2024 Volume 47 Issue 9 Pages 1542-1549
The pathogenesis of stress-related disorders involves aberrant glucocorticoid secretion, and decreased pH and increased lactate in the brain are common phenotypes in several psychiatric disorders. Mice treated with glucocorticoids develop these phenotypes, but it is unclear how glucocorticoids affect brain pH. Therefore, we investigated the effect of corticosterone (CORT), the main glucocorticoid in rodents, on extracellular pH and lactate release in cultured astrocytes, which are the main glial cells that produce lactate in the brain. CORT treatment for one week decreased the extracellular pH and increased the extracellular lactate level via glucocorticoid receptors. CORT also increased the intracellular pyruvate level and upregulated pyruvate dehydrogenase kinase 4 (PDK4), while PDK4 overexpression increased extracellular lactate and decreased the extracellular pH. Furthermore, PDK4 inhibition suppressed the increase in extracellular lactate and the decrease in extracellular pH induced by CORT. These results suggest that increased lactate release via accumulation of intracellular pyruvate in astrocytes by chronic glucocorticoid exposure contributes to decreased brain pH.
Stressful conditions and events can occur at any time, and physiological responses to stress are necessary for organisms to adapt to environments. Stress causes peripheral physiological responses, such as increased blood pressure and heart rate, and also affects the central nervous system.1,2) Secretion of glucocorticoids from the adrenal glands is an important stress response that is triggered by activation of the hypothalamus-pituitary-adrenal (HPA) axis.3) Chronic exposure to stress enhances neuroendocrine activity, and particularly prolongs activation of HPA axis function, which causes chronic elevation of glucocorticoid secretion.4) Thus, glucocorticoid secretion caused by chronic exposure to stress is considered to be a driver of several psychiatric disorders.5)
Postmortem studies suggest that pH is lower in the brains of psychiatric patients, including schizophrenic and bipolar subjects, than in healthy controls.6–16) Decreased pH and increased lactate are also observed in the brains of several psychiatric disorder model mice.6,10,17,18) These studies suggest a negative correlation between brain pH and brain lactate levels, and changes in these parameters are common intermediate phenotypes in psychiatric disorders. A recent study also showed that chronic glucocorticoid-treated mice have decreased brain pH and increased lactate.18) However, the mechanism through which glucocorticoids affect brain pH and the possible association of the increase in lactate with decreased brain pH are unclear.
Astrocytes are glial cells that organize the structural architecture and neural plasticity of the brain.19) Storage of glycogen and production of lactate are important roles of astrocytes in maintaining neuronal activation.20,21) Neurons use both glucose and lactate as energy sources, and lactate is the major source of energy for particularly active neurons.22) We hypothesized that glucocorticoids affect lactate release in astrocytes in the brain, resulting in a decrease in the extracellular pH. In this study, we investigated the effects of glucocorticoids on extracellular pH and lactate release in cultured astrocytes.
Experimental procedures concerning the use of animals were approved by the Committee for Ethical Use of Experimental Animals of Setsunan University and conducted according to the Guide for the Care and Use of Laboratory Animals. Primary astrocytes were isolated from cerebral cortices of 3-d-old neonatal Wistar rats, which were purchased with their dams from Shimizu Laboratory Supplies (Kyoto, Japan). The cortices were isolated from the whole brain, and the meninges were removed from the cortices under a stereomicroscope. The cortices were cut into pieces of less than 1 × 1 mm, and these pieces were then digested with 0.5 g/L Trypsin–0.2 mmol ethylenediaminetetraacetic acid (EDTA) solution and 0.2 mg/mL DnaseI (11284932001; Roche Diagnostics, Mannheim, Germany). The cell suspension was cultured in Dulbecco’s modified Eagle’s medium (DMEM) High Glucose (10% fetal bovine serum (FBS), 100 units/mL Penicillin, 100 µg/mL Streptomycin) in a Primaria™ Cell Culture Flask (353824; Corning, NY, U.S.A.) at 37 °C under 5% CO2. One week later, the mixed glial cells were shaken at 180 rpm for 16 h and then the floating cells were discarded to remove microglia. Adherent cells were cultured as astrocytes in DMEM Low Glucose (10% FBS, 100 units/mL Penicillin, 100 µg/mL Streptomycin). Cultured astrocytes contained around 90% glial fibrillary acidic protein (GFAP)-positive cells as verified by immunostaining.
Astrocytes seeded at 90% confluency were treated for a week with 1 µM corticosterone (CORT) or vehicle (0.0001% dimethyl sulfoxide (DMSO)) and then used for each experiment. Treatment with 100 µM spironolactone (S0260; Tokyo Chemical Industry, Tokyo, Japan), 30 µM mifepristone (M3321; LKT Laboratories, St. Paul, MN, U.S.A.), and KPLH1130 (HY-128578; MedChemExpress, Monmouth Junction, NJ, U.S.A.) were given at the same time as CORT treatment. The medium was changed once every 3 d with a fresh medium with each drug.
A pyruvate dehydrogenase kinase 4 (PDK4) expression plasmid vector pcDNA3-PDK4 and an empty plasmid were transfected into cells using Lipofectamine 2000 (Thermo Scientific, Waltham, MA, U.S.A.). Astrocytes were seeded at 2.5 × 105 cells in 35-mm dishes and transfected with 2.5 µg of plasmid vector according to the manufacturer's instructions. In astrocytes transfected with enhanced green fluorescent protein (EGFP) expression plasmid vectors, the percentage of EGFP-positive cells was about 40–50%. Over-expression of PDK4 was confirmed by Western blot analysis (Supplementary Fig. 1). Transfected cells were cultured for one week and then used for each analysis.
PlasmidsThe PDK4 expression plasmid vector was generated by cloning the cDNA sequence of the PDK4 gene from cDNA prepared from rat primary astrocytes into the CMV promoter downstream of the pcDNA3 plasmid vector (Thermo Scientific).
Lactate MeasurementAstrocytes were seeded in 35-mm dishes at 90% confluency and treated with drugs or transfected with plasmids as described above. The cells were washed with phosphate buffered saline (PBS)(−) and the medium was replaced with fresh DMEM Low Glucose (FBS free), after which the cells were cultured for 24 h. For measurement of extracellular lactate, the culture supernatants were collected. For measurement of intracellular lactate, 1.0 × 105 cells were collected and lysed with 300 µL of 0.1% Triton-X. The cell lysates were centrifuged at 8000 × g for 5 min and the supernatants were collected. The supernatants were transferred to a VIVASPIN 500 (VS0141, MWCO 100000, PES; Sartorius, Göttingen, Germany) and centrifuged at 12000 × g for 10 min. The filtrates were collected as the measurement samples. Extracellular and intracellular lactate concentrations were measured using a Lactate Assay Kit-WST (L256; Dojindo Laboratories, Kumamoto, Japan) according to the manufacturer's instructions. Extracellular lactate levels were normalized to the absorbance of crystal violet staining. Cells were fixed with 4% paraformaldehyde, incubated for 30 min with 0.2% crystal violet solution, and then washed three times with PBS(−), after which the medium was replaced with 1% sodium dodecyl sulfate (SDS) solution. The cells were then incubated for 1 h at room temperature and the lysate was quantified by measuring absorbance at 595 nm to evaluate relative cell numbers.
Pyruvate MeasurementAstrocytes were seeded in 100-mm dishes at 90% confluency and treated with drugs as described above. After washing with PBS(−), 5.0 × 106 cells were collected as a measurement sample. Intracellular pyruvate was measured using a Pyruvate Assay Kit (700470; Cayman Chemical, Ann Arbor, MI, U.S.A.) according to the manufacturer’s instructions.
pH MeasurementAstrocytes were seeded in 35-mm dishes at 90% confluency and treated with drugs or transfected with plasmids as described above. The cells were washed with PBS(−), after which the medium was replaced with fresh DMEM Low Glucose (FBS free, sodium bicarbonate free) and the cells were cultured for 24 h. The extracellular pH was determined by measuring the pH of the collected culture supernatant with a pH Meter (AS800; As One, Osaka, Japan).
RT-Quantitative PCR (qPCR)Total RNA was prepared using a Sepasol®-RNA I Super G Kit (Nacalai Tesque, Kyoto, Japan) according to the manufacturer’s instructions. To produce cDNA, 1 µg of total RNA was reverse transcribed with a ReverTra Ace® qPCR RT Kit (Toyobo, Osaka, Japan). The mRNA expression level relative to β-actin was determined using THUNDERBIRD® SYBR® qPCR Mix (Toyobo, Osaka, Japan) for real-time PCR (Thermal Cycler Dice® Real Time System TP850; TaKaRa Bio, Shiga, Japan). Relative expressions were calculated using the ∆∆Ct method. All primer sequences are listed in Table 1.
Gene | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|
Pdk4 | CCCCGTTACCAATCAAAATC | TCAAAGGCATCTTCGACTACTG |
Slc2a1 | ACCCTGCATCTCATTGGTCT | CCAAAGATGGCCACGATACT |
Pkm1 | CTCTGGAGGCTGTTCGCAT | CGGACTCCGTCAGAACTATC |
Pkm2 | GGCTGCCATCTACCACTTG | TCCTGCCAGACTTGGTGAGC |
Ldha | GCAAACTGCTCATCGTCTCAAACC | TTCAGACTTCAGGGAGACG |
Ldhb | CTCCGTGACAGCCAATTCTAAG | GGCTGTACTTGACGATCTGAG |
Slc16a1 | GTGGCTTGATTGCAGCTTCT | GTTGAAAGCAAGCCCAAGAGC |
Slc16a3 | TGCTGCTGTTAGAGGCTGTG | CGCCAGGATGAACACATACTT |
Basigin | GTGGATGAGTGGGTCTGGTTTAAG | GACAGCTCAGGCGTGGATATAATG |
Actb | ACCCACACTGTGCCCATCTA | GCCACAGGATTCCATACCCA |
Cells were lysed using RIPA buffer containing 1× protease inhibitor cocktail (Nacalai Tesque, Kyoto, Japan). Protein concentration was determined in cell lysates using Pierce™ BCA Protein Assay Kits (Thermo Scientific). The cell lysates were mixed with an SDS-polyacrylamide gel electrophoresis (PAGE) sample buffer and boiled for 3 min at 94 °C. The samples containing equal amounts of protein (20–40 µg) were loaded into wells and were electrophoresed on 10% polyacrylamide gels. The proteins were transferred from the gel to an Immobilon-P membrane (IPVH00010; Millipore, Burlington, MA, U.S.A.). The samples were blocked in 5% skim milk for 2 h at room temperature and incubated overnight at 4 °C with primary antibodies for PDK4 (12949-1-AP, 1 : 1500; Proteintech Group, Rosemont, IL, U.S.A.), MCT4 (sc-376140, 1 : 200; Santa Cruz Biotechnology, Dallas, TX, U.S.A.) and β-actin (66009-1-Ig, 1 : 2000; Proteintech Group), followed by incubation for 1 h at room temperature with secondary antibodies for HRP-linked rabbit immunoglobulin G (IgG) (7074, 1 : 10000) and HRP-linked mouse IgG (7076, 1 : 10000) (Cell Signaling Technology, Beverly, MA, U.S.A.). The signal was detected with Chemi–Lumi One L or Chemi–Lumi One Super (Nacalai Tesque, Kyoto, Japan). Chemiluminescence images were obtained using ChemiDoc MP (Bio-Rad Laboratories, Hercules, CA, U.S.A.). Protein band intensities were quantified using ImageJ.
Statistical AnalysisStatistical analyses were performed using JMP-Pro 15.0 (SAS Institute, Cary, NC, U.S.A.). Data are presented as mean ± standard error. The p-value for each experiment was calculated using the method described in each figure legend, with p < 0.05 considered to be significant.
We first investigated whether CORT affects the extracellular pH of cultured astrocytes. Acute CORT treatment for up to 24 h did not affect the extracellular pH of astrocytes (F5, 12 = 0.85, p = 0.54, Fig. 1A). In contrast, chronic CORT treatment for one week decreased the extracellular pH (Fig. 1B). The CORT-induced decrease in extracellular pH was inhibited by the glucocorticoid receptor (GR) antagonist mifepristone, but not the mineralocorticoid receptor (MR) antagonist spironolactone (F3, 8 = 25.46, p = 0.0002, Fig. 1C, Supplementary Fig. 2). These results suggest that chronic CORT decreases the extracellular pH via GR in cultured astrocytes.
(A, B) Extracellular pH of acute (≤24 h) (A) and chronic (one week) (B) CORT-treated astrocytes (n = 3). (C) Effects of spironolactone (100 µM) and mifepristone (30 µM) on the CORT-induced decrease in extracellular pH (n = 3). Data were compared by one-way ANOVA followed by a Dunnett post hoc test (A), Student t-test (B), and one-way ANOVA followed by a Tukey–Kramer post hoc test (C). * p < 0.05, ** p < 0.01 vs. Control, # p < 0.05 vs. CORT/DMSO.
To investigate whether CORT affected lactate release from cultured astrocytes, we assessed the extracellular lactate levels of astrocytes treated with CORT. CORT treatment for one week increased extracellular lactate (Fig. 2B), whereas treatment for up to 24 h did not do so (Fig. 2A, F5, 12 = 0.63, p = 0.68). As for the extracellular pH, the CORT-induced increase in extracellular lactate levels was inhibited by mifepristone, but not by spironolactone (Fig. 2C, F3, 8 = 16.49, p = 0.0009). We further examined whether CORT changed the expression of monocarboxylate transporter 1 (MCT1; Slc16a1), monocarboxylate transporter 4 (MCT4; Slc16a3), and CD147 (Basigin), which are involved in lactate release from astrocytes. CORT increased the level of mRNA for MCT4 (Slc16a3) (Fig. 2D), which is a high-affinity transporter for export of lactate.23) The protein level of MCT4 was also upregulated by CORT (Fig. 2E, Supplementary Fig. 3A). These results suggest that chronic CORT may increase lactate release from cultured astrocytes by upregulating MCT4 via GR.
(A, B) Extracellular lactate levels in acute (≤24 h) (A) and chronic (one week) (B) CORT-treated astrocytes (n = 3). (C) Effects of spironolactone (100 µM) and mifepristone (30 µM) on the CORT-induced increase in extracellular lactate (n = 3). (D) mRNA levels of genes involved in lactate release (n = 6). (E) Protein level of MCT4 in astrocytes (n = 3). Data were compared by one-way ANOVA followed by a Dunnett post hoc test (A), Student t-test (B, D), one sample t-test (E), and one-way ANOVA followed by a Tukey–Kramer post hoc test (C). * p < 0.05 vs. Control, # p < 0.05 vs. CORT/DMSO.
We next investigated the effect of chronic CORT on the metabolic process involved in lactate production in cultured astrocytes. CORT increased intracellular pyruvate (Fig. 3A), but not intracellular lactate (Fig. 3B). We next examined whether chronic CORT changed the expression levels of PDK4, facilitated glucose transporter member 1 (GLUT1; Slc2a1), pyruvate kinase PKM isoform b (PKM1), pyruvate kinase PKM isoform a (PKM2), L-lactate dehydrogenase A (LDHA) and L-lactate dehydrogenase B (LDHB), which are all involved in the metabolic process associated with lactate production in astrocytes. CORT upregulated PDK4 at the mRNA (Fig. 3C) and protein (Fig. 3D, Supplementary Fig. 3B) levels. These results suggest that chronic CORT affects lactate production via upregulation of PDK4 in astrocytes.
(A, B) Intracellular lactate (A) and pyruvate (B) levels in CORT-treated astrocytes (n = 3). (C) mRNA levels of genes involved in lactate production (n = 6). (D) Protein levels of PDK4 in astrocytes (n = 3). Data were compared by Student t-test (A–C) and one sample t-test (D). * p < 0.05 vs. Control.
To investigate whether upregulation of PDK4 affects the extracellular lactate level and pH of astrocytes, lactate and pH were measured in PDK4-transfected astrocytes. Overexpression of PDK4 increased extracellular lactate and decreased extracellular pH in the astrocytes (Figs. 4A, B). To determine whether PDK upregulation contributes to the CORT-induced decrease in extracellular pH and increase in lactate release, astrocytes were treated with a PDK inhibitor, KPLH1130, along with CORT for one week. The CORT-induced increase in lactate release and decrease in extracellular pH were suppressed by PDK inhibition (Fig. 4C, CORT; F1, 20 = 65.75, p < 0.0001, KPLH; F1, 20 = 29.57, p < 0.0001, CORT × KPLH; F1, 20 = 1.05, p = 0.32, Fig. 4D, CORT; F1, 20 = 47.38, p < 0.0001, KPLH; F1, 20 = 273.19, p < 0.0001, CORT × KPLH; F1, 20 = 134.15, p < 0.0001). These results suggest that CORT decreases the extracellular pH by increasing lactate release via upregulation of PDK4 in astrocytes.
(A, B) Extracellular lactate (A) and pH (B) in PDK4-overexpressed astrocytes (n = 3). (C, D) Extracellular lactate (C) and pH (D) in CORT-treated astrocytes in the presence of KPLH1130 (10 µM) (n = 6). Data were compared by Student t-test (A, B) and two-way ANOVA followed by a Tukey–Kramer post hoc test (C, D). * p < 0.05 vs. Control, # p < 0.05 vs. CORT, & p < 0.05 vs. KPLH1130.
The mechanism through which glucocorticoids affect pH in the brain is poorly understood. This study showed that chronic CORT treatment decreases the extracellular pH and increases lactate release by promoting accumulation of intracellular pyruvate in cultured astrocytes. Under physiological conditions, astrocytes are the main glycolytic cells providing lactate to neurons in the brain.24,25) Lactate is a byproduct of glucose metabolism via glycolysis. PDK4 is highly expressed in astrocytes and decreases conversion of pyruvate to acetyl-CoA by inhibiting pyruvate dehydrogenase activity.26,27) These data support the idea that PDK4 upregulation contributes to the effects of CORT on extracellular pH and lactate release in astrocytes.
KPLH1130, a pan-PDK inhibitor, decreased the extracellular lactate levels of astrocytes not treated with CORT (Fig. 4C). PDK4 is the major isoform in astrocytes, so KPLH1130 is predicted to have a greater effect on lactate production via PDK4 activity in astrocytes. Additionally, astrocytes were cultured without other cell types in this study, whereas astrocytes provide lactate to neurons in the brain. It is considered that cultured astrocytes release lactate produced without neurons, a supply source of lactate, to inhibit the increase in intracellular lactate levels and the decrease in intracellular pH. Thus, KPLH1130 may inhibit lactate production and consequently prevent lactate release from cultured astrocytes not treated with CORT.
Astrocytes have a strong intracellular pH buffering capacity, and maintenance of intracellular pH is regulated by multiple factors, including proton extrusion by Na+/H+ exchangers, V-type ATPase, and proton co-transpoters.28) MCT1 and MCT4 regulate intracellular pH by proton co-transport in efflux of lactate and are modulated by CD147 to localize to the plasma membrane.23,29,30) In this study, CORT did not change the intracellular lactate levels in astrocytes (Fig. 3B), but increased the intracellular pyruvate levels (Fig. 3A) and upregulated MCT4 expression (Fig. 2E). These findings suggest that MCT4 upregulation may prevent a decrease in intracellular pH due to increased lactate production with CORT in astrocytes.
PDK4 is upregulated by several hormones, including glucocorticoids,31) and glucocorticoids regulate target gene expression by binding to GR or MR. GR binding sites are located in the human PDK4 promoter region and PDK4 upregulation by glucocorticoids requires these binding sites.32) The rat PDK4 promoter has been identified,33) but the presence of GR binding sites in this promoter has not been explored. However, two putative GR binding sites have been predicted in the rat PDK4 promoter using JASPAR,34) and these sites are located at similar regions to those in the human PDK4 promoter, which suggests that CORT upregulates PDK4 expression via GR binding to the rat PDK4 promoter. Several studies have shown that glucocorticoids downregulate MCT4 in myeloid-derived suppressor cells and chondrocytes,35,36) but no GR binding sites have been identified in the MCT4 promoter. The phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K)-RAC-alpha serine/threonine-protein kinase (AKT) pathway and the transcription factor hypoxia-inducible factor 1-alpha (HIF-1α) regulate the expression of MCT4.37–39) The acidic condition and the excessive intracellular lactate activate the PI3K-AKT pathway and HIF-1α.40–42) Thus, MCT4 upregulation by CORT may be a consequence of the decrease in the intracellular pH.
As shown in Figs. 1A and B, chronic CORT decreased the extracellular pH and increased lactate release, while acute CORT did not affect astrocytes. Acute glucocorticoid treatment has been shown to upregulate PDK4 in cultured astrocytes,43,44) and similarly, our results showed that chronic CORT upregulated PDK4 in these cells (Figs. 3C, D). These data suggest that a sustained increase in PDK4 causes an increase in intracellular sufficient to increase lactate release, resulting in a CORT-induced increase in lactate release and a decrease in extracellular pH. We note that a previous study found that chronic CORT treatment did not change PDK4 levels in vivo,45) and it is still unclear whether PDK4 levels are persistently elevated in astrocytes in vivo. Previous results were obtained by measuring expression levels in hippocampal tissue composed of diverse cell types including astrocytes.45) PDK4 expression levels in cultured astrocytes were examined in this study, so our results may have differed from the previous study. Further studies are warranted to examine if PDK4 upregulation is a key factor in the decrease in brain pH in vivo.
In conclusion, this study shows that increased lactate release by CORT induces a decrease in the extracellular pH in cultured astrocytes. Pyruvate accumulation via upregulation of PDK4 by CORT promotes lactate release in cultured astrocytes, which contributes to the acidic extracellular environment. These findings advance understanding of the contribution of glucocorticoids to the decrease in brain pH during chronic exposure to stress. Further in-depth investigation of the effects of metabolic processes on brain pH may help to reveal the mechanism underlying psychiatric disorders.
We thank Ms. Riona Oka, Ms. Mai Shigematsu, Mr. Hiroki Kudo, Ms. Ai Ryo and Mr. Tomoyuki Narusawa for technical assistance.
The authors declare no conflict of interest.
This article contains supplementary materials.