Dibenzoylmethane Suppresses Lipid Accumulation and Reactive Oxygen Species Production through Regulation of Nuclear Factor (Erythroid-Derived 2)-Like 2 and Insulin Signaling in Adipocytes

Abstract

The aim of this study was to investigate the effects of dibenzoylmethane (1,3-diphenyl-1,3-propanedione, DBM) from licorice roots on lipid accumulation and reactive oxygen species (ROS) production in 3T3-L1 cells. DBM effectively inhibited lipid accumulation during adipogenesis, and its inhibitory effect was shown to be due to the down-regulation of adipogenic factors such as CCAAT-enhancer-binding protein-α (C/EBPα), peroxisome proliferator-activated receptor γ (PPARγ), and fatty acid-binding protein 4 (FABP4). DBM was observed to exert its inhibitory effect on lipid accumulation in the early adipogenic stage (days 0–2) by regulating early adipogenic factors including CCAAT-enhancer-binding protein-β (C/EBPβ) and Krueppel-like factor (KLF) 2. DBM significantly increased the translocation of nuclear factor (erythroid-derived 2)-like 2(Nrf2) into the nucleus, promoting the protein expression of its target gene, heme oxygenase-1 (HO-1). DBM significantly suppressed the insulin-mediated activation of phosphoinositide 3-kinase (PI3K) and protein kinase B (Akt), which are components of insulin signaling. In addition, intracellular ROS production was effectively reduced by DBM treatment, which upregulated antioxidant genes such as glutathione peroxidase (Gpx), catalase (CAT), and superoxide dismutase 1 (SOD1). Furthermore, DBM significantly regulated the expression of the adipokines, resistin and adiponectin. This DBM-mediated regulation of lipid accumulation, ROS production, and adipokine production was shown to be involved in the regulation of the Nrf2 and insulin signaling.

Dibenzoylmethane (DBM), an aromatic 1,3-diketone analog of curcumin, is a constituent of licorice, the root of Glycyrrhiza glabra^1,2) (Fig. 1). As licorice is sweeter than sugar, it has been extensively used as a food additive.²⁾ Licorice has long been used as a medicine in addition to being used as a food in Western and Eastern countries.³⁾ Recently, many studies have shown that licorice extract has various biological effects such as hepatoprotective, hypnotic, and gastroprotective activities.^4–7) DBM, a licorice-derived compound, has also been shown to have diverse bioactive effects, including anti-mutagenesis, anti-tumorigenesis, cell cycle regulation, anti-photoaging, and anti-estrogenic activities.^1,8–11) A recent study showed that DBM suppresses lipid-synthesis genes with a reduction in body weight.¹⁰⁾ However, a detailed mechanism for DBM-mediated inhibition of lipid accumulation and reactive oxygen species (ROS) production with antioxidant response in adipocytes has not been reported thus far.

Fig. 1. Experimental Time Schedule

Lipid accumulation in adipocytes is accomplished via adipocyte differentiation, which accompanies a morphological change from fibroblastic cells to round, fat-containing cells.¹²⁾ Differentiation of preadipocytes is experimentally executed by adding differentiation inducer, called a hormonal cocktail, which is composed of insulin, dexamethasone (DEX), and 3-isobutyl-1-methylxanthine (IBMX).¹²⁾ These hormonal signals induce the expression of a series of transcription factors that are responsible for regulating adipocyte-specific genes and are involved in lipid synthesis.^13,14) In the early stage of differentiation, the transcription factors, CCAAT-enhancer-binding proteins (C/EBP)β and δ are expressed and lead to the continuous expression of other transcription factors such as C/EBPα and peroxisome proliferator-activated receptor γ (PPARγ), which are major adipogenic factors.¹⁵⁾ C/EBPα and PPARγ, which are expressed in late adipogenic stage, are known to promote the expression of lipid synthesis genes, such as adipocyte fatty acid binding protein aP2 (FABP4), by binding to their promoter/enhancer regions.¹⁶⁾ These transcription factors interact with each other to coordinate the regulation of lipid metabolism.¹⁴⁾

ROS are naturally produced during various metabolic processes and play an important role in maintaining normal cellular functions, including proliferation and signaling.^17,18) However, excessive production of ROS leads to cell damage, through the attack of important cellular molecules, thereby inducing oxidative stress—a pathological state.¹⁷⁾ Oxidative stress also occurs because of various risk factors, such as exposure to pollutants, smoking, stress, and unhealthy diets.¹⁹⁾ Oxidative stress is one of the most important factors that mediates the development of chronic diseases, including obesity, inflammation, and cancer.²⁰⁾ However, cells have a protective system to neutralize ROS-mediated cellular stress and toxicity.²¹⁾ Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) is a transcription factor best known as an intracellular, protective regulator of oxidative stress. The regulation of Nrf2 has been implicated in various disease conditions.²¹⁾

Obesity is a complex disease in which ROS-mediated oxidative stress is known to be enhanced.²⁰⁾ Therefore, the regulation of oxidative stress may be a way to manage obesity and metabolic diseases, and Nrf2 may be a good target, as it is an important regulatory component in the control of obesity and obesity-related diseases. In this study, we investigated the effect of DBM on the lipid accumulation and ROS production which are associated with the regulation of Nrf2.

MATERIALS AND METHODS

Materials

DBM was purchased from Fluka (Fluka/Sigma-Aldrich, Germany). Dulbecco’s modified Eagle’s medium (DMEM), bovine serum (BS), and insulin were purchased from Gibco (Gaithersburg, MD, U.S.A.). Fetal bovine serum (FBS), penicillin-streptomycin (PS), and phosphate-buffered saline (PBS) were obtained from Hyclone (Logan, UT, U.S.A.). DEX, IBMX, Oil Red O (ORO), hydrogen peroxide, and N-acetylcysteine (NAC), and 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA) were purchased from Sigma-Aldrich Chemical Co. (St. Louis, MO, U.S.A.). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was purchased from Amresco Inc. (Solon, OH, U.S.A.). Nitroblue tetrazolium (NBT) was obtained from Life Technology (Eugene, OR, U.S.A.).

Cell Culture

3T3-L1 preadipocytes were cultured in 6- or 24-well plates. 3T3-L1 preadipocytes were grown in DMEM containing 3.7 mg/mL sodium bicarbonate, 10% BS, and 1% PS. Two days after reaching confluency, 3T3-L1 cells were allowed to differentiate using DMEM containing 1% PS, 10% FBS, and a differentiation cocktail (1 µM DEX, 0.5 mM IBMX, and 1.67 µM insulin). After 48 h, the culture medium was replaced with DMEM supplemented with 1.67 µM insulin and 10% FBS for 2 d. The differentiated culture was maintained with DMEM containing 10% FBS; media were changed every other day until the indicated time. For treatment, DBM dimethylsulfoxide (DMSO, 0.1%), hydrogen peroxide (50 µM) or NAC (10 mM) was added every 2 d starting from 2 d after confluency. Cells were cultured and allowed to differentiate 37°C under 5% CO₂ and 95% humidity. ND indicates the not-differentiated preadipocyte, and CON signifies the fully differentiated adipocyte. Subsequent analyses were performed at appropriated time conditions (Fig. 1).

MTT Assay

For analyzing cell viability, an MTT assay was performed. 3T3-L1 cells were seeded at concentrations of 1×10⁴–1×10⁵ cells per well in 96-well plates. Following 24 h of incubation, the cells were treated with DBM for 6 d with media change every other day. The medium was removed, and the cells were treated with MTT reagent (0.5 mg/mL) in serum-free media for 60 min at 37°C. After the medium was removed, MTT formazan was solubilized in DMSO. Absorbance was measured at 550 nm (Spectra Max M3; Molecular Devices, Sunnylvale, CA, U.S.A.).

ORO Staining

Differentiated 3T3-L1 adipocytes were stained on d 8 using ORO to determine lipid accumulation. Briefly, the cells were fixed with 10% formalin for 1 h at 4°C, and then washed with distilled water. Adipocytes were stained with filtered 0.5% ORO in 60% isopropanol overnight at 25°C in the dark. The plates were sufficiently washed and dried overnight. Differentiation was also monitored under a microscope and quantified using ImageJ (National Institutes of Health (NIH)).

Determination of ROS Production

In differentiated adipocytes, ROS production was measured using two methods, the DCFH-DA and NBT assays. For the DCFH-DA assay, cells were treated with DCFH-DA (20 µM) on days 4 or 6 of differentiation for 30 min. Cell membranes were dissociated using DMSO. ROS-mediated DCF formation was measured using a fluorescence plate reader (excitation 485 nm, emission 535 nm) (SpectraMaxM3; Molecular Devices). For the NBT assay, 4 or 6 d after differentiation induction, the cells were washed with PBS, and 0.2% NBT solution was added to the cells. The dark-blue color (formazan) is formed, indicating ROS production. Following incubation for 90 min, the plates were washed with PBS and then allowed to dry. Stained formazan was dissolved in 100% acetic acid, and absorbance was read at 570 nm (Spectra Max M3; Molecular Devices). Hydrogen peroxide (50 µM) and NAC (10 mM) were used as a ROS and an antioxidant, respectively.

Western Blot

Cells (differentiated or undifferentiated) were scraped and harvested using lysis buffer (pH 7.4) containing the protease and phosphatase inhibitors; aprotinin, leupeptin, benzamidine, pepstatin, sodium orthovanadate, and phenylmethylsulfonyl fluoride (PMSF) and phosphatase inhibitor cocktails I and II (Sigma). Protein extracts (30 or 50 µg) were obtained from cell lysates by centrifugation at 10000×g for 10 min, after which the extract was subjected to sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins were transferred to polyvinylidene fluoride (PVDF) membranes, followed by incubation with a blocking solution (5% non-fat dried milk) for 30 min. Immunoblotting was performed using the indicated primary antibodies (1 : 1000) overnight, and horseradish peroxidase-conjugated secondary antibodies (1 : 2000) for 1 h. Nrf2, heme oxygenase-1 (HO-1), Lamin B, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, U.S.A.). PPARγ, C/EBPα, C/EBPβ, FABP4, p-phosphoinositide 3-kinase (p-PI3K), PI3K, p-AKT, AKT, and adiponectin were obtained from Cell Signaling Technology, Inc. (Denvers, MA, U.S.A.). Krueppel-like factor (KLF) 2 was purchased from EMD Millipore (Gangnam-gu, Seoul, South Korea). Protein bands were visualized by enhanced chemiluminescence using the LAS imaging software (Fuji, New York, NY, U.S.A.). Protein bands on the membrane were quantified by ImageJ (NIH).

Preparation of Nuclear and Cytosol Fraction

Cells were collected in a harvesting buffer [10 mM N-2-hydroxyethylpiperazine-N′-2-ethanesulfonic acid (HEPES) (pH 7.9), 50 mM sodium chloride, 0.5 M sucrose, 0.1 mM ethylenediaminetetraacetic acid (EDTA), 0.5% Triton X-100, 1 mM dithiothreitol (DTT), 10 mM tetrasodium pyrophosphate, 100 mM sodium fluoride, 17.5 mM glycerophosphate, 1 mM PMSF, 4 mg/mL aprotinin, and 2 mg/mL pepstatin A]. Cell lysates, obtained by disruption using 25-gauge needles and pipetting, were centrifuged at 120×g for 10 min in a swinging bucket rotor. For nuclear fraction preparation, the pellets were resuspended in buffer A, composed of 10 mM HEPES (pH 7.9), 10 mM KCL, 0.1 mM EDTA, 0.1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA), 1 mM DTT, 1 mM PMSF, 4 mg/mL aprotinin, and 2 mg/mL pepstatin A. After centrifugation at 120×g for 5 min, the pellet was resuspended by vortexing for 15 min at 4°C in buffer C, containing 10 mM HEPES (pH 7.9), 0.5 M sodium chloride, 0.1 mM EDTA, 0.1 mM EGTA, 0.1% NP-40, 1 mM DTT, 1 mM PMSF, 4 mg/mL aprotinin, and 2 mg/mL pepstatin A. After centrifugation at 10000×g for 10 min, the resulting supernatant was used as the nuclear fraction. For the cytosolic fraction, the supernatant obtained after the centrifugation of cell lysates at 120×g for 10 min was further centrifuged at 10000×g for 15 min. The resulting supernatant was used as the cytosolic fraction.

RNA Extraction and Real Time PCR

Cells from which RNA samples were derived (differentiated or undifferentiated, with or without DBM) were washed with PBS. TRIzol (Invitrogen, Carlsbad, CA, U.S.A.) was used to extract total RNA from the cells according to the manufacturer’s protocol. Transcribed cDNA was produced using the Maxime RT PreMix Kit (iNtRON Biotechnology, Inc.) from 1 µg of total RNA. Transcribed cDNA was diluted and mixed with SYBR Green PCR Master Mix (Applied Biosystems) containing 100 ng/mL of the specific primers shown in Table 1. Reactions were carried out in triplicate for each pair of primers using AriaMx Real-Time PCR system (Agilent Technologies).

Table 1. Primers Used in This Study

Name	Forward (5′ to 3′)	Reverse (5′ to 3′)
Gpx	GAGGGTAGAGGCCGGATAAG	AGAAGGCATACACGGTGGAC
CAT	ACATGGTCTGGGACTTCTGG	CAAGTTTTTGATGCCCTGGT
SOD1	GAGACCTGGGCAATGTGACT	GTTTACTGCGCAATCCCAAT
Resistin	CAAGAAGGAGCTGTGGGACA	GAGTGCAGGTGCCTGTAGAG
Adiponectin	GGTCCTAAGGGTGAGACAGG	AGTCCCGGAATGTTGCAGTA
GAPDH	CTGCGACTTCAACAGCAACT	GAGTTGGGATAGGGCCTCTC

Statistical Analysis

All data are expressed as mean±standard error of the mean (S.E.M.) SAS 9.0 software was used to perform all statistical analysis. One-way ANOVA was used for comparisons among groups. Significant differences between the mean values were assessed by using Duncan’s test. Differences with p-values <0.05 were considered significant.

RESULTS

Effect of DBM on Cell Viability

Various concentrations of DBM (3.15, 6.25, 12.5, 25, 50, and 100 µM) were used to determine the effect on cell viability by MTT assay. Cytotoxic effects were not observed at concentrations ≤50 µM during the 6-d incubation period. Treatment with 100 µM DBM decreased cell viability by 18% compared to that after control treatment (Fig. 2). However, DBM did not cause morphological alterations to the cells. Therefore, subsequent experiments of DBM were performed at concentrations less than 100 µM.

Fig. 2. Effect of DBM (A) on Viability of 3T3-L1 Cells (B)

Preadipocytes or confluent 3T3-L1 cells were treated with DBM or vehicle (DMSO) for 6 d. Cell viability was examined by MTT assay. Assays were performed in triplicate. Values are presented as means and standard errors of the mean (means±S.E.M.). Symbols indicate statistically significant differences versus control (p<0.05). Data shown in (B) are representative of three replicates. n.s.: not significant.

Effects of DBM on Lipid Accumulation during Adipocyte Differentiation

DBM was observed to inhibit lipid accumulation, determined by the ORO staining (Fig. 3A). DBM reduced fat accumulation in a dose-dependent manner: 13% at 12.5 µM, 35% at 25 µM, and 54% at 50 µM, compared with the control (DMSO only) (Fig. 3A). These results show that DBM effectively inhibits lipid accumulation during adipogenesis. This lipid-reducing effect of DBM was involved in the down-regulation of adipogenic factors and their target gene. DBM suppressed the protein expression of PPARγ, C/EBPα, and FABP4 (Fig. 3B) in a dose-dependent manner. The high dose (50 µM) of DBM decreased the expression of PPARγ, C/EBPα, and FABP4 by 91, 88, and 50%, respectively, compared with that after control treatment (CON, fully differentiation) (Fig. 3C). These results indicate that DBM inhibits lipid accumulation in 3T3-L1 by suppressing the expression of adipogenic factors.

Fig. 3. Effects of DBM on Lipid Accumulation and Adipogenic Factors during Adipogenesis

Relative lipid content was evaluated by ORO staining (A). Quantification of stained lipids was performed by ImageJ (A). Differentiation was processed in the presence or absence of DBM for 6 d (B). Proteins were then extracted for immunoblotting analysis using the indicated antibodies for adipogenic factors and, as an internal control, GAPDH. C/EBPα has two isoforms corresponding to 30 kDa (lower) and 43 kDa (upper) (B). Protein levels of adipogenic factors were quantified using ImageJ software (C). Values are presented as means and standard errors of the mean (means±S.E.M.). Symbols indicate statistically significant differences versus control (p<0.05). CON: fully differentiated, ND: undifferentiated. Data shown in (A) and (B) are representative of three replicates. *p<0.05; **p<0.01; ***p<0.005; ^#p<0.001 versus CON (control).

Effects of DBM on Stages of Adipogenesis

DBM was shown to effectively inhibit lipid accumulation at the early stages (days 0–2 and 0–4) of adipogenesis (Fig. 4A). This inhibitory effect was similarly observed up to the late stage (days 0–6). DBM treatments for days 0–2, 0–4, and 0–6 showed reductions of 61%, 68%, and 70% in ORO staining, respectively (Fig. 4B). However, DBM treatments initiated after day 2 were much less effective in lipid reduction compared to treatments starting from days 0, although they still showed inhibitory effects of 15–35% (Fig. 4B). These results indicate that DBM inhibits lipid accumulation by suppressing it at the early stages of differentiation. The effect of DBM on the expression of early adipogenic factors correlated with the results of the ORO staining study. C/EBPβ, a pro-adipogenic factor present in the early stages of differentiation, significantly decreased in the presence of DBM. Protein levels of KLF2, an anti-adipogenic factor, increased with DBM concentrations in a dose-dependent manner (Figs. 4C, D). DBM treatment (50 µM) decreased protein levels of C/EBPβ by 63% compared to that after control treatment, and the same dose of DBM enhanced KLF2 expression by 5-fold compared to that after control treatment (Fig. 4D). These results show that DBM-mediated inhibition of lipid accumulation in the early stages of adipogenesis may be due to the regulation of early adipogenic factors.

Fig. 4. Effects of DBM on Adipogenic Stages and Early Adipogenic Factors

Differentiation was performed for 6 d with or without DBM (50 µM), after which lipids from each group were visualized by ORO staining and quantified by ImageJ (A and B). Cells were differentiated with or without DBM (12.5 µM, 25 µM, or 50 µM) for 4 h. Proteins from each group were extracted from the cells and analyzed by immunoblotting (C); protein levels were quantified by ImageJ (D). Values are presented as means and standard errors of the mean (means±S.E.M.). Symbols indicate statistically significant differences versus Control (p<0.05). CON: fully differentiated, ND: undifferentiated. Data shown in (A) and (C) are representative of three replicates. *p<0.05; **^, ***p<0.01; ^{#, ##}p<0.005; ^###p<0.001 versus CON (control) (B), *p<0.05; **p<0.01; ***p<0.001 versus CON (control) (D).

Effects of DBM on Protein Abundance of Nrf2 and HO-1 and Nrf2 Transactivation

DBM effectively increased the protein levels of Nrf2, which is an antioxidant transcription factor; treatment with 25 and 50 µM DBM increased Nrf2 expression by over 2-fold compared with control treatment (Figs. 5A, B). The protein level of HO-1 in CON significantly decreased compared with ND (undifferentiated) (Fig. 5B). The protein levels of HO-1, a target molecule of Nrf2, also increased when treated with DBM. Treatment with 50 µM of DBM increased HO-1 protein level by around 2.5-fold compared with control treatment (Fig. 5B). This result showed that DBM effectively increased antioxidant signaling molecules of the Nrf2-Keap1 pathway. This DBM-mediated up-regulation of Nrf2 and HO-1 was correlated to DBM-mediated inhibition of lipid accumulation during adipocyte differentiation. Up-regulation of Nrf2 and HO-1 by DBM in cells suggests that DBM can activate phase II genes, detoxifying genes, via Nrf2 transactivation. Next, the difference in Nrf2 content in the nucleus and cytoplasm was examined to identify the effect of DBM on Nrf2 translocation into the nucleus. DBM treatment significantly increased nuclear Nrf2 (Fig. 5C). Treatment with 50 µM of DBM markedly increased the levels of Nrf2 in the nucleus by around 8-fold compared with control treatment (Figs. 5C, D). In contrast, cytosolic Nrf2 was shown to be significantly decreased by DBM treatment (Figs. 5C, D). These results indicate that DBM increases translocation of Nrf2 into the nucleus to promote the expression of HO-1.

Fig. 5. Effects of DBM on Nrf2 and HO-1

Preadipocytes were differentiated with or without DBM for 2 or 4 d. Proteins from each group were extracted from the cells and analyzed using antibodies against Nrf2 and HO-1 (A). Protein levels were quantified by ImageJ (B). Nuclear and cytosolic fractions were prepared as described in methods, and subjected to immunoblotting using antibodies against Nrf2 and Lamin B (nuclear loading control) proteins (C). Protein levels were quantified by ImageJ (D). Values are presented as means and standard errors of the mean (means±S.E.M.). Symbols indicate statistically significant differences versus control (p<0.05). CON: fully differentiated, ND: undifferentiated. Data shown in (A) and (C) are representative of three replicates. *p<0.05; **p<0.01; ***p<0.005; ^#p<0.001 versus CON (control).

Effect of DBM on Insulin Signaling

DBM significantly decreased the activation of PI3K by suppressing its phosphorylation in a dose-dependent way (Fig. 6A). High dose of DBM (50 µM) suppressed the phosphorylation by 60% compared with the control group (Fig. 6B). AKT, a downstream signaling molecule of PI3K, was also significantly deactivated by DBM in a concentration-dependent manner (Fig. 6A). In particular, DBM of 50 µM showed a marked reduction of AKT phosphorylation (80%) (Fig. 6B). This result showed DBM effectively inhibits insulin signaling inside of cell.

Fig. 6. Effect of DBM on Insulin Signaling

Preadipocytes were differentiated with or without DBM for 2 or 4 h. Proteins from each group were extracted from the cells and analyzed using antibodies (indicated) and immunoblotting (A). Protein levels were quantified by ImageJ program (B). Values are presented as means and standard errors of the mean (means±S.E.M.). Symbols indicate statistically significant differences versus Control (p<0.05). CON: fully differentiated, ND: undifferentiated. Data shown in (A) are representative of three replicates. *p<0.05; **p<0.01; ***p<0.001 versus CON (control).

Effect of DBM on ROS Production and Antioxidant Genes

The effect of DBM on ROS production during adipocyte differentiation was measured via DCFH-DA and NBT assays in 3T3-L1 cells. In the DCFH-DA assay, DCF-derived fluorescence, produced by intracellular ROS, greatly increased in fully differentiated cells (CON) compared to that in undifferentiated cells (ND), indicating that ROS production increased with differentiation (Fig. 7A). Hydrogen peroxide (H₂O₂)-treated cells, used as a negative control, showed an increase in the levels of fluorescence (around 15%), compared with control (CON) cells, while NAC, an antioxidant, markedly decreased the ROS-derived fluorescence(Fig. 7A). Differentiation-induced increase in DCF-derived fluorescence was significantly reduced by DBM in a dose-dependent manner (p<0.05). DBM treatment at 25 and 50 µM showed inhibitory rates of 26% and 50%, respectively, in fluorescence production (Fig. 7A). This result implies that DBM effectively suppressed ROS production as measured by the DCFH-DA system. In the NBT assay, differentiation induced an increase in ROS-derived NBT staining, and hydrogen peroxide further enhanced staining in a similar manner to that observed in the DCFH-DA assay. DBM was also shown to inhibit ROS production in the NBT assay (Fig. 7B). DBM at 25 and 50 µM decreased the ROS-derived NBT staining by 28 and 56%, respectively (Fig. 7B). Therefore, DBM was observed to inhibit ROS production during differentiation. Also, hydrogen peroxide and N-acetylcysteine exhibited increased and decreased lipid accumulation, respectively, during differentiation (Fig. 7C). These results indicate that DBM-mediated inhibition of ROS production is involved in the DBM-mediated inhibition of lipid accumulation.

Fig. 7. Effect of DBM on ROS Production and Antioxidant Genes

After differentiation for 2 or 4 d, the formation of DCF was measured using fluorescence (A), and dark blue formazan was determined using NBT and absorbance (B). ORO staining was performed after 6 d differentiation (C). Total RNA was extracted from cells, and the levels of mRNA expression of Gpx, CAT, and SOD1 were assessed by real-time PCR, and normalized to GAPDH (D). Hydrogen peroxide (H₂O₂, 50 µM) and N-acetylcysteine (NAC, 10 mM) were used as a negative and a positive control, respectively. Values are presented as means and standard errors of the mean (means±S.E.M.). Symbols indicate statistically significant differences versus control (p<0.05). CON: fully differentiated, ND: undifferentiated, n.s.: not significant. Data shown in (B) and (C) are representative of three replicates. *p<0.05; **p<0.01; ***p<0.001; versus CON (control).

Furthermore, antioxidant genes such as glutathione peroxidase (Gpx), catalase (CAT), and superoxide dismutase (SOD1) were upregulated by DBM treatment (Fig. 7D). Expressions of these genes were also regulated by hydrogen peroxide and NAC treatment. High dose of DBM (50 µM) increased the gene expression of Gpx, CAT, and SOD1 by 89, 60, and 42%, respectively. These results indicate that DBM-mediated inhibition of lipid accumulation is associated with antioxidant responses and ROS reduction, which are induced by Nrf2 activation.

Effect of DBM on Resistin and Adiponectin

The effect of DBM on the production of adipokines was examined during adipocyte differentiation. Resistin mRNA levels significantly decreased with high-dose DBM treatment (50 µM); however, the low-dose (25 µM) treatment resulted in no change in expression, compared with control treatment (Fig. 8A). High-dose DBM (50 µM) decreased resistin mRNA levels by 25% compared with the control group. Hydrogen peroxide significantly increased the expression of resistin mRNA, but NAC showed a great reduction of resistin mRNA, which is similar level to the ND (Fig. 8A). In contrast, DBM effectively increased adiponectin in adipocytes, although this increase was not dose dependent (Fig. 8A). DBM treatment (25 and 50 µM) increased adiponectin mRNA expression by around 3-fold compared with control treatment. NAC and hydrogen peroxide also down-regulated adiponectin expression (Fig. 8A). Adiponectin protein abundance was also increased by DBM treatment, and regulated by NAC and hydrogen peroxide (Fig. 8B), showing a similar trend to mRNA levels. High dose (50 µM) of DBM led to the increase of adiponectin protein level by around 2-fold compared with the control (Fig. 8C). This result showed that DBM regulates adipocyte-derived adipokines via ROS control.

Fig. 8. Effect of DBM on Adipokines

Preadipocytes were differentiated with or without DBM for 6 d. Total RNA was extracted from the cells, and the mRNA expression levels of resistin and adiponectin were analyzed by real-time PCR, and normalized to GAPDH (A). Adiponectin abundance was analyzed by Western blot (B) and quantified by ImageJ program (C). Values are presented as means and standard errors of the mean (means±S.E.M.). Symbols indicate statistically significant differences versus control (p<0.05). CON: fully differentiated, ND: undifferentiated, n.s.: not significant. Data shown in (B) are representative of three replicates. *p<0.05; **p<0.01 versus CON (control).

DISCUSSION

In this study, we examined the effects of DBM, a naturally occurring phytochemical, on lipid accumulation and ROS generation, and resultant signaling in 3T3-L1 cells. DBM-mediated inhibition of lipid accumulation during adipogenesis was shown to be achieved from the early stages of adipogenesis (Fig. 4). Many studies have reported that anti-adipogenic phytochemicals exert their inhibitory effect on lipid accumulation by controlling the early adipogenic step.^12,22,23) Early adipogenesis includes regulation of various transcription factors that are responsible for adipogenesis, including C/EBPβ/δ, KLF members, Krox 20, etc.²⁴⁾ These transcription factors are closely associated with adipogenic factors—for example, C/EBPα and C/EBPδ proteins induce the expression of PPARγ.²⁴⁾ In addition, KLF members also control the adipogenic pathway²⁴⁾; KLF2 is reported to suppress adipogenesis by inhibiting PPARγ.²⁵⁾ In contrast, KLF4 regulates adipogenesis by promoting C/EBPβ expression.²⁴⁾ Therefore, the regulation of early adipogenic factors is important to the overall adipogenic process. The current study shows that DBM regulates protein expression of the early adipogenic factors C/EBPβ and KLF2 (Fig. 4). The up-regulation of KLF2 and down-regulation of C/EBPβ by DBM are shown to negatively affect adipogenic lipid accumulation. A recent study showed that various early adipogenic factors are regulated by vitamin D precursors to reduce lipid accumulation during adipogenesis.²⁶⁾

Excessive ROS, which induces oxidative stress, has been known to be closely involved in adipogenesis or obesogenic conditions.²⁷⁾ A previous study indicated that both ROS production as well as nicotinamide adenine dinucleotide phosphate (NADPH) oxidase 4 (NOX4), a ROS generating enzyme, are markedly increased during the differentiation of 3T3-L1 cells into mature adipocytes.²⁸⁾ High-dose hydrogen peroxide treatment, which can induce oxidative stress, also promoted adipogenesis,²⁷⁾ while an antioxidant suppressed lipid accumulation in adipocytes,²⁹⁾ supported by our data (Fig. 7). Furukawa et al. show that systemic oxidative stress during lipid accumulation in cells is associated with the metabolic syndrome via in vivo study.³⁰⁾ DBM effectively reduced ROS levels during adipogenesis (Fig. 7), indicating that DBM can eliminate conditions that may cause lipid accumulation. This DBM-mediated ROS reduction was not shown to be due to the direct ROS scavenging effect of DBM.³¹⁾ Instead, DBM may play a role in regulating intracellular molecules that are related to ROS or ROS-mediated cellular stress. This hypothesis was supported by our data; DBM significantly regulated the Nrf2-HO-1 system and insulin signaling (Figs. 5, 6). Nrf2, a transcription factor, has been known to promote the expression of protective or antioxidant genes against cell stress in the nucleus.³²⁾ Nrf2 translocates to the nucleus and bind to promoter region of their target genes, promoting their expression (transactivation).³²⁾ HO-1 is one of the target genes that contain Nrf2-binding region. Thus, DBM-mediated HO-1 increase was shown to be due to the increase in Nrf2 transactivation (Fig. 5). Several studies have reported HO-1-mediated ROS reduction in cellular stress condition.^33,34) In addition to HO-1, some antioxidant genes such as nicotinamide adenine dinucleotide (NAD) (P)H quinone oxidoreductase 1 (NQO1), CAT, and SOD and glutathione (GSH)-related genes are known to be activated via Nrf2.³⁵⁾ In particular, GSH, one of the main biomarkers for Nrf2 activation, has been known to scavenge various reactive species such as superoxide, hydroxyl radicals, NO, and peroxynitrite (ONOO).³⁶⁾ These studies support our data showing DBM-mediated upregulation of antioxidant genes (Fig. 7). Accordingly, DBM-mediated activation of Nrf2 and HO-1 are thought to contribute to the suppression of ROS generation via regulation of antioxidant molecules during adipogenesis.

Another link of DBM-mediated ROS regulation can be an insulin signaling. In fact, adipogenic process includes the activation of insulin signaling which is responsible for the increase of ROS production during adipogenesis.³⁷⁾ Our data showed that DBM significantly suppressed activation of downstream molecules of intracellular insulin signaling (Fig. 6). This DBM-mediated ROS reduction may be, at least in part, due to the inhibition of insulin signaling, and may be associated with the decrease of lipid accumulation. However, whether lipid accumulation in adipogenesis is due to the ROS level remains to be fully explored. In addition, since insulin signaling is also associated with the cell proliferations for preparation of lipid accumulation in adipocyte,³⁸⁾ DBM is considered to be able to inhibit insulin signaling to delay the lipid accumulation (Fig. 6). Therefore, DBM-mediated inhibition of lipid accumulation is considered to be involved in control of ROS via multiple mechanisms.

However, current study did not describe how the cell interacts with this compound. For insulin signaling, the regulation of DBM on activation of PI3K and AKT (Fig. 6) may suggest the interaction of DBM with insulin receptor substrate (IRS), the PI3K/AKT upstream. DBM also may penetrate to regulate the other signalings. This further analysis would be performed in the next study.

Although DBM-mediated activation of Nrf2 was associated with the inhibition of lipid accumulation based on our data (Fig. 5), there have been many conflicting studies on the correlation of Nrf2 and adipogenesis.^39–42) Pi et al. showed that loss of Nrf2 caused a reduction in adipogenesis,⁴¹⁾ and the decrease in expression of major adipogenic factors was observed in Nrf2 deficiency.⁴⁰⁾ In contrast, Nrf2 deficient mouse embryonic fibroblast cells have been shown to markedly promote adipogenic differentiation compared with wild-type cells, and Nrf2 ectopic expression reversed this consequence.⁴²⁾ Gaikwad et al. reported that sulforaphane, a vegetable phytochemical, activates Nrf2 and its target gene, NQO1, to inhibit lipid accumulation in adipose tissue.³⁹⁾ In the current study, DBM-mediated Nrf2 activation is considered to negatively affect adipogenesis and lipid accumulation.

DBM-mediated lipid reduction led to regulation of the adipokines, resistin and adiponectin (Fig. 8). Adiponectin has been known to inversely correlate with obesity and type 2 diabetes.⁴³⁾ Increased levels of adiponectin have been shown to impair adipogenesis,⁴³⁾ supporting our data showing DBM-mediated increases in adiponectin expression (Fig. 8). In contrast, the level of resistin has been implicated in the pathogenesis of insulin resistance and type 2 diabetes, although there are controversies.⁴⁴⁾ However, not differentiated and NAC-treated cells did not show the induction of adiponectin (Figs. 8B, C). This result indicates that adipokines are induced from differentiated adipocyte and NAC is thought to suppress the adipocyte differentiation. The regulation of these adipokines is supported by DBM-mediated inhibition of lipid accumulation via ROS regulation (Fig. 8).

There are many studies on phytochemicals that can control adipognesis,^22,23,26) but the adipogenic control of DBM via Nrf2 and ROS regulation has rarely been reported. DBM is a component of licorice, which has been traditionally used to control various illnesses, such as the common cold and liver disease, for a long time.³⁾ Although licorice-derived active compounds, such as glycyrrhizic acid, have been widely known for their licorice-mediated biological activity in principle, many other components from licorice have been investigated for their functionalities.^45,46) DBM is one of those licorice-derived bioactive compounds. The structure of DBM is similar to curcumin, which is a bioactive compound derived from turmeric.³¹⁾ These two compounds share β-diketone groups containing conjugated double bonds. DBM is smaller than curcumin in molecular weight due to the lack of hydroxyl groups.³¹⁾ However, DBM has been shown to have stronger bioavailability in chemical-induced tumorigenesis,³¹⁾ indicating that DBM could be an anti-adipogenic agent with improved bioavailability.

In conclusion, DBM inhibited lipid accumulation by suppressing early adipogenic stages. This DBM-mediated inhibition of lipid accumulation is closely associated with the regulation of Nrf2 and insulin signaling which are responsible for ROS reduction and up-regulation of antioxidant genes. This study shows the DBM-mediated multiple mechanisms suppress the lipid accumulation in adipocyte and supports a potential of DBM as an anti-adipogenic agent.

Acknowledgments

This work was supported by the National Research Foundation of Korea, a Grant funded by the Korea government (the Ministry of Education) (NRF-2015R1D1A1A01059729) (2017).

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Fukai T, Nishizawa J, Nomura T. Five isoprenoid-substituted flavonoids from Glycyrrhiza eurycarpa. Phytochemistry, 35, 515–519 (1994).
• 2) Iida K, Uematsu Y, Suzuki K, Yasuno T, Hirata K, Ito K. Properties of commercial licorice extracts used as a food additive. Shokuhin Eiseigaku Zasshi (J. Food Hyg. Soc. Japan), 48, 112–117 (2007).
• 3) Stepanova E, Sampiev A. Status of studies and potential application of licorice grass. Chem. Pharm. J., 1997, 39–43 (1997).
• 4) Cho S, Park JH, Pae AN, Han D, Kim D, Cho NC, No KT, Yang H, Yoon M, Lee C, Shimizu M, Baek NI. Hypnotic effects and GABAergic mechanism of licorice (Glycyrrhiza glabra) ethanol extract and its major flavonoid constituent glabrol. Bioorg. Med. Chem., 20, 3493–3501 (2012).
• 5) Jung JC, Lee YH, Kim SH, Kim KJ, Kim KM, Oh S, Jung YS. Hepatoprotective effect of licorice, the root of Glycyrrhiza uralensis Fischer, in alcohol-induced fatty liver disease. BMC Complement. Aaltern. Med., 16, 19 (2016).
• 6) Nugroho AE, Wijayanti A, Mutmainah M, Susilowati R, Rahmawati N. Gastroprotective effect of combination of hot water extracts of Licorice (Glycyrrhiza glabra), Pulasari Stem Bark (Alyxia reinwardtii), and Sembung Leaf (Blumea balsamifera) against aspirin-induced gastric ulcer model rats. J. Evid. Based Complementary Altern. Med., 21, NP77–NP84 (2016).
• 7) Wittschier N, Faller G, Hensel A. Aqueous extracts and polysaccharides from liquorice roots (Glycyrrhiza glabra L.) inhibit adhesion of Helicobacter pylori to human gastric mucosa. J. Ethnopharmacol., 125, 218–223 (2009).
• 8) Choshi T, Horimoto S, Wang CY, Nagase H, Ichikawa M, Sugino E, Hibino S. Synthesis of dibenzoylmethane derivatives and inhibition of mutagenicity in Salmonella typhimurium. Chem. Pharm. Bull., 40, 1047–1049 (1992).
• 9) Jackson KM, DeLeon M, Verret CR, Harris WB. Dibenzoylmethane induces cell cycle deregulation in human prostate cancer cells. Cancer Lett., 178, 161–165 (2002).
• 10) Kim N, Kim HM, Lee ES, Lee JO, Lee HJ, Lee SK, Moon JW, Kim JH, Kim JK, Kim SJ, Park SH, Chung CH, Kim HS. Dibenzoylmethane exerts metabolic activity through regulation of AMP-activated protein kinase (AMPK)-mediated glucose uptake and adipogenesis pathways. PLOS ONE, 10, e0120104 (2015).
• 11) Lin CC, Tsai YL, Huang MT, Lu YP, Ho CT, Tseng SF, Teng SC. Inhibition of estradiol-induced mammary proliferation by dibenzoylmethane through the E 2-ER-ERE-dependent pathway. Carcinogenesis, 27, 131–136 (2005).
• 12) Suh HJ, Cho SY, Kim EY, Choi H-S. Blockade of lipid accumulation by silibinin in adipocytes and zebrafish. Chem. Biol. Interact., 227, 53–62 (2015).
• 13) Kersten S. Mechanisms of nutritional and hormonal regulation of lipogenesis. EMBO Rep., 2, 282–286 (2001).
• 14) Lowe CE, O’Rahilly S, Rochford JJ. Adipogenesis at a glance. J. Cell Sci., 124, 2681–2686 (2011).
• 15) Rosen ED, Walkey CJ, Puigserver P, Spiegelman BM. Transcriptional regulation of adipogenesis. Genes Dev., 14, 1293–1307 (2000).
• 16) Ross SR, Graves RA, Greenstein A, Platt KA, Shyu H-L, Mellovitz B, Spiegelman BM. A fat-specific enhancer is the primary determinant of gene expression for adipocyte P2 in vivo. Proc. Natl. Acad. Sci. U.S.A., 87, 9590–9594 (1990).
• 17) Halliwell B, Gutteridge JM, Cross CE. Free radicals, antioxidants, and human disease: where are we now? J. Lab. Clin. Med., 119, 598–620 (1992).
• 18) Oakley FD, Abbott D, Li Q, Engelhardt JF. Signaling components of redox active endosomes: the redoxosomes. Antioxid. Redox Signal., 11, 1313–1333 (2009).
• 19) Kelishadi R, Mirghaffari N, Poursafa P, Gidding SS. Lifestyle and environmental factors associated with inflammation, oxidative stress and insulin resistance in children. Atherosclerosis, 203, 311–319 (2009).
• 20) Fernández-Sánchez A, Madrigal-Santillán E, Bautista M, Esquivel-Soto J, Morales-González Á, Esquivel-Chirino C, Durante-Montiel I, Sánchez-Rivera G, Valadez-Vega C, Morales-González JA. Inflammation, oxidative stress, and obesity. Int. J. Mol. Sci., 12, 3117–3132 (2011).
• 21) Kobayashi M, Yamamoto M. Molecular mechanisms activating the Nrf2-Keap1 pathway of antioxidant gene regulation. Antioxid. Redox Signal., 7, 385–394 (2005).
• 22) Choi HS, Jeon HJ, Lee OH, Lee BY. Indole-3-carbinol, a vegetable phytochemical, inhibits adipogenesis by regulating cell cycle and AMPKα signaling. Biochimie, 104, 127–136 (2014).
• 23) Choi KM, Lee YS, Sin DM, Lee S, Lee MK, Lee YM, Hong JT, Yun YP, Yoo HS. Sulforaphane inhibits mitotic clonal expansion during adipogenesis through cell cycle arrest. Obesity, 20, 1365–1371 (2012).
• 24) Birsoy K, Chen Z, Friedman J. Transcriptional regulation of adipogenesis by KLF4. Cell Metab., 7, 339–347 (2008).
• 25) Banerjee SS, Feinberg MW, Watanabe M, Gray S, Haspel RL, Denkinger DJ, Kawahara R, Hauner H, Jain MK. The Krüppel-like factor KLF2 inhibits peroxisome proliferator-activated receptor-γ expression and adipogenesis. J. Biol. Chem., 278, 2581–2584 (2003).
• 26) Kim JH, Kang S, Jung YN, Choi H-S. Cholecalciferol inhibits lipid accumulation by regulating early adipogenesis in cultured adipocytes and zebrafish. Biochem. Biophys. Res. Commun., 469, 646–653 (2016).
• 27) Turker I, Zhang Y, Zhang Y, Rehman J. Oxidative stress as a regulator of adipogenesis. FASEB J., 21, A1053–A1053 (2007).
• 28) Schröder K, Wandzioch K, Helmcke I, Brandes RP. Nox4 acts as a switch between differentiation and proliferation in preadipocytes. Arterioscler. Thromb. Vasc. Biol., 29, 239–245 (2009).
• 29) Pieralisi A, Martini C, Soto D, Vila M, Calvo J, Guerra L. N-acetylcysteine inhibits lipid accumulation in mouse embryonic adipocytes. Redox Biol., 9, 39–44 (2016).
• 30) Furukawa S, Fujita T, Shimabukuro M, Iwaki M, Yamada Y, Nakajima Y, Nakayama O, Makishima M, Matsuda M, Shimomura I. Increased oxidative stress in obesity and its impact on metabolic syndrome. J. Clin. Invest., 114, 1752–1761 (2004).
• 31) Huang M-T, Lou Y-R, Xie JG, Ma W, Lu Y-P, Yen P, Zhu BT, Newmark H, Ho C-T. Effect of dietary curcumin and dibenzoylmethane on formation of 7, 12-dimethylbenz[a]anthracene-induced mammary tumors and lymphomas/leukemias in Sencar mice. Carcinogenesis, 19, 1697–1700 (1998).
• 32) Taguchi K, Motohashi H, Yamamoto M. Molecular mechanisms of the Keap1–Nrf2 pathway in stress response and cancer evolution. Genes Cells, 16, 123–140 (2011).
• 33) Tang W, Yan J, Wang T, Xia X, Zhuang X, Hong K, Li R, Liu P, Jiang H, Qiao J. Up-regulation of heme oxygenase-1 expression modulates reactive oxygen species level during the cryopreservation of human seminiferous tubules. Fertil. Steril., 102, 974–980.e4 (2014).
• 34) Zhong Y, Liu T, Lai W, Tan Y, Tian D, Guo Z. Heme oxygenase-1-mediated reactive oxygen species reduction is involved in the inhibitory effect of curcumin on lipopolysaccharide-induced monocyte chemoattractant protein-1 production in RAW264. 7 Macrophages. Mol. Med. Rep., 7, 242–246 (2013).
• 35) Zhang M, An C, Gao Y, Leak RK, Chen J, Zhang F. Emerging roles of Nrf2 and phase II antioxidant enzymes in neuroprotection. Prog. Neurobiol., 100, 30–47 (2013).
• 36) Aoyama K, Watabe M, Nakaki T. Regulation of neuronal glutathione synthesis. J. Pharmacol. Sci., 108, 227–238 (2008).
• 37) Goldstein BJ, Mahadev K, Wu X, Zhu L, Motoshima H. Role of insulin-induced reactive oxygen species in the insulin signaling pathway. Antioxid. Redox Signal., 7, 1021–1031 (2005).
• 38) Shukla A, Grisouard J, Ehemann V, Hermani A, Enzmann H, Mayer D. Analysis of signaling pathways related to cell proliferation stimulated by insulin analogs in human mammary epithelial cell lines. Endocr. Relat. Cancer, 16, 429–441 (2009).
• 39) Gaikwad A, Long DJ 2nd, Stringer JL, Jaiswal AK. In vivo role of NAD (P) H: quinone oxidoreductase 1 (NQO1) in the regulation of intracellular redox state and accumulation of abdominal adipose tissue. J. Biol. Chem., 276, 22559–22564 (2001).
• 40) Hou Y, Xue P, Bai Y, Liu D, Woods CG, Yarborough K, Fu J, Zhang Q, Sun G, Collins S, Chan JY, Yamamoto M, Andersen ME, Pi J. Nuclear factor erythroid-derived factor 2-related factor 2 regulates transcription of CCAAT/enhancer-binding protein β during adipogenesis. Free Radic. Biol. Med., 52, 462–472 (2012).
• 41) Pi J, Leung L, Xue P, Wang W, Hou Y, Liu D, Yehuda-Shnaidman E, Lee C, Lau J, Kurtz TW, Chan JY. Deficiency in the nuclear factor E2-related factor-2 transcription factor results in impaired adipogenesis and protects against diet-induced obesity. J. Biol. Chem., 285, 9292–9300 (2010).
• 42) Shin S, Wakabayashi N, Misra V, Biswal S, Lee GH, Agoston ES, Yamamoto M, Kensler TW. NRF2 modulates aryl hydrocarbon receptor signaling: influence on adipogenesis. Mol. Cell. Biol., 27, 7188–7197 (2007).
• 43) Diez JJ, Iglesias P. The role of the novel adipocyte-derived hormone adiponectin in human disease. Eur. J. Endocrinol., 148, 293–300 (2003).
• 44) Kusminski CM, Mcternan PG, Kumar S. Role of resistin in obesity, insulin resistance and Type II diabetes. Clin. Sci., 109, 243–256 (2005).
• 45) Jitsuno M, Yokosuka A, Hashimoto K, Amano O, Sakagami H, Mimaki Y. Chemical constituents of Lycoris albiflora and their cytotoxic activities. Nat. Prod. Commun., 6, 187–192 (2011).
• 46) Nomura T, Fukai T, Akiyama T. Chemistry of phenolic compounds of licorice (Glycyrrhiza species) and their estrogenic and cytotoxic activities. Pure Appl. Chem., 74, 1199–1206 (2002).