New Inhibitory Effect of Latilactobacillus sakei UONUMA on the Cholesterol Biosynthesis Pathway in Human HepG2 Cells

Abstract

Many pharmaceuticals and dietary foods have been reported to inhibit cholesterol biosynthesis, mainly by inhibiting the presqualene enzyme 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase rather than a postsqualene enzyme. In this study, we examined the inhibitory effects of Latilactobacillus sakei UONUMA on cholesterol biosynthesis, especially postsqualene, in human HepG2 hepatoma cells. We quantified cholesterol and its precursors, and the mRNA and protein levels of enzymes involved in cholesterol biosynthesis. Three L. sakei UONUMA strains exhibited new inhibitory effects on cholesterol biosynthesis and inhibited the mRNA level of sterol-delta24-reductase (DHCR24), which is involved in the postsqualene cholesterol biosynthesis pathway. These strains will be useful for the prevention and treatment of hyperlipidemia.

INTRODUCTION

Hyperlipidemia is a risk factor for cardiovascular diseases, arteriosclerosis, coronary heart disease, and myocardial infarction.^1–4) Antihyperlipidemic therapy thus mainly uses statins that inhibit 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR), an enzyme involved in the synthesis of presqualene during cholesterol biosynthesis.⁵⁾ Components of many dietary foods inhibit HMGCR similarly to statins, such as hesperetin⁶⁾ in citrus fruits, lycopene⁷⁾ in tomatoes, the catechin epigallocatechin-3-gallate⁸⁾ in green tea, and procyanidins⁹⁾ in red wine. In contrast, some compounds have been reported to inhibit the postsqualene stages of cholesterol biosynthesis, such as daidzein¹⁰⁾ in soybean, (3S,20S)-20-[(formyloxy)methyl]-pregn-7-en-3β-yl acetate (SH42),^11–13) N,N-dimethyl-3β-hydroxycholenamide (DMHCA),^11,12,14) tyrosine kinase inhibitors (masitinib and ponatinib),¹⁵⁾ and (3S,20S)-20-(methyl-carbamoyl)-pregn-7-en-3β-yl acetate (MGI-21)^11,16,17) (which inhibits sterol-delta24-reductase (DHCR24)). It has been reported that small alkyl residues, such as amide nitrogens, and N-ethyl and N-propyl derivatives, lead to inhibition of DHCR24.¹⁷⁾ In addition, trans-1, 4-bis(2-chloro-benzylaminomethyl) cyclohexane (AY9944),^18–22) 4-[2-[4-[3-(4-chlorophenyl)-2-propenyl]-1-piperazinyl]ethyl]benzoic acid (BM15766),^12,21,22) and antipsychotic (aripiprazole)^18,19) inhibit sterol 7-reductase (DHCR7), and 2-(4-phenethylpiperazin-1-yl)-1-(pyridine-3-yl)ethanol (LK-980)²³⁾ inhibits DHCR7 and DHCR24. The inhibition of DHCR24 leads to select reprogramming of fatty acid metabolism, activating liver X receptor (LXR) target genes, inhibiting sterol regulatory element-binding protein (SREBP) target genes, and suppressing inflammatory-response genes, as observed in macrophage foam cells.^13,24–26)

Acetyl-CoA is the starting material in cholesterol biosynthesis and is converted to squalene, which is then transformed to lanosterol. There are two pathways from lanosterol to cholesterol: the Kandutsch–Russell pathway via lathosterol, and the Bloch pathway via desmosterol.²⁷⁾ Therefore, finding a compound that targets these two postsqualene pathways could aid the treatment of hyperlipidemia and show a synergistic effect in lowering cholesterol when used together with HMGCR inhibitors.

Lactobacillus spp. (formerly named²⁸⁾ Lactiplantibacillus plantarum, Lacticaseibacillus casei, Lactobacillus helveticus, Lactobacillus gasseri and Limosilactobacillus fermentum) decrease intestinal peristalsis and alleviate constipation,²⁹⁾ and therefore are used as an intestinal medication. Lactobacillus spp. were recently reported to have various other beneficial effects, such as an anti-tumor effect caused by inducing the secretion of interleukin-12 (IL-12) and interferon-γ (IFN-γ),^30,31) and an antihypertensive effect following the ingestion of fermented milk.³²⁾ Furthermore, Lactobacillus spp. decrease cholesterol levels due to their cholesterol-binding ability,^33,34) and by binding³⁵⁾ and deconjugating^33,34) bile acid, the terminal metabolite of cholesterol. In addition, Lactobacillus plantarum (formerly named²⁸⁾ Lactiplantibacillus plantarum) inhibits HMGCR.³⁶⁾ However, the effect of Lactobacillus spp. on postsqualene cholesterol synthesis has not been reported.

Latilactobacillus sakei is a psychotropic lactic acid bacterium with biotechnological potential for biopreservation³⁷⁾ and immunomodulation.^38,39) L. sakei UONUMA strains 1, 2 and 3 were isolated from Japanese pickles in snow caverns in the Uonuma region of Niigata, Japan.⁴⁰⁾ The sugar fermentation processes of each of these strains are different,^40,41) and thus these bacteria were classified as three separate strains.^40,42) The flavor and components of koji amazake (a fermented drink made from rice) can be altered by lactic acid fermentation using L. sakei UONUMA,⁴¹⁾ which aids in alleviating constipation.⁴³⁾

Here, we investigated the effect of the three strains of L. sakei UONUMA on the postsqualene pathway in cholesterol biosynthesis of DHCR24. Using human HepG2 hepatoma cells, we quantified cholesterol and its precursors, as well as the mRNA and protein levels of enzymes involved in cholesterol biosynthesis.

MATERIALS AND METHODS

Bacterial Strains and Growth Conditions

L. sakei UONUMA strains were cultured in MRS medium (Becton Dickinson and Company, Franklin Lakes, NJ, U.S.A.) for 24 h at 30 °C.

Reagents

Methanol, n-hexane, squalene and 5α-cholestane (an internal standard, I.S.) were purchased from FUJIFILM Wako Pure Chemical Corporation (Osaka, Japan), lanosterol was manufactured by Nagara Science Corporation (Gifu, Japan), and Dulbecco’s modified Eagle’s medium (DMEM) with high-glucose lipoprotein-deficient bovine calf serum (LPDS), penicillin–streptomycin, 7-dehydrocholesterol, desmosterol, lathosterol, and cholesterol were purchased from Sigma-Aldrich Corporation (St. Louis, MO, U.S.A.). Fetal bovine serum (FBS), 0.25% trypsin-ethylenediamineteraacetic acid (EDTA), and Tri-Sil HTP reagent (hexamethyldisilazane [HMDS] : trimethylchlorosilane [TMCS] : pyridine = 2 : 1 : 10), a trimethylsilyl derivatizing agent, were purchased from Thermo Fisher Scientific Corporation (Waltham, MA, U.S.A.). Dimethyl sulfoxide (DMSO) was obtained from Nacalai Tesque (Kyoto, Japan). Zirconia beads (0.5 mm diameter) for cell disruption were from Tomy Seiko Corporation (Tokyo, Japan). RevaTraAce qPCR RTmix, Thunderbird SYBR qPCR mix, and KOD SYBR qPCR mix were from Toyobo Corporation (Osaka, Japan), and polyvinylidene fluoride (PVDF) membrane (Immbilon-P) was purchased from Merck Corporation (Darmstadt, Germany).

Cell Cultures

For GC-MS analysis, human HepG2 hepatoma cells (National Institutes of Biomedical Innovation, Health and Nutrition, Osaka, Japan) (1 × 10⁶ cells/10 mL) were pre-cultured in DMEM containing 10% FBS and 1% penicillin-streptomycin in a 100 mm dish. After 6 h, the medium was replaced with 1% penicillin–streptomycin and 10% LPDS to enhance cholesterol biosynthesis.^10,44) The cells were cultured with or without medium from freeze-dried L. sakei UONUMA strains 1, 2, or 3 (dissolved in DMSO to final concentrations of 0.03, 0.1, 0.3 mg/mL, which gave a survival rate of >90% in toxicity tests) for 40 h (with cholesterol precursors) or 72 h (with cholesterol) at 37 °C and 5% CO₂. Culturing the cells in this LPDS medium resulted in increased levels of desmosterol and lathosterol (a cholesterol precursor) at 36 and 48 h, and an increase in cholesterol at 72 h (data not shown). We therefore determined cholesterol precursors by culturing for 40 h and cholesterol by culturing for 72 h. The cells were collected by trypsin-EDTA treatment.

For quantitative RT-PCR (qPCR) assays, human HepG2 cells (1 × 10⁶ cells/10 mL) were cultured in DMEM containing 10% FBS and 1% penicillin-streptomycin in a 100 mm dish; then, the cells were cultured with or without medium from freeze-dried L. sakei UONUMA strains 1, 2, or 3 (dissolved in DMSO to final concentrations of 0.03, 0.075, 0.15, 0.3 mg/mL) for 40 h.

For Western blot analysis, human HepG2 cells (1 × 10⁶ cells/10 mL) were cultured as above, and then the cells were cultured with or without medium from freeze-dried L. sakei UONUMA strains 1, 2, or 3 (dissolved in DMSO to final concentrations of 0.03, 0.15, 0.3 mg/mL) for 15, 24, and 40 h.

GC-MS Analysis

Cholesterol and its precursors were measured using a previously described method.⁴⁵⁾ Briefly, methanol (5 mL) containing 250 ng I.S. and 0.9 g zirconia beads was added to the cell sample (2 × 10⁶ cells) and the cells were disrupted by vortexing at room temperature for 5 min. The cell lysate was saponified with 10 mol/L potassium hydroxide for 1 h, neutralized by adding 50% phosphoric acid, and extracted with n-hexane. The n-hexane layer was collected and dried under a stream of nitrogen, then derivatized with trimethylsilyl ester. The GC-MS conditions were as follows: capillary column, DB-5MS (30 m × 0.25 mm, 0.25 µm particle size); carrier gas, helium (1 mL/min); column temperature, 180 °C for 1 min→20 °C/min→250 °C→5 °C/min→280 °C→3 °C/min→300 °C for 12 min; inlet temperature, 230 °C; ion source temperature, 250 °C; interface temperature, 250 °C; injection volume, 1 µL; detection mode, selected ion monitoring; GC-MS instrument, Shimadzu QP2010Plus; monitoring ions, m/z 69, 81 for squalene, m/z 393, 498, 483 for lanosterol, m/z 458, 459, 255 for lathosterol, m/z 325, 351 for 7-dehydrocholesterol, m/z 343, 456, 253 for desmosterol, m/z 368, 458, 329 for cholesterol, and m/z 217, 357 for 5α-cholestane (bold underline indicates the quantitative ion).

qPCR Assay

RNA was isolated from human HepG2 cells, cDNA was synthesized using RevaTraAce qPCR RTmix, and qPCR was conducted using THUNDERBIRD SYBR qPCR mix or KOD SYBR qPCR mix. The primers were designed during this study and the sequences and GenBank Accession numbers are shown in Table 1. The gene expression levels were determined using the comparative Ct method (comparative quantification method) with actb (actin, beta) as the endogenous control.⁴⁶⁾

Table 1. Primer Sequences

Gene	Sequence (5′→3′)	GenBank Accession No.
Human actb (β-Actin)	FP: CTGGAACGGTGAAGGTGACA	NM_01101
	RP: AAGGGACTTCCTGTAACAATGCA
Human dhcr7	FP: ACGTAGGAGGCATCCAGGAG	NM_001360
	RP: GCGAGAACCAGGACAGGAGA
Human sc5dl	FP: CTTGCTGGAGATAAGAGGTTACAGC	NM_006918
	RP: AGTCTATGATGAAGGCCTCTGTGAA
Human dhcr24	FP: CTGCCGCTCTCGCTTATCTTC	NM_014762
	RP: TCTTGCTACCCTGCTCCTTCC
Human hmgcr	FP: GGTGGCCTCTAGTGAGATCTGGA	NM_000859
	RP: TCACTGTCCCCACTATGATTCC

FP, forward primer; RP, reverse primer.

Western Blot Analysis

Protein was extracted from the cells using radio immunoprecipitation assay buffer (FUJIFILM Wako Pure Chemical Corporation) with protease inhibitors (cOmplete, EDTA-free: Roche, Basel, Switzerland). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis was conducted using 12.5% polyacrylamide gels, proteins were transferred to a PVDF membrane, and then the target protein was detected. The following antibodies were used in this study: β-actin monoclonal antibody (Catalog No.66009-1-lg: Proteintech, Rosemont, IL, U.S.A.), DHCR7 polyclonal antibody (GTX130695: GeneTex, Irvine, CA, U.S.A.) and DHCR24 polyclonal antibody (GTX103712: GeneTex). Protein expression levels were determined by measuring the band amount using Image J with ACTB (actin, beta) as the endogenous control.

Statistical Analysis

Statistical analysis was performed using the statistical software package EZR, version 1.40.⁴⁷⁾ The mean and standard deviation of each cholesterol precursor and cholesterol were determined, the Mann–Whitney U test was performed, and p < 0.05 was regarded as statistically significant.

RESULTS

Effect of L. sakei UONUMA on Cholesterol Precursor and Cholesterol Levels in Human Hepatocytes

For strain 1, the squalene level in human HepG2 cells did not significantly change from that of the control (1.94 ± 2.73 µg/10⁶ cells). The lanosterol level significantly increased to about 149% compared with the control (0.27 ± 0.08 µg/10⁶ cells) at 0.3 mg/mL (p < 0.05, n = 3). The 7-dehydrocholesterol level significantly increased to about 132% at 0.03 mg/mL and to about 114% at 0.3 mg/mL compared with the control (0.27 ± 0.08 µg/10⁶ cells) (p < 0.05, n = 3). The lathosterol level significantly increased to about 165% at 0.03 mg/mL and to about 143% at 0.1 mg/mL of strain 1 compared with the control (1.73 ± 0.27 µg/10⁶ cells) (p < 0.05, n = 3). Furthermore, the desmosterol level (control 0.70 ± 0.27 µg/10⁶ cells) significantly increased to about 128–160% at 0.03–0.3 mg/mL (p < 0.05, n = 3). However, the cholesterol level significantly decreased to about 78% compared with the control (160 ± 37.8 µg/10⁶ cells) (p < 0.05, n = 3) at 0.3 mg/mL (Fig. 1A).

Fig. 1. Effect of Latilactobacillus sakei UONUMA on the Levels of Cholesterol Precursors and Cholesterol Produced by HepG2 Cells

(A) Strain 1, (B) Strain 2, (C) Strain 3. *: p < 0.05, The Mann–Whitney U test. Concentration (%) indicates the concentration of each compound relative to that in the absence of Latilactobacillus sakei UONUMA (represented as 100%).

Strain 2 did not significantly change the squalene level. The lanosterol level significantly increased to about 185% at 0.3 mg/mL and the desmosterol level significantly increased to about 138% at 0.3 mg/mL compared with the control (p < 0.05, n = 3). However, the 7-dehydrocholesterol level significantly decreased to about 66% compared with the control at 0.3 mg/mL (p < 0.05, n = 3). The lathosterol level decreased in a concentration-dependent manner to about 72% at 0.1 mg/mL and to about 54% at 0.3 mg/mL (p < 0.05, n = 3). The cholesterol level significantly decreased to about 67% compared with the control (p < 0.05, n = 3) at 0.3 mg/mL (Fig. 1B).

Strain 3 did not significantly change the squalene and lanosterol levels. The 7-dehydrocholesterol level significantly decreased to about 78% at 0.1 mg/mL and to about 66% at 0.3 mg/mL (p < 0.05, n = 3). The lathosterol level significantly decreased to about 69% at 0.1 mg/mL and to about 60% at 0.3 mg/mL (p < 0.05, n = 3). The desmosterol level significantly increased to about 193% at 0.3 mg/mL (p < 0.05, n = 3). The cholesterol level significantly decreased to about 65% compared with the control at 0.3 mg/mL (p < 0.05, n = 3) (Fig. 1C).

All strains increased the desmosterol level and decreased the cholesterol level, suggesting that L. sakei UONUMA inhibits cholesterol biosynthesis by DHCR24.

Effect of L. sakei UONUMA on the mRNA Expression of Cholesterol Biosynthesis Enzymes in HepG2 Cells

The effect of cholesterol biosynthesis enzymes on the expression of mRNA was examined using the three stains. Using strain 1, the dhcr24 level concentration-dependently decreased to about 33–72% compared with the control (p < 0.05, n = 3) (Fig. 2A). Using strain 2, the dhcr7 level significantly increased to about 185–210% compared with the control (p < 0.05, n = 3) whereas the dhcr24 and hmgcr levels significantly decreased to about 53-64% and 62%, respectively, compared with the control (p < 0.05, n = 3) (Fig. 2B). Using strain 3, the dhcr7 level significantly increased to about 265–306% compared with the control (p < 0.05, n = 3) whereas the dhcr24 and hmgcr levels significantly decreased to about 60–68% and 74% compared with the control (p < 0.05, n = 3) (Fig. 2C).

Fig. 2. Effect of Latilactobacillus sakei UONUMA on the mRNA Expression Levels of Cholesterol Biosynthesis Enzymes

(A) Strain 1, (B) Strain 2, (C) Strain 3. *: p < 0.05, The Mann–Whitney U test. Gene expression levels were determined with actb as the endogenous control, using a value of 1 for the untreated sample.

None of the strains affected several other biosynthetic enzymes: sc5dl, sterol C5-desaturase (Fig. 2); hmgcs1, 3-hydroxy-3-methylglutaryl-CoA synthase 1; sqle, squalene epoxidase; lss, lanosterol synthase; cyp51, lanosterol 14-demethylase; dhcr14, sterol 14-reductase; sc4mol, sterol C4 methyl-oxidase; hsd17b7, 3-keto-steroid reductase; nsdhl, 3-hydroxy 5-steroid dehydrogenase; ebp, sterol 8, 7-isomerase (data not shown except for sc5dl).

Effect of L. sakei UONUMA on Cholesterol Biosynthesis Enzymes in HepG2 Cells

Strain 1 significantly decreased the protein level of DHCR7 to about 30–35% at 0.03–0.3 mg/mL in the 15 h culture compared with the control (p < 0.05, n = 3) (Fig. 3A). Moreover, the protein level of DHCR24 significantly decreased to about 28–51% (15 h culture) and 30–61% (24 h culture) compared with the control at 0.03, 0.1, and 0.3 mg/mL (p < 0.05, n = 3), and to about 71% in the 40 h culture at 0.3 mg/mL (p < 0.05, n = 3) (Fig. 4A). These results indicate that strain 1 inhibits DHCR7 in the early stage (15 h culture) and DHCR24 is inhibited throughout the culture period.

Fig. 3. Effects of Latilactobacillus sakei UONUMA on the Protein Level of the Cholesterol Biosynthesis Enzyme DHCR7

(A) Strain 1, (B) Strain 2, (C) Strain 3. *: p < 0.05, The Mann–Whitney U test. The amount of protein was determined by measuring the β-actin band as an endogenous control, using a value of 1 for the untreated sample.

Fig. 4. Effects of Latilactobacillus sakei UONUMA on the Protein Level of DHCR24, Which Is Involved in Cholesterol Biosynthesis

(A) Strain 1, (B) Strain 2, (C) Strain 3. *: p < 0.05, The Mann–Whitney U test. The amount of protein secreted was determined by measuring the β-actin band as an endogenous control, using a value of 1 for the untreated sample.

Strain 2 significantly reduced the protein level of DHCR7 to about 22–34% in the 15 h culture and to about 49–52% in the 40 h culture at 0.03–0.3 mg/mL compared with the control (p < 0.05, n = 3) (Fig. 3B). The protein level of DHCR24 significantly decreased to about 21–41% at 0.03–0.3 mg/mL in the 15 h culture compared with the control (p < 0.05, n = 3) and further decreased to about 17% at 0.3 mg/mL (24 h culture), but increased to about 70% at 0.3 mg/mL (40 h culture) compared with the control (p < 0.05, n = 3) (Fig. 4B). These data show that strain 2 inhibited DHCR7 in the early stage, promoted it afterwards, and then further inhibited it again in the 40 h culture, and that DHCR24 is inhibited during long-duration culture.

Strain 3 significantly decreased the protein level of DHCR7 to about 39–53% at 0.03–0.3 mg/mL in the 15 h culture compared with the control (p < 0.05, n = 3) (Fig. 3C). Moreover, the protein level of DHCR24 in the 15, 24, and 40 h cultures significantly decreased to about 23–60% at 0.03–0.3 mg/mL (15 h culture), about 34–88% at 0.03–0.3 mg/mL (24 h culture), and about 47% at 0.03 mg/mL (40 h culture) (p < 0.05, n = 3) (Fig. 4C). Strain 3 suppressed DHCR7 early during culture (15 h) and persistently suppressed DHCR24. These data show that strain 3 inhibits DHCR7 in the early stage (15 h culture) and throughout the culture period.

DISCUSSION

L. sakei UONUMA strain 1 decreased the cholesterol level and increased the desmosterol level in human HepG2 hepatoma cells, suggesting that it inhibits cholesterol biosynthesis by DHCR24. Daidzein was reported to inhibit DHCR24, decrease cholesterol levels, and increase desmosterol levels in HepG2 cells.¹⁰⁾ SH42, DMHCA, MGI-21, masitinib, and ponatinib inhibit DHCR24 and result in the accumulation of desmosterol,^11–17) but MGI-21 did not result in the accumulation of zymosterol and 5α-colesta-7,24-dien-3β-ol.¹¹⁾ The k_cat (V_max/K_m) values of DHCR24 using lanosterol, zymosterol, 5α-colesta-7,24-dien-3β-ol, and desmosterol as substrates are 0.0033, 0.0201, 0.0586, and 0.0180, respectively. 5α-Colesta-7,24-dien-3β-ol provides the highest k_cat, about 18-fold higher (defining lanosterol as 1) than other substrates.⁴⁸⁾ Although the values of k_cat range from 0.03 to 0.0586, the accumulation of desmosterol is caused by the inhibition of DHCR24 and thus strain 1 inhibits DHCR24 (Fig. 5). Moreover, we comprehensively quantified the mRNA levels of other enzymes involved in cholesterol biosynthesis to identify the mechanism of action of strain 1. The mRNA level of DHCR24 was significantly decreased and the protein level was persistently reduced. As a result, strain 1 exhibited a new inhibitory effect on postsqualene cholesterol biosynthesis by inhibiting DHCR24 at the mRNA level. In addition, strain 1 had an inhibitory effect on DHCR7 because it decreased the protein level early during culture (15 h culture). However, desmosterol significantly accumulated, suggesting that DHCR24 was more strongly inhibited than DHCR7.

Fig. 5. Inhibition Sites of Latilactobacillus sakei UONUMA on the Cholesterol Biosynthesis Pathway

HMG-CoA, 3-hydroxy-3-methylglutaryl-CoA; HMGCS1, 3-hydroxy-3-methylglutaryl-CoA synthase 1; HMGCR, HMG-CoA reductase; SQLE, squalene epoxidase; LSS, lanosterol synthase; CYP51, lanosterol 14-demethylase; DHCR14, sterol 14-reductase; SC4MOL, sterol C4 methyl-oxidase; HSD17B7, 3-keto-steroid reductase; NSDHL, 3-hydroxy 5-steroid dehydrogenase; EBP, sterol 8, 7-isomerase; SC5DL, sterol C5-desaturase; DHCR7, sterol 7-reductase; DHCR24, sterol 24-reductase.

Strain 2 decreased the levels of cholesterol, lathosterol, and 7-dehydrocholesterol and increased the level of desmosterol. The mRNA level of DHCR24 was significantly decreased and its protein level was persistently reduced, suggesting that strain 2 inhibits the biosynthesis of DHCR24. Moreover, the mRNA level of DHCR7 was significantly increased but its protein level was significantly decreased during 15 and 40 h of culture, suggesting that the mRNA level of DHCR7 increased due to feedback after early inhibition of DHCR7.⁴⁹⁾

Strain 3 decreased cholesterol, lathosterol, and 7-dehydrocholesterol levels and increased desmosterol. The mRNA and protein levels of DHCR24 were significantly and persistently decreased, suggesting that strain 3 inhibits the synthesis of DHCR24. Moreover, the mRNA level of DHCR7 was significantly increased but the protein level was suppressed only during early culture (15 h culture), suggesting that the mRNA level of DHCR7 increased due to feedback after the early inhibition of DHCR7,⁴⁹⁾ similar to strain 2.

Our findings suggest that L. sakei UONUMA (strains 1–3) exhibits a new inhibitory effect on postsqualene cholesterol biosynthesis by inhibiting the mRNA level of DHCR24. In addition, all strains weakly inhibited the protein level of DHCR7. LK-980 mainly inhibits DHCR7 and results in the accumulation of lathosterol and 7-dehydrocholesterol.²³⁾ L. sakei strains 2 and 3 mainly inhibit the synthesis of DHCR24 and weakly inhibit DHCR7 as they decrease the levels of lathosterol and 7-dehydrocholestrerol (Fig. 5). Only strain 1 increased the levels of lathosterol and 7-dehydrocholesterol, and the mRNA levels of DHCR7 did not change significantly. These results may explain the differences in feedback times of strains 1–3, although the details remain unclear. L. sakei UONUMA strains 1–3 reportedly ferment sugars differently,^40,41) suggesting that each strain produces different fermentation products and thus may inhibit different sites on the cholesterol biosynthesis pathway. These strains have been identified using primers in a random amplified polymorphic DNA assay,⁴²⁾ although details have not been reported.

This is the first study to demonstrate the inhibitory effect of L. sakei UONUMA toward DHCR24 in the cholesterol biosynthesis pathway. The inhibition of DHCR24 leads to select reprogramming of fatty acid metabolism, activation of LXR target genes, inhibition of SREBP target genes, and suppression of inflammatory-response genes, as observed in macrophage foam cells.^13,24–26) All L. sakei UONUMA strains inhibited DHCR24 in the cholesterol biosynthesis pathways, suggesting that all strains could be useful for the prevention and treatment of hyperlipidemia. L. sakei UONUMA may provide a synergistic effect in lowering cholesterol when used together with HMGCR inhibitors. Lactobacillus spp. are reported to decrease cholesterol levels due to their cholesterol-binding ability,^33,34) and due to binding³⁵⁾ and deconjugation^33,34) of bile acid, the final metabolite of cholesterol. L. plantarum inhibits HMGCR during presqualene cholesterol biosynthesis,³⁶⁾ suggesting that other Lactobacillus spp. may also inhibit cholesterol biosynthesis.

Acknowledgments

This research was partly supported by the Regional Revitalization Project of the Cabinet Office, Government of Japan (A3007).

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

The online version of this article contains supplementary materials.

REFERENCES

• 1) Nelson RH. Hyperlipidemia as a risk factor for cardiovascular disease. Prim. Care, 40, 195–211 (2013).
• 2) Tanaka A. Postprandial hyperlipidemia and atherosclerosis. J. Atheroscler. Thromb., 11, 322–329 (2004).
• 3) Nakamura K, Miyoshi T, Yunoki K, Ito H. Postprandial hyperlipidemia as a potential residual risk factor. J. Cardiol., 67, 335–339 (2016).
• 4) Shia WC, Ku TH, Tsao YM, Hsia CH, Chang YM, Huang CH, Chung YC, Hsu SL, Liang KW, Hsu FR. Genetic copy number variants in myocardial infarction patients with hyperlipidemia. BMC Genomics, 12(Suppl. 3), S23 (2011).
• 5) Japan Atherosclerosis Society. Japan Atherosclerosis Society (JAS) guidelines for prevention of atherosclerotic cardiovascular disease. Japan Atherosclerosis Society, Tokyo, pp. 80–96 (2017).
• 6) Lee YS, Huh JY, Nam SH, Moon SK, Lee SB. Enzymatic bioconversion of citrus hesperidin by Aspergillus sojae naringinase: enhanced solubility of hesperetin-7-O-glucoside with in vitro inhibition of human intestinal maltase, HMG-CoA reductase, and growth of Helicobacter pylori. Food Chem., 135, 2253–2259 (2012).
• 7) Alvi SS, Iqbal D, Ahmad S, Khan MS. Molecular rationale delineating the role of lycopene as a potent HMG-CoA reductase inhibitor: in vitro and in silico study. Nat. Prod. Res., 30, 2111–2114 (2016).
• 8) Liu G, Zheng X, Xu Y, Lu J, Chen J, Huang X. Long non-coding RNAs expression profile in HepG2 cells reveals the potential role of long non-coding RNAs in the cholesterol metabolism. Chin. Med. J., 128, 91–97 (2015).
• 9) Rong S, Zhao S, Kai X, Zhang L, Zhao Y, Xiao X, Bao W, Liu L. Procyanidins extracted from the litchi pericarp attenuate atherosclerosis and hyperlipidemia associated with consumption of a high fat diet in apolipoprotein-E knockout mice. Biomed. Pharmacother., 97, 1639–1644 (2018).
• 10) Nakagawa S, Fuwa F, Shimizu-Ohta M, Yamato S. New inhibitiory effect of Daidzein on desmosterol pathway in HepG2 cells. International Journal of Analytical Bio-Science, 41, 147–152 (2018).
• 11) Müller C, Hemmers S, Bartl N, Plodek A, Körner A, Mirakaj V, Giera M, Bracher F. New chemotype of selective and potent inhibitors of human delta 24-dehydrocholesterol reductase. Eur. J. Med. Chem., 140, 305–320 (2017).
• 12) Müller C, Junker J, Bracher F, Giera M. A gas chromatography-mass spectrometry-based whole-cell screening assay for target identification in distal cholesterol biosynthesis. Nat. Protoc., 14, 2546–2570 (2019).
• 13) Körner A, Zhou E, Müller C, Mohammed Y, Herceg S, Bracher F, Rensen PCN, Wang Y, Mirakaj V, Giera M. Inhibition of Δ24-dehydrocholesterol reductase activates pro-resolving lipid mediator biosynthesis and inflammation resolution. Proc. Natl. Acad. Sci. U.S.A., 116, 20623–20634 (2019).
• 14) Pfeifer T, Buchebner M, Chandak PG, Patankar J, Kratzer A, Obrowsky S, Rechberger GN, Kadam RS, Kompella UB, Kostner GM, Kratky D, Levak-Frank S. Synthetic LXR agonist suppresses endogenous cholesterol biosynthesis and efficiently lowers plasma cholesterol. Curr. Pharm. Biotechnol., 12, 285–292 (2011).
• 15) Wages PA, Kim H-YH, Korade Z, Porter NA. Identification and characterization of prescription drugs that change levels of 7-dehydrocholesterol and desmosterol. J. Lipid Res., 59, 1916–1926 (2018).
• 16) Giera M, Müller C, Bracher F. Analysis and experimental inhibition of distal cholesterol biosynthesis. Chromatographia, 78, 343–358 (2015).
• 17) Giera M, Renard D, Plössl F, Bracher F. Lathosterol side chain amides: a new class of human lathosterol oxidase inhibitors. Steroids, 73, 299–308 (2008).
• 18) Genaro-Mattos TC, Tallman KA, Allen LB, Anderson A, Mirnics K, Korade Z, Porter NA. Dichlorophenyl piperazines, including a recently-approved atypical antipsychotic, are potent inhibitors of DHCR7, the last enzyme in cholesterol biosynthesis. Toxicol. Appl. Pharmacol., 349, 21–28 (2018).
• 19) Kim H-YH, Korade Z, Tallman KA, Liu W, Weaver CD, Mirnics K, Porter NA. Inhibitors of 7-dehydrocholesterol reductase: screening of a collection of pharmacologically active compounds in Neuro2a cells. Chem. Res. Toxicol., 29, 892–900 (2016).
• 20) Dvornik D, Hill P. Effect of long-term administration of AY-9944, an inhibitor of 7-dehydrocholesterol Δ⁷-reductase, on serum and tissue lipids in the rat. J. Lipid Res., 9, 587–595 (1968).
• 21) Moebius FF, Fitzky BU, Lee JN, Paik YK, Glossmann H. Molecular cloning and expression of the human Δ7-sterol reductase. Proc. Natl. Acad. Sci. U.S.A., 95, 1899–1902 (1998).
• 22) Chevy F, Illien F, Wolf C, Roux C. Limb malformations of rat fetuses exposed to a distal inhibitor of cholesterol biosynthesis. J. Lipid Res., 43, 1192–1200 (2002).
• 23) Acimovic J, Korosec T, Seliskar M, Bjorkhem I, Monostory K, Szabo P, Pascussi JM, Belic A, Urleb U, Kocjan D, Rozman D. Inhibition of human sterolΔ7-reductase and other postlanosterol enzymes by LK-980, a novel inhibitor of cholesterol synthesis. Drug Metab. Dispos., 39, 39–46 (2011).
• 24) Muse ED, Yu S, Edillor CR, Tao J, Spann NJ, Troutman TD, Seidman JS, Henke A, Roland JT, Ozeki KA, Thompson BM, McDonald JG, Bahadorani J, Tsimikas S, Grossman TR, Tremblay MS, Glass CK. Cell-specific discrimination of desmosterol and desmosterol mimetics confers selective regulation of LXR and SREBP in macrophages. Proc. Natl. Acad. Sci. U.S.A., 115, E4680–E4689 (2018).
• 25) Spann NJ, Garmire LX, McDonald JG, et al. Regulated accumulation of desmosterol integrates macrophage lipid metabolism and inflammatory responses. Cell, 151, 138–152 (2012).
• 26) Spann NJ, Glass CK. Sterols and oxysterols in immune cell function. Nat. Immunol., 14, 893–900 (2013).
• 27) Acimovic J, Lövgren-Sandblom A, Monostory K, Rozman D, Golicnik M, Lutjohann D, Björkhem I. Combined gas chromatographic/mass spectrometric analysis of cholesterol precursors and plant sterols in cultured cells. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci., 877, 2081–2086 (2009).
• 28) Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, O’Toole PW, Pot B, Vandamme P, Walter J, Watanabe K, Wuyts S, Felis GE, Gänzle MG, Lebeer S. A taxonomic note on the genus Lactobacillus: description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int. J. Syst. Evol. Microbiol., 70, 2782–2858 (2020).
• 29) Zhao X, Qian Y, Li G, Yi R, Park KY, Song JL. Lactobacillus plantarum YS2 (yak yogurt Lactobacillus) exhibited an activity to attenuate activated carbon-induced constipation in male Kunming mice. J. Dairy Sci., 102, 26–36 (2019).
• 30) Shida K, Suzuki T, Kiyoshima-Shibata J, Shimada S, Nanno M. Essential roles of monocytes in stimulating human peripheral blood mononuclear cells with Lactobacillus casei to produce cytokines and augment natural killer cell activity. Clin. Vaccine Immunol., 13, 997–1003 (2006).
• 31) Kato I, Tanaka K, Yokokura T. Lactic acid bacterium potently induces the production of interleukin-12 and interferon-gamma by mouse splenocytes. Int. J. Immunopharmacol., 21, 121–131 (1999).
• 32) Yamamoto N, Akino A, Takano T. Antihypertensive effects of different kinds of fermented milk in spontaneously hypertensive rats. Biosci. Biotechnol. Biochem., 58, 776–778 (1994).
• 33) Usman, Hosono A. Bile tolerance, taurocholate deconjugation, and binding of cholesterol by Lactobacillus gasseri strains. J. Dairy Sci., 82, 243–248 (1999).
• 34) Xie N, Cui Y, Yin YN, Zhao X, Yang JW, Wang ZG, Fu N, Tang Y, Wang XH, Liu XW, Wang CL, Lu FG. Effects of two Lactobacillus strains on lipid metabolism and intestinal microflora in rats fed a high-cholesterol diet. BMC Complement. Altern. Med., 11, 53 (2011).
• 35) Hashimoto H, Yamazaki K, He F, Kawase M, Hosoda M, Hosono A. Hypocholesterolemic effects of Lactobacillus casei subsp. casei TMC0409 strain observed in rats fed cholesterol contained diets. Anim. Sci. J., 70, 90–97 (1999).
• 36) Jeon YB, Lee JJ, Chang HC. Characterization of juice fermented with Lactobacillus plantarum EM and its cholesterol-lowering effects on rats fed a high-fat and high-cholesterol diet. Food Sci. Nutr., 7, 3622–3634 (2019).
• 37) Bredholt S, Nesbakken T, Holck A. Industrial application of an antilisterial strain of Lactobacillus sakei as a protective culture and its effect on the sensory acceptability of cooked, sliced, vacuum-packaged meats. Int. J. Food Microbiol., 66, 191–196 (2001).
• 38) Masuda Y, Takahashi T, Yoshida K, Nishitani Y, Mizuno M, Mizoguchi H. TLR ligands of Lactobacillus sakei LK-117 isolated from seed mash for brewing sake are potent inducers of IL-12. J. Biosci. Bioeng., 112, 363–368 (2011).
• 39) Masuda Y, Takahashi T, Yoshida K, Nishitani Y, Mizuno M, Mizoguchi H. Anti-allergic effect of lactic acid bacteria isolated from seed mash used for brewing sake is not dependent on the total IgE levels. J. Biosci. Bioeng., 114, 292–296 (2012).
• 40) Nishiwaki T, Shimojyo A. New lactic acid bacteria and method for producing fermented food using this lactic acid bacteria. Japan Patent JP5577559B2 (2014).
• 41) Oguro Y, Nishiwaki T, Shinada R, Kobayashi K, Kurahashi A. Metabolite profile of koji amazake and its lactic acid fermentation product by Lactobacillus sakei UONUMA. J. Biosci. Bioeng., 124, 178–183 (2017).
• 42) Nishiwaki T, Shimojyo S. Discrimination of the psychrotrophic lactic acid bacteria Lactobacillus sakei UONUMA strains using PCR. J. Niigata Agri. Res. Inst., 14, 69–73 (2016).
• 43) Sakurai M, Kubota M, Iguchi A, Shigematsu T, Yamaguchi T, Nakagawa S, Kurahashi A, Oguro Y, Nishiwaki T, Aihara K, Sato S. Effects of koji amazake and its lactic acid fermentation product by Lactobacillus sakei UONUMA on defecation status in healthy volunteers with relatively low stool frequency. Food Sci. Technol. Res., 25, 853–861 (2019).
• 44) Haigh LS, Leatherman GF, O’Hara DS, Smith TW, Galper JB. Effects of low density lipoproteins and mevinolin on cholesterol content and muscarinic cholinergic responsiveness in cultured chick atrial cells. Regulation of levels of muscarinic receptors and guanine nucleotide regulatory proteins. J. Biol. Chem., 263, 15608–15618 (1988).
• 45) Hirayama S, Nakagawa S, Soda S, Kamimura Y, Nishioka E, Ueno T, Fukushima Y, Higuchi K, Inoue M, Seino U, Ohmura H, Yamato S, Miida T. Ezetimibe decreases serum oxidized cholesterol without impairing bile acid synthesis in Japanese hypercholesterolemic patients. Atherosclerosis, 230, 48–51 (2013).
• 46) Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2_T^−ΔΔC method. Methods, 25, 402–408 (2001).
• 47) Kanda Y. Investigation of the freely available easy-to-use software ‘EZR’ for medical statistics. Bone Marrow Transplant., 48, 452–458 (2013).
• 48) Bae SH, Paik YK. Cholesterol biosynthesis from lanosterol: development of a novel assay method and characterization of rat liver microsomal lanosterol Δ²⁴-reductase. Biochem. J., 326, 609–616 (1997).
• 49) Ness GC. Physiological feedback regulation of cholesterol biosynthesis: role of translational control of hepatic HMG-CoA reductase and possible involvement of oxylanosterols. Biochim. Biophys. Acta, 1851, 667–673 (2015).