2024 Volume 47 Issue 6 Pages 1144-1147
Long non-coding RNAs (lncRNAs) are sequences longer than 200 nucleotides, but they do not encode proteins. Nevertheless, they have significant roles in diverse biological functions. It remains unclear how viral infections trigger the expression of lncRNAs. In our previous research, we revealed a distinct type of lncRNAs with a lifespan under 4 h in human HeLa cells. These short-lived lncRNAs might be associated with numerous regulatory roles. Given their potential impact on human physiology, these short-lived lncRNAs could be key indicators to measure polyinosinic:polycytidylic acid (poly I:C) stimulation. In our recent work, we discovered three lncRNAs: IDI2-AS1, OIP5-AS1, and LITATS1. After exposure to poly I:C, imitating viral assault in human A549 cells, IDI2-AS1 levels dropped significantly while OIP5-AS1 and LITATS1 levels rose markedly. Our results indicate that short-lived lncRNAs respond to poly I:C stimulation, exhibiting substantial changes in expression. This indicates that the understanding the role of lncRNAs in the host response to viral infection and the potential for these molecules to serve as novel therapeutic targets.
Traditionally, the primary role of RNA has been attributed to mRNA, which is translated into proteins. Research has been conducted in parallel with the study of the fluctuation in the products, namely proteins. Additionally, short non-coding RNAs, exemplified by “microRNAs” of approximately 20 nucleotides, have been extensively analyzed.1) Over 1400 of these have been identified, revealing their involvement in physiological functions such as development, cell proliferation, and carcinogenesis, among others. Specifically, microRNAs have been implicated in carcinogenesis in recent years. miRNAs can promote cancer development by suppressing the expression of tumor suppressor genes. For example, miR-21 has been shown to suppress the expression of the tumor suppressor gene PTEN, which is frequently mutated in cancer.1) On the other hand, the study of long non-coding RNAs (lncRNAs), with a nucleotide length exceeding 200, was somewhat lagging. However, recent large-scale transcriptome analyses have reported that lncRNAs are abundantly transcribed within cells and dynamically regulate intracellular gene expression mechanisms.2) These lncRNAs have been shown to have a profound impact, altering our perspectives on life itself, as they are implicated in nuclear structures, chromatin remodeling, imprinting, transcription, translation, and epigenetic control.3,4) Like mRNAs, lncRNAs are transcribed from genomic DNA by RNA polymerase II, possess a 5′ cap structure, and have a polyA tail. The distinction between mRNA and lncRNA lies in whether they have a region that is translated into proteins (mRNA) or not (lncRNA).5) However, it is also a fact that the functions of only a few dozen non-coding RNAs have been elucidated to date, and it is believed that there exist at least several thousand whose functions remain unknown.
In 2012, two distinct groups, including the authors, measured the half-life of all cellular RNAs, encompassing non-coding RNAs.6,7) It was revealed that long half-life non-coding RNAs (more than 4 h) predominantly include housekeeping-like RNAs such as ribosomal RNAs, transfer RNAs, and nucleolar small RNAs. On the other hand, short half-life non-coding RNAs (less than 4 h) primarily comprise well-characterized regulatory long non-coding RNAs like growth arrest specific 5 (GAS5),8) HOX transcript antisense RNA (HOTAIR),9) and nuclear paraspeckle assembly transcript 1 (NEAT1).10) The observed results suggest that the temporal persistence of lncRNAs may be intrinsically associated with their functional significance. Consequently, hitherto unidentified transient lncRNAs could exert modulatory effects on human cellular processes, acting as molecular markers for cellular stress.11)
Our research aimed to find new short-lived lncRNAs in human cells that alter their expression due to polyinosinic:polycytidylic acid (poly I:C) stimulation, because the growing interest in understanding the role of lncRNAs in the host response to viral infection and the potential for these molecules to serve as novel therapeutic targets. LncRNAs have been shown to play a role in the host response to viral infection.12) They can act as sensors of viral infection, suppress viral replication, or regulate viral pathogenesis. Moreover, lncRNAs are amenable to therapeutic targeting. Antisense oligonucleotides, small interfering RNAs, and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR-associated protein 9 (CRISPR-Cas9) gene editing are all potential approaches for targeting lncRNAs. We used A549 cells that are adenocarcinomic human alveolar basal epithelial cells. A549 cells are useful in vitro model of viral invading research. We identified three lncRNAs, IDI2-AS1, OIP5-AS1, and LITATS1, in A549 cells that dramatically changed expression in response to poly I:C.
Poly I:C was purchased from Tocris Bioscience (U.K.). An average size of 1.5–8 kb. Poly I:C was dissolved in water.
Cell CultureA549 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) (Wako, Japan) supplemented with 10% fetal bovine serum (FBS) at 37 °C in a humidified incubator under an atmosphere of 5% CO2.
TransfectionCells (1 × 105) were seeded into 6-well cell culture plates followed by transfection using the indicated amounts of poly I:C and Lipofectamine 2000 (Invitrogen, U.S.A.), in accordance with the manufacturer’s instructions.
RNA Isolation and RT-Quantitative PCR (RT-qPCR)Total RNA was extracted from cells with TRIzol Reagent (Thermo Fisher Scientific, U.S.A.), in accordance with the manufacturer’s instructions. The isolated RNA was reverse transcribed into cDNA using PrimeScript RT Master Mix (Perfect Real Time) (TaKaRa, Japan). The resulting cDNA was amplified using the primer sets listed in Table 1, and the levels were normalized relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB) mRNAs. Relative RNA quantities were calculated as treated values normalized relative to untreated values. We have normalized the changes in ACTB based on GAPDH, that is, normalized so that the relative quantity becomes 1. The sample numbers were three in each gene (N = 3). THUNDERBIRD SYBR qPCR mix (Toyobo, Japan) was used in accordance with the manufacturer’s instructions. For significance testing, the Student’s t-test was used. RT-qPCR analysis was performed using a Quantstudio 7 Flex (Thermo Fisher Scientific). For RT-qPCR, the sample volume was 10 µL, and three independent replicates were performed. Additionally, there were no apparent error values and all obtained data were used.
| Name | Sence sequence (5′-3′) | Antisence sequence (5′-3′) |
|---|---|---|
| GAPDH | GCACCGTCAAGGCTGAGAAC | TGGTGAAGACGCCAGTGGA |
| ACTB | CCAACCGCGAGAAGATGA | CCAGAGGCGTACAGGGATAG |
| MIR22HG | CGGACGCAGTGATTTGCT | GCTTTAGCTGGGTCAGGACA |
| GABPB1-AS1 | AGGGAAAGAAAATATGCCATTTCTA | ATCATTCCGCCGCTTTCT |
| SLC12A2-DT | GCAATTATCACGGGAAACCTAT | ATCATTCCGCCGCTTTCT |
| LINC00473 | TATGCGCGTCAGCATACTTT | TCTCCCAAAGCACAACGAG |
| FAM222A-AS1 | CAACATGGAAATGGAGACCA | CTTCCGGGATCCCAGTGT |
| CYTOR | CGTGCCTGTCTTCAGATCTTC | TCATCTCCCAGTTATTCAAGGAG |
| IDI2-AS1 | GTGTTAAACAAGACAACGCTGAA | AAGAGCGCTGGAAAAACCTT |
| SNHG15 | GCAACTCCTTTGCAAGATGC | CTCAAGGAGGGACCTCAGC |
| OIP5-AS1 | GATTTCTGCTCACTGCAGTCTCT | CCTAGCTACTTGGGAGGCTGA |
| LITATS1 | GGGGGAAGTTGTGTAACCTCT | CTCCAAGGGGCTTCGTTC |
We initially chose ten lncRNAs that have brief half-lives (t1/2 ≤ 4 h) in HeLa cells7): (a) they exceed 200 nucleotides in length; (b) they are either highly or moderately expressed with an RPKM greater than 1 according to RNA-Seq data in HeLa cells; (c) they can be found on the NCBI database; (d) they do not intersect with known protein-coding gene regions; and (e) they do not include well-characterized lncRNAs (Table 2). A549 cells were treated with Poly I:C (viral infection simulation) at a concentration of 3 µg/mL for 24 h, and alterations in the expression levels of the 10 selected lncRNAs were examined. As positive controls for poly I:C treatment, we have confirmed through microscopic observation that cells treated with Poly I:C showed a significant decrease in cell number compared to control cells (data not shown). This observation is common method according to previous studies.13) Interestingly, significant decrease of 0.2-fold in the expression level of IDI2 antisense RNA 1 (IDI2-AS1), and increases of 4.2-, and 5.9-fold in the expression levels of OIP5 antisense RNA 1 (OIP5-AS1) and lncRNA induced by transforming growth factor (TGF)-β and antagonizes TGF-β signaling 1 (LITATS1) were observed following treatment with 3 µg/mL poly I:C (Fig. 1). The basic information of the three lncRNAs are as follows. IDI2-AS1, genome location : chr10; 1022601–1045425; length : 1107 nt; NCBI RefSeq ID : NR_024628; representative previous research.14) OIP5-AS1, genome location : chr15; 41282697–41508868; length : 5320 nt; NCBI RefSeq ID : NR_026757; representative previous research.15) LITATS1, genome location : chr1; 37350616–37474517; length : 997 nt; NCBI RefSeq ID : NR_038842; representative previous research.16) Thus, we focused on the three lncRNAs in the subsequent experiments.
| Name | Accession No. | Length (nt) | t1/2* |
|---|---|---|---|
| MIR22HG | NR_028502 | 2699 | 2.4 |
| GABPB1-AS1 | NR_024490 | 4139 | 3.4 |
| SLC12A2-DT | NR_015360 | 2977 | 3.5 |
| LINC00473 | NR_026861 | 1123 | 2.4 |
| FAM222A-AS1 | NR_026661 | 1178 | 2.4 |
| CYTOR | NR_024204 | 828 | 2.4 |
| IDI2-AS1 | NR_024628 | 1107 | 3.7 |
| SNHG15 | NR_003697 | 837 | 2.6 |
| OIP5-AS1 | NR_026757 | 5320 | 3.4 |
| LITATS1 | NR_038842 | 997 | 3.0 |
*These values are taken from a previous report (Tani et al., 2012).

A549 cells were treated with 3 µg/mL Poly I:C for 24 h. Expression levels of the indicated RNAs were determined by RT-qPCR. GAPDH and ACTB were used for normalization. Values obtained from three independent experiments comparing to those of GAPDH (** p < 0.01, Student’s t test). p-Values of IDI2-AS1, OIP5-AS1, or LITATS1 were 0.0018, 0.0031, or 0.0075, respectively. Y-axis indicated that the expression levels of treated-cells was divided by the those of untreated-cells. Thus, zero indicated the RNA not detectable and one indicated the there was no change in expression levels comparing the untreated-cells.
Next, the degrees of change in expression of the three lncRNAs down or upregulated following treatment with poly I:C at various concentrations were examined (Fig. 2). The sample numbers were three in each gene (N = 3) The levels of IDI2-AS1, OIP5-AS1, and LITATS1 expression decreased or increased with changing poly I:C concentrations. These results for the three lncRNAs showed a dose-dependent response to poly I:C concentrations.

A549 cells were treated with Poly I:C for 24 h. Expression levels of the indicated RNAs were determined by RT-qPCR. GAPDH and ACTB were used for normalization. Values obtained from three independent experiments comparing to those of GAPDH (** p < 0.01, Student’s t test). In IDI2-AS1, p-values of 0.3, or 3 (Poly I:C conc.) were 0.0024, 0.0033. In OIP5-AS1, p-values of 0.03, 0.3, or 3 (Poly I:C conc.) were 0.0016, 0.0027, 0.0045. In LITATS1, p-values of 0.03, 0.3, or 3 (Poly I:C conc.) were 0.0011, 0.0019, 0.0071.
In this study, we identified three short-lived lncRNAs (IDI2-AS1, OIP5-AS1, and LITATS1) that respond to poly I:C stimulation. Poly I:C stimulation is known to inductions an immune response in cells. These observations suggest that these lncRNAs may play a crucial role in the immune response with poly I:C stress. IDI2-AS1 was down-regulated, while OIP5-AS1 and LITATS1 were up-regulated. These data suggest that the expressions of immune response genes might be controlled by the lncRNAs. The switch in expression leads to the suppression and/or acceleration of lncRNA expression, while the expression of immune response genes is changed. Recently, several lncRNAs with distinct regulatory roles in responses to chemical stresses have been identified.17) In the context of chemical stress, the upregulation of lncRNA is particularly intriguing. Moreover, our previous study has confirmed that when RNA quantities change, RNA stability either increases or decreases, and the action of ribonuclease (RNase) has been identified as a factor.17)
Recent studies showed that OIP5-AS1 maintains cell proliferation in embryonic stem cells, and this lncRNA can bind to and negatively regulate the activity of multiple cellular RNAs and microRNAs, including cyclin G associated kinase and ELAV like RNA binding protein 1.15) LITATS1 suppresses TGF-β-induced epithelial mesenchymal transition (EMT) and cancer cell plasticity by potentiating transforming growth factor β type I (TβRI) degradation.16) However, the functions of the IDI2-AS1 remain unknown. Pathogenic infections are classified as distinct forms of cellular stress.12,18) These studies documented that NEAT1 expression undergoes an upregulation in HeLa cells upon infection with either influenza or herpes simplex virus.
Several studies have demonstrated that type-I interferon can regulate lncRNA expression.19) Type-I interferon treatment upregulated the expression of the lncRNA NEAT1, which is involved in the antiviral response. Additionally, Type-I interferon downregulated the expression of the lncRNA MALAT1, which is associated with cancer progression. In addition to type-I interferon, other cytokines can also regulate lncRNA expression.20) Tumor necrosis factor-alpha (TNF-alpha) treatment upregulated the expression of the lncRNA HOTAIR, which is involved in cell proliferation and migration. Additionally, interleukin-6 (IL-6) treatment downregulated the expression of the lncRNA GAS5, which is involved in apoptosis. Poly I:C is an agonist for the toll-like receptor 3 (TLR3) signaling pathway. TLR3 signaling can induce the production of type-I interferon and other cytokines, which could potentially mediate the observed changes in lncRNA expression.21) Moreover, the size of poly I:C used in this study affects the recognition by RIG-I-like receptors. RIG-I-like receptors are a family of cytoplasmic RNA sensors that play a crucial role in host defense against viral infections. LncRNAs have emerged as important regulators of RIG-I-like receptors signal transduction.22) We believe that further research is needed to elucidate the precise mechanisms by which poly I:C treatment regulates lncRNA expression. Future studies could investigate the role of type-I interferon, other cytokines, TLR3 signaling, and RIG-I-like receptors in this process.
The limitations of this study, the changes in the expression levels of lncRNAs due to poly I:C stimulation have been only elucidated, and actual virus was not used. Future research is expected to unravel the relationship with the expression of immune response genes and to clarify their mechanisms under actual virus infection. Moreover, further studies to explore the broader role of these lncRNAs in the context of various stresses and pathogens are required. We believe that this study will contribute to elucidating the role of lncRNA in viral infections.
The authors declare no conflict of interest.