Cellular Uptake of Decitabine by Equilibrative Nucleoside Transporters in HCT116 Cells

Abstract

DNA hypermethylation, an epigenetic change that silences gene expression without altering nucleotide sequences, plays a critical role in the formation and progression of colorectal cancers as well as in the acquisition of drug resistance. Decitabine (DAC), a DNA methyltransferase 1 inhibitor of nucleoside analogues, has been shown to restore gene expression silenced by hypermethylation. In the present study, the mechanisms underlying both uridine and DAC uptake were examined in the human colon cancer cell line HCT116. Real-time polymerase chain reaction analysis revealed that ENT1 mRNA was the most abundant among the nucleoside transporters examined in HCT116 cells. The ENT1 protein was detected in the membrane fraction, as determined by Western blotting. The uptake of uridine or DAC was time- and concentration-dependent, but also Na⁺-independent. The uptake of these agents was inhibited by S-(4-nitrobenzyl)-6-thioinosine (NBMPR), an inhibitor of equilibrative nucleoside transporters (ENTs), and was also decreased in cells treated with ENT1 small interfering RNA. The uptake of both uridine and DAC was inhibited by uridine, cytidine, adenosine, or inosine, while that of DAC was also inhibited by thymidine. The expression of MAGEA1 mRNA, the DNA of which was methylated in HCT116 cells, was increased by DAC treatment, and this increment was attenuated by concomitant treatment with NBMPR. The IC₅₀ value of DAC was also increased in the presence of NBMPR. These results suggest that DAC is mainly taken up by ENT1 and that this uptake is one of the key determinants of the activity of DAC in HCT116 cells.

Colorectal cancer is the second most common cancer in females and third most common cancer in males worldwide including Japan.^1,2) Approximately 600000 people die from this cancer in the world each year. The majority of colon cancers arise sporadically, and the deficient expression of DNA repair genes has frequently been observed in these sporadic colorectal cancers. Previous studies reported that this deficient expression was often due to epigenetic alterations that did not include changes in the DNA sequence.^3,4) DNA hypermethylation is one of the epigenetic alterations in colorectal cancers that occur in the CG-rich regions of the promoter region of protein-coding genes. These changes cause the transcriptional silencing of cancer-related genes such as tumor suppressor genes.³⁾ DNA hypermethylation also plays a critical role in the acquisition of drug resistance by colorectal cancers. For example, promoter methylation of the DNA mismatch repair gene, human MLH1, has been associated with the loss of DNA mismatch repair and resistance to 5-FU in colon cancer cell lines or to cisplatin, carboplatin, temozolomide, or epirubicin in human tumor xenografts.^5,6)

Decitabine (5-aza-2′-deoxycytidine; DAC) is a DNA methyltransferase 1 inhibitor that restores gene expression silenced as a result of DNA hypermethylation.^7,8) Several studies have demonstrated that treatments with DAC restored the expression of methylation-regulated genes including p16, E-cadherin, and MLH1, and suppressed the growth of cancer cells.^9–12) DAC has also been shown to reverse resistance to a number of anticancer agents used in the treatment of colorectal cancers.^5,6,13,14) DAC has already been approved for the treatment of myelodysplastic syndrome and other hematological malignancies such as leukemias and lymphomas by the U.S. Food and Drug Administration.

To change the methylation status of DNA, DAC must be taken up by cancer cells. Intracellular transport across plasma membranes is crucial for the uptake of this highly hydrophilic molecule. Nucleosides and nucleotides were found to be mostly taken up by equilibrative nucleoside transporters (ENTs) and concentrative nucleoside transporters (CNTs).^15,16) ENTs are a family of facilitated diffusion transporter systems that transport nucleosides in both directions in a Na⁺-independent manner. Of the four proteins in ENTs, ENT1 and ENT2 are membrane-bound transporters. ENT1 transports pyrimidine and purine nucleosides, is ubiquitously distributed in human tissues, and was shown to be inhibited at a low concentration (0.1 µM) of S-(4-nitrobenzyl)-6-thioinosine (NBMPR).^15–17) ENT2 transports pyrimidine and purine nucleosides and nucleobases, its expression is highest in skeletal muscle, and it is only inhibited by a high concentration (100 µM) of NBMPR.^15–17) On the other hand, CNTs are Na⁺-dependent; CNT1 and CNT2 preferentially transport pyrimidine and purine nucleosides, respectively, whereas CNT3 has been shown to transport both purine and pyrimidine nucleosides. The uptake of DAC by these transporters was examined by a gene transfer technique using Saccharomyces cerevisiae cells and Xenopus laevis oocytes, and was shown to occur in the following decreasing order; ENT1>CNT1≫ENT2 and CNT2.¹⁸⁾ The cytotoxic potency of azacytidine, a DNA demethylating agent similar to DAC, was correlated with ENT1 expression using oligonucleotide arrays to analyze the gene expression of these transporters and channels in 60 human cancer cell lines.¹⁹⁾ Furthermore, ENT1 was identified as a key transporter in the cellular uptake of azacytidine in human leukemia cells.²⁰⁾ However, the transporters responsible for DAC uptake in cells in which DNA methylation levels are affected by DAC have not yet been identified.

HCT116 has been well characterized for the epigenetic regulation of genes including cancer promoting genes. DAC was previously shown to regulate p16 DNA methylation and gene expression in seven cancer cell lines including HCT116 cells.¹²⁾ The DAC analogue azacytidine was found to decrease the global level of DNA methylation and to downregulate DNMT1 and DNMT3a gene transcription in HCT116 cells at 3 to 4 d.²¹⁾ We also examined the DNA demethylating effects of DAC on various solute carrier (SLC) transporters in 4 human colon cancer cell lines, and found that DAC increased the mRNA levels of four SLC transporters examined in HCT116 cells.²²⁾ Since DAC has various effects on DNA demethylation and cell survival in HCT116 cells, DAC may be taken up intracellularly to markedly high levels, and this DAC uptake may be related to the effects of DAC on DNA demethylation and cell survival in HCT116 cells. In the present study, we attempted to characterize the cellular uptake of uridine and DAC, and showed that DAC was mainly taken up by ENT1, similar to uridine, a typical substrate for ENT1, in HCT116 cells.

MATERIALS AND METHODS

Materials

The human colon carcinoma cell line HCT116 was purchased from DS Pharmabiomedical (Osaka, Japan). McCoy’s 5A medium and penicillin-streptomycin were purchased from Life Technologies Corp. (Carlsbad, CA, U.S.A.). Fetal bovine serum (FBS) was purchased from Biosource (Rockville, MD, U.S.A.). A rabbit polyclonal anti-ENT1 antibody (ab48607) was purchased from Abcam plc. (Cambridge, U.K.). A mouse monoclonal anti-β actin antibody (sc-47778), goat anti-rabbit immunoglobulin G-horseradish peroxidase (IgG-HRP) (sc-2004), goat anti-mouse IgG-HRP (sc-2005), human ENT1 small interfering RNA (siRNA) (sc-60583) and negative control (NC) siRNA (Stealth RNAi Negative Control Duplexes, Medium GC Duplex #2) were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, U.S.A.). [³H]-Uridine (377.4 GBq/mmol) and [³H]-DAC (259 GBq/mmol) were purchased from Moravek Biochemicals Inc. (Brea, CA, U.S.A.). All other chemicals were of the highest grade commercially available.

Cell Culture

HCT116 cells were cultured in McCoy’s 5A Medium supplemented with 10% FBS, 100 U/mL penicillin, and 100 µM streptomycin at 37°C in 5% CO₂–95% air, and subcultured every 3–4 d at a 1 : 10 dilution, with media changed every 3 d, as indicated in the instruction manual.

Real-Time Polymerase Chain Reaction (PCR)

Real-time PCR was performed as described previously.²²⁾ Briefly, total RNA was extracted from HCT116 cells by the spin column method using the RNeasy Mini Kit (QIAGEN, Valencia, CA, U.S.A.), including on-column DNA digestion using the RNase-free DNase set (QIAGEN). Total RNA was reverse-transcribed into cDNA using a ReverTra Ace qPCR Kit (TOYOBO, Osaka, Japan). Real-time PCR was performed on a Miniopticon System (Bio-Rad, Hercules, CA, U.S.A.) using SYBR Green. The primers used in the present study are shown in Table 1. The expression level of each mRNA was normalized to that of ribosomal protein 27 (RPL27) as a housekeeping gene.

Table 1. Primers Used for Real-Time PCR Analysis

Gene name	Sense (5′–3′) primer	Antisense (5′–3′) primer	Size (base pair)
ENT1	GCTGGGTCTGACCGTTCTAT	AAGGCAGTAACGTGGCAACT	149
ENT2	CTTGGAAGGAGTCAGGCAAG	GAGGAGAGAGAGGGGATTGG	116
ENT3	GTCATCCTGGCCATCTTCAT	GGATCACCATGCAGACAATG	103
ENT4	TGCAGCAATCCAGCTTCTACGGG	TGCGGCTCAGAGAGATCATCACG	108
CNT1	TCCCCACAGAGACGTGTGCTTC	TGGCCACAGGTGTGAGAGAGATG	130
CNT2	TACATTGAGGGCAGGCTCAGCG	CATGGGGGCTTTCCTGCCATTG	71
CNT3	TGGAAACACAACCAAGGTGA	CGATGGATTCAACAATGTGC	139

Western Blot Analysis

HCT116 cells were seeded on 100-mm dishes at 6.0×10⁴ cells/dish 4 d prior to protein extraction, with the medium being changed a day before the extraction. Proteins were extracted from HCT116 cells using the ProteoExtract^® Transmembrane Protein Extraction Kit (Calbiochem, La Jolla, CA, U.S.A.), according to the manufacturer’s instructions, in order to separately evaluate the expression of ENT1 in a membrane fraction and cytosol fraction. Solution A in the kit was utilized to extract proteins from the membrane fraction. The protein concentration of the extract was determined by the Protein Assay Bicinchoninate Kit (Nacalai Tesque, Inc., Kyoto, Japan). Electrophoresis of the extracted proteins was performed using NuPAGE Novex^® 10% Bis-Tris Gels (Life Technologies, Carlsbad, CA, U.S.A.). Western blotting was performed using the iBlot^® Gel Transfer System (Life Technologies). Blocking One (Nacalai Tesque), Signal Enhancer HIKARI for Western blotting and ELISA (Nacalai Tesque), a rabbit polyclonal anti-ENT1 antibody at a 1/500 dilution as the primary antibody, and goat anti-rabbit IgG-HRP at a 1/2000 dilution as the secondary antibody were used to detect ENT1. ENT1 was also detected using Chemi-Lumi One Super (Nacalai Tesque) as the chemiluminescent reagent and Image Quant LAS-4000 (GE Healthcare UK Ltd., Buckinghamshire, U.K.) as the detector.

Intracellular Uptake Studies

HCT116 cells were seeded on 35-mm dishes at 1.0×10⁴ cells/dish 4 d prior to the uptake experiments, with medium being changed a day before the experiments. Uptake studies were performed in Hanks’ balanced sodium solution (HBSS) (Na⁺(+)) containing 136.9 mM NaCl, 5.4 mM KCl, 1.3 mM CaCl₂, 0.8 mM MgSO₄, 0.3 mM Na₂HPO₄, 0.4 mM KH₂PO₄, 4.2 mM NaHCO₃, 5.56 mM D-glucose, and 25 mM HEPES, pH 7.2, or HBSS (Na⁺(−)), with NaCl, NaHCO₃, and Na₂HPO₄ being replaced by choline chloride, KHCO₃, and K₂HPO₄, respectively. After being preincubated with HBSS for 10 min for equilibration at 37°C or 4°C, cells were replaced with HBSS containing 37 kBq/mL [³H]-uridine or [³H]-DAC with non-radiolabeled uridine or DAC at 37°C or 4°C. The concentration of total uridine or DAC in the incubation buffer was adjusted by adding cold uridine or DAC. NBMPR (0.1 µM or 100 µM) and other inhibitors were also included in the incubation buffers for inhibition analysis. After being incubated for the indicated times, cells were washed three times with ice-cold HBSS and then lysed in 500 µL of 0.1 M NaOH per dish. An aliquot was sampled and measured for radioactivity with a Tri-carb 2900 Liquid Scintillation Counter (PerkinElmer, Inc., Waltham, MA, U.S.A.) using Emulsifier Scintillation Plus (PerkinElmer, Inc.) as the scintillation cocktail. The amount of protein per dish was determined using the Bio-Rad Protein Assay (Bio-Rad, Hercules, CA, U.S.A.) with bovine serum albumin as the standard.

siRNA Transfection

siRNAs were transfected using Lipofectamine RNAiMAX (Invitrogen) immediately after seeding the cells onto dishes at a final siRNA concentration of 10 nM, as indicated in the instruction manual. NC cells were transfected with NC siRNA. The mRNA levels of ENT1 and uptake of uridine and DAC were examined 4 d after the transfection of siRNAs.

Cytotoxic Assay

HCT116 cells were seeded on 96-well plates at 4000 cells/well. DAC and/or NBMPR were added to each well at final concentrations of 0–100 µM and 0, 0.1 or 100 µM, respectively, 24 h after seeding. Cytotoxicity was determined by the WST-8 method using Cell Counting Kit-8 (Dojindo, Kumamoto, Japan) 72 h after the treatment.

Analytical Methods

The apparent kinetic parameters K_m (Michaelis constant), V_max (maximal transport rate), and K_d (nonsaturable first order rate constant) of uridine and DAC uptake were calculated by Levenberg–Marquardt algorithm according to the following Michaelis–Menten type equations, where v and [s] are the velocity of substrate uptake and substrate concentration, respectively.

  

(1)

Levenberg–Marquardt algorithm was performed using Kaleida Graph Ver. 4 (Hulinks Inc., Tokyo, Japan).

All data were expressed as means±standard deviation (S.D.), and statistical analyses were performed with either the Student’s t-test or one-way ANOVA test followed by Dunnett’s test.

RESULTS

Expression of ENT and CNT mRNAs

ENT1, ENT2, CNT1, CNT2, and CNT3 mRNA levels in HCT116 cells were examined by the quantitative real-time PCR method. As shown in Fig. 1A, ENT1 mRNA was the most abundant among the nucleotide transporters examined. The expression level of ENT2 mRNA was approximately 5% that of ENT1 mRNA. On the other hand, CNT1, CNT2, and CNT3 mRNAs could not be detected in the present study. Western blot analysis of ENT1 in Fig. 1B showed that ENT1 was expressed in the membrane fraction, but not in the cytosol fraction of HCT116 cells.

Fig. 1. Expression of ENT1, ENT2, CNT1, CNT2, and CNT3 mRNAs (A) and the ENT1 Protein (B) in HCT116 Cells

The expression levels of ENT and CNT mRNAs in A were normalized to that of RLP27. Each column represents the mean±S.D. of 3 independent experiments. ND: not detected.

Time Course and Concentration Dependence of [³H]-Uridine and [³H]-DAC Uptake

Figures 2A and B show the time courses of 0.1 µM [³H]-uridine and [³H]-DAC uptake in the presence of Na⁺ in HCT116 cells, respectively. The uptake of [³H]-uridine at 37°C increased linearly up to 5 min, while that of [³H]-DAC increased linearly up to 2 min at 37°C. The uptake of both [³H]-uridine and [³H]-DAC was markedly lower at 4°C than at 37°C.

Fig. 2. Time Course (A, B) and Concentration Dependency (C, D) of [³H]-Uridine (A, C) and [³H]-DAC Uptake (B, D)

Open circles (○) and closed circles (●) represent uptake at 37°C and 4°C, respectively, in A and B. The final concentrations of uridine and DAC were adjusted with non-radiolabeled uridine and DAC to 0.1 µM. Each symbol is the mean±S.D. of 3 independent experiments.

Concentration dependence for [³H]-uridine and [³H]-DAC uptake at 37°C for 5 and 2 min is shown in Figs. 2C and D, respectively. The kinetic parameters for [³H]-uridine uptake were calculated using Eq. 1 as follows; V_max=3.19±0.29 nmol/5 min/mg protein, K_m=26.3±7.0 µM and K_d=5.45±0.35 µL/5 min/mg protein. The kinetic parameters for [³H]-DAC uptake were calculated using Eq. 1 as follows; V_max=58.2±11.3 pmol/2 min/mg protein, K_m=1.09±0.63 µM and K_d=7.61±0.31 µL/2 min/mg protein. These findings suggested that DAC was taken up via ENT1 in HCT116 cells with higher affinity and lower capacity than those of uridine.

Characterization of [³H]-Uridine and [³H]-DAC Uptake

To exclude the possibility of Na⁺-dependent transport systems, the uptake of both [³H]-uridine and [³H]-DAC uptake was determined in the presence or absence of Na⁺ in the incubation buffer. The uptake of neither [³H]-uridine nor [³H]-DAC was influenced by the presence or absence of Na⁺, which indicated that CNTs may not be involved in the uptake of uridine and DAC in HCT116 cells (Figs. 3A, B).

Fig. 3. Effects of Na⁺ (A, B) and NBMPR (C, D) on the Uptake of Both [³H]-Uridine (A, C) and [³H]-DAC (B, D) and the Effects of ENT1 siRNA on ENT1 mRNA Levels (E) and Uptake of [³H]-Uridine (F) and [³H]-DAC (G)

The final concentrations of uridine and DAC were adjusted with non-radiolabeled uridine and DAC to 0.1 µM for A–D, F, and G. Each column is the mean±S.D. of 3 independent experiments. * Significantly different from 0 µM NBMPR or NC siRNA at p<0.05.

The effect of NBMPR on the uptake of both [³H]-uridine and [³H]-DAC at 5 min was examined to investigate whether ENTs participated in their uptake, and is shown in Figs. 3C and D. The uptake of [³H]-uridine at 0.1 µM was inhibited in the presence of 0.1 µM and 100 µM NBMPR to approximately 30% and 2% of the control, respectively (Fig. 3C). The uptake of [³H]-DAC at 0.1 µM in the presence of 0.1 µM and 100 µM NBMPR was approximately 30% and 2% of the control, respectively (Fig. 3D).

Effects of the ENT1 siRNA Treatment on [³H]-Uridine and [³H]-DAC Uptake

To confirm that ENT1 was responsible for the uptake of both uridine and DAC in HCT116 cells, the uptake of [³H]-uridine and [³H]-DAC was examined in cells transfected with ENT1 siRNA (Figs. 3E–G). ENT1 mRNA expression in ENT1 siRNA-treated cells was suppressed to 5% that of negative control (NC) cells (Fig. 3E). The uptake of 0.1 µM [³H]-uridine and 0.1 µM [³H]-DAC in ENT1 siRNA-treated cells was decreased to approximately 25% and 47% that in NC cells, respectively (Figs. 3F, G).

Effects of Nucleosides on [³H]-Uridine and [³H]-DAC Uptake

Figures 4A and B show the effects of pyrimidine and purine nucleosides on [³H]-uridine and [³H]-DAC uptake, respectively. Among the pyrimidine nucleosides examined, uridine and cytidine markedly inhibited [³H]-uridine uptake, whereas thymidine did not (Fig. 4A). On the other hand, uridine, cytidine, and thymidine significantly inhibited [³H]-DAC uptake (Fig. 4B). Among the purine nucleosides examined, adenosine and inosine significantly inhibited both [³H]-uridine and [³H]-DAC uptake, while guanosine inhibited neither [³H]-uridine nor [³H]-DAC uptake (Figs. 4A, B).

Fig. 4. Effects of Nucleoside Analogs on [³H]-Uridine (A) and [³H]-DAC (B) Uptake

The final concentrations of uridine and DAC were adjusted to 0.1 µM with non-radiolabeled uridine or DAC. The concentration of inhibitors was 1 mM for nucleosides, except for adenosine (0.5 mM) and guanosine (0.33 mM). Each column is the mean±S.D. of 3 independent experiments. * Significantly different from the control at p<0.05.

Effects of DAC on MAGEA1 mRNA Expression and Cytotoxicity

To determine whether ENT-mediated DAC uptake affected DAC activities in HCT116 cells, we examined the effects of DAC on MAGEA1 mRNA expression levels using real-time PCR (Fig. 5A). MAGEA1 is a gene that encodes the melanoma-associated antigen 1 protein, which has been identified as one of the tumor antigens observed in many tumors and can be activated by DAC in several colorectal tumor cell lines including HCT116.²³⁾ A previous study reported that MAGEA1 promoter methylation was decreased by a DAC treatment in HCT116.²⁴⁾ In the present study, MAGEA1 mRNA expression levels were very low at 0 µM DAC, but markedly increased in the presence of DAC in a concentration-dependent manner (Fig. 5A). This increase was attenuated to 42% and 1% that of control in the presence of 0.1 and 100 µM NBMPR (Fig. 5B). We also examined the cell survival of DAC in the absence or presence of NBMPR, and found that 0.1 and 100 µM NBMPR could protect against DAC cytotoxicity (Fig. 5C). The IC₅₀ values for DAC in the absence and presence of 0.1 and 100 µM NBMPR were 1.10±0.29, 4.63±0.13, and >100 µM, respectively.

Fig. 5. Effects of DAC on MAGEA1 mRNA Expression (A), Effects of NBMPR on MAGEA1 mRNA Expression in the Presence of 1 µM DAC (B), and Effects of NBMPR on Cell Survival in the Presence of DAC (C)

Open circles (○), closed triangles (▲), and closed squares (■) represent cell survival in the absence and presence of 0.1 µM and 100 µM NBMPR, respectively (C). Each column and symbol is the mean ±S.D. of at least 3 independent experiments. * Significantly different from 0 µM DAC in A and 0 µM NBMPR in B at p<0.05.

DISCUSSION

In the present study, we demonstrated that DAC was mainly transported intracellularly by ENT1 in HCT116 cells. HCT116 cells expressed ENT1 mRNA most abundantly among the nucleoside transporters examined, and the ENT1 protein was detected in the membrane fraction of HCT116 cells by Western blotting. The uptake of DAC was Na⁺-insensitive and NBMPR-sensitive, similar to the uptake of uridine. We also demonstrated that ENT1-mediated transport into HCT116 cells was one of the key determinants of DAC activities such as DNA demethylation and cellular toxicity.

ENT1 has been classified as one of the membrane transporters for the uptake of nucleosides into cells in facilitated-diffusion and Na⁺-independent manners.¹⁵⁾ In the present study, we showed the concentration-dependent uptake of uridine and DAC, suggesting the facilitated-diffusion uptake of uridine and DAC (Figs. 2C, D). We also showed the Na⁺ independence and NBMPR sensitivity, two of the major characteristics of ENT1 transport, of the uptake of both uridine and DAC (Figs. 3A–D). NBMPR inhibited the transport of both 0.1 µM uridine and 0.1 µM DAC to approximately one-third that of the control at a concentration as low as 0.1 µM. We also demonstrated that the uptake of both uridine and DAC was decreased by the knockdown of ENT1 due to the ENT1 siRNA treatment (Figs. 3F, G). Since uridine is often used as a substrate of ENT1 and the chemical structure of DAC closely resembles that of uridine, we considered that DAC was mainly transported by ENT1 in HCT116 cells.

We also demonstrated that the ENT1-mediated transport of DAC was important for its DNA demethylating activity and cytotoxicity in HCT116 cells. The attenuation of elevations in MAGEA1 mRNA levels by DAC in the presence of 0.1 and 100 µM NBMPR corresponded with DAC uptake levels, as shown in Figs. 5A and B. Cell survival for DAC in the presence of 0.1 and 100 µM NBMPR also appeared, at least in part, to correspond to DAC uptake levels. From the intracellular uptake study shown in Fig. 3D, the intracellular level of DAC in the presence of 0.1 and 100 µM NBMPR would be about 30% and 2% that in the absence of NBMPR, respectively (Fig. 3D). Furthermore, cell survival at 1 µM DAC in the presence of 0.1 and 100 µM NBMPR was similar to that at 0.1–0.3 µM and <0.03 µM DAC, respectively (Fig. 5C). A similar phenomenon was also observed with the uptake of ribavirin by hepatic cells.²⁵⁾

ENT1 is involved in the uptake of the various anticancer agents of nucleoside analogs including gemcitabine and cytarabine into cancer cells.^26,27) However, the clinical importance of ENT1 as a biological marker for cancer treatments using nucleoside analogs remains controversial; some metabolizing enzymes such as deoxycytidine kinase may be more important for determining the effects of anticancer agents. Although we could not clarify the clinical importance of ENT1-mediated DAC transport in the present study, we showed that the entry of DAC via ENT1 into cancer cells was necessary for exerting anticancer effects, at least in HCT116 cells.

The K_m value for DAC uptake we have observed in HCT116 cells (1.09 µM) was about 1/900 that of the K_i value against uridine transport reported in the previous study (996 µM).¹⁸⁾ If DAC inhibits uridine transport via ENT1 in a similar manner as to the competitive inhibition of enzyme reactions, K_m and K_i values would be similar to each other. However, there are few pieces of information concerning how the substrates are transported through the transporter proteins and how their transport is inhibited by the other substrates and/or inhibitors. Various inhibition experiments for these compounds as substrates and/or inhibitors would be required to clarify the question.

In conclusion, we demonstrated that DAC was mainly transported intracellularly via ENT1 and this ENT1-mediated transport was one of the key determinants for DAC activities in cancer cells. These results provide valuable information for the use of DAC as an anticancer agent in colorectal cancer chemotherapy.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J. Clin., 61, 69–90 (2011).
• 2) Matsuda A, Matsuda T, Shibata A, Katanoda K, Sobue T, Nishimoto H, The Japan Cancer Surveillance Research Group. Cancer incidence and incidence rates in Japan in 2007: A study of 21 population-based cancer registries for the Monitoring of Cancer Incidence in Japan (MCIJ) project. Jpn. J. Clin. Oncol., 43, 328–336 (2013).
• 3) Goel A, Boland CR. Epigenetics of colorectal cancer. Gastroenterology, 143, 1442–1460.e1 (2012).
• 4) Roy S, Majumdar APN. Cancer stem cells in colorectal cancer: genetic and epigenetic changes. J. Stem Cell Res. Ther., S7 (Suppl. 7), 006 (2012).
• 5) Arnold CN, Goel A, Boland CR. Role of hMLH1 promoter hypermethylation in drug resistance to 5-fluorouracil in colorectal cancer cell lines. Int. J. Cancer, 106, 66–73 (2003).
• 6) Plumb JA, Strathdee G, Sludden J, Kaye SB, Brown R. Reversal of drug resistance in human tumor xenografts by 2′-deoxy-5-azacytidine-induced demethylation of the hMLH1 gene promoter. Cancer Res., 60, 6039–6044 (2000).
• 7) Stresemann C, Lyko F. Modes of action of the DNA methyltransferase inhibitors azacytidine and decitabine. Int. J. Cancer, 123, 8–13 (2008).
• 8) Jabbour E, Issa JP, Garcia-Manero G, Kantarjian H. Evolution of decitabine development; accomplishments, ongoing investigations, and future strategies. Cancer, 112, 2341–2351 (2008).
• 9) Gonzalez-Zulueta M, Bender CM, Yang AS, Nguyen T, Beart RW, Van Tornout JM, Jones PA. Methylation of the 5′ CpG island of the p16/CDKN2 tumor suppressor gene in normal and transformed human tissues correlates with gene silencing. Cancer Res., 55, 4531–4535 (1995).
• 10) Yoshiura K, Kanai Y, Ochiai A, Shimoyama Y, Sugimura T, Hirohashi S. Silencing of the E-cadherin invasion-suppressor gene by CpG methylation in human carcinomas. Proc. Natl. Acad. Sci. U.S.A., 92, 7416–7419 (1995).
• 11) Herman JG, Umar A, Polyak K, Graff JR, Ahuja N, Issa J-PJ, Markowitz S, Willson JKV, Hamilton SR, Kinzler KW, Kane MF, Kolodner RD, Vogelstein B, Kunkel TA, Baylin SB. Incidence and functional consequences of hMLH1 promoter hypermethylation in colorectal carcinoma. Proc. Natl. Acad. Sci. U.S.A., 95, 6870–6875 (1998).
• 12) Bender CM, Pao MM, Jones PA. Inhibition of DNA methylation by 5-aza-2′-deoxycytidine suppresses the growth of human tumor cell lines. Cancer Res., 58, 95–101 (1998).
• 13) Ishiguro M, Iida S, Uetake H, Morita S, Makino H, Kato K, Takagi Y, Enomoto M, Sugihara K. Effect of combined therapy with low-dose 5-aza-2′-deoxycytidine and irinotecan on colon cancer cell line HCT-15. Ann. Surg. Oncol., 14, 1752–1762 (2007).
• 14) Miyaki Y, Suzuki K, Koizumi K, Kato T, Saito M, Kamiyama H, Maeda T, Shibata K, Shiya N, Konishi F. Identification in of a potent epigenetic biomarker for resistance to camptothecin and poor outcome to irinotecan-based chemotherapy in colon cancer. Int. J. Oncol., 40, 217–226 (2012).
• 15) Choi JS, Berdis AJ. Nucleoside transporters: biological insights and therapeutic applications. Future Med. Chem., 4, 1461–1478 (2012).
• 16) Podgorska M, Kocbuch K, Pawelczyk T. Recent advances in studies on biochemical and structural properties of equilibrative and concentrative nucleoside transporters. Acta Biochim. Pol., 52, 749–758 (2005).
• 17) Ward JL, Sherali A, Mo Z-P, Tse C-M. Kinetic and pharmacological properties of cloned human equilibrative nucleoside transporters, ENT1 and ENT2, stably expressed in nucleoside transporter-deficient PK15 cells. J. Biol. Chem., 275, 8375–8381 (2000).
• 18) Damaraju VL, Mowles D, Yao S, Ng A, Young JD, Cass CE, Tong Z. Role of human nucleoside transporters in the uptake and cytotoxicity of azacitidine and decitabine. Nucleosides Nucleotides Nucleic Acids, 31, 236–255 (2012).
• 19) Huang Y, Anderle P, Bussey KJ, Barbacioru C, Shankavaram U, Dai Z, Reinhold WC, Papp A, Weinstein JN, Sadée W. Membrane transporters and channels: role of the transportome in cancer chemosensitivity and chemoresistance. Cancer Res., 64, 4294–4301 (2004).
• 20) Hummel-Eisenbeiss J, Hascher A, Hals P-A, Sandvold ML, Muller-Tidow C, Lyko F, Rius M. The role of human equilibrative nucleoside transporter 1 on the cellular transport of the DNA methyltransferase inhibitors 5-azacytidine and CP-4200 in human leukemia cells. Mol. Pharmacol., 84, 438–450 (2013).
• 21) Schneider-Stock R, Diab-Assef M, Rohrbeck A, Foltzer-Jourdainne C, Boltze C, Hartig R, Schönfeld P, Roessner A, Gali-Muhtasib H. 5-Aza-cytidine is a potent inhibitor of DNA methyltransferase 3a and induces apoptosis in HCT-116 colon cancer cells via Gadd45- and p53-dependent mechanisms. J. Pharmacol. Exp. Ther., 312, 525–536 (2005).
• 22) Ikehata M, Ueda K, Iwakawa S. Different involvement of DNA methylation and histone deacetylation in the expression of solute-carrier transporters in 4 colon cancer cell lines. Biol. Pharm. Bull., 35, 301–307 (2012).
• 23) Karpf AR, Lasek AW, Ririe TO, Hanks AN, Grossman DO, Jones DA. Limited gene activation in tumor and normal epithelial cells treated with the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine. Mol. Pharmacol., 65, 18–27 (2004).
• 24) Al-Salihi M, Yu M, Burnett DM, Alexander A, Samlowski W, Fitzpatrick FA. The depletion of DNA methyltransferase-1 and the epigenetic effects of 5-aza-2′-deoxycytidine (decitabine) are differentially regulated by cell cycle progression. Epigenetics, 6, 1021–1028 (2011).
• 25) Iikura M, Furihata T, Mizuguchi M, Nagai M, Ikeda M, Kato N, Tsubota A, Chiba K. ENT1, a ribavirin transporter, plays a pivotal role in antiviral efficacy of ribavirin in a hepatitis C virus replication cell system. Antimicrob. Agents Chemother., 56, 1407–1413 (2012).
• 26) Mackey JR, Mani RS, Selner M, Mowles D, Young JD, Belt JA, Crawford CR, Cass CE. Functional nucleoside transporters are required for gemcitabine influx and manifestation of toxicity in cancer cell lines. Cancer Res., 58, 4349–4357 (1998).
• 27) Wiley JS, Jones SP, Sawyer WH, Paterson AR. Cytosine arabinoside influx and nucleoside transport sites in acute leukemia. J. Clin. Invest., 69, 479–489 (1982).