Chronic Corticosterone Treatment Decreases Extracellular pH and Increases Lactate Release via PDK4 Upregulation in Cultured Astrocytes

Abstract

The pathogenesis of stress-related disorders involves aberrant glucocorticoid secretion, and decreased pH and increased lactate in the brain are common phenotypes in several psychiatric disorders. Mice treated with glucocorticoids develop these phenotypes, but it is unclear how glucocorticoids affect brain pH. Therefore, we investigated the effect of corticosterone (CORT), the main glucocorticoid in rodents, on extracellular pH and lactate release in cultured astrocytes, which are the main glial cells that produce lactate in the brain. CORT treatment for one week decreased the extracellular pH and increased the extracellular lactate level via glucocorticoid receptors. CORT also increased the intracellular pyruvate level and upregulated pyruvate dehydrogenase kinase 4 (PDK4), while PDK4 overexpression increased extracellular lactate and decreased the extracellular pH. Furthermore, PDK4 inhibition suppressed the increase in extracellular lactate and the decrease in extracellular pH induced by CORT. These results suggest that increased lactate release via accumulation of intracellular pyruvate in astrocytes by chronic glucocorticoid exposure contributes to decreased brain pH.

INTRODUCTION

Stressful conditions and events can occur at any time, and physiological responses to stress are necessary for organisms to adapt to environments. Stress causes peripheral physiological responses, such as increased blood pressure and heart rate, and also affects the central nervous system.^1,2) Secretion of glucocorticoids from the adrenal glands is an important stress response that is triggered by activation of the hypothalamus-pituitary-adrenal (HPA) axis.³⁾ Chronic exposure to stress enhances neuroendocrine activity, and particularly prolongs activation of HPA axis function, which causes chronic elevation of glucocorticoid secretion.⁴⁾ Thus, glucocorticoid secretion caused by chronic exposure to stress is considered to be a driver of several psychiatric disorders.⁵⁾

Postmortem studies suggest that pH is lower in the brains of psychiatric patients, including schizophrenic and bipolar subjects, than in healthy controls.^6–16) Decreased pH and increased lactate are also observed in the brains of several psychiatric disorder model mice.^6,10,17,18) These studies suggest a negative correlation between brain pH and brain lactate levels, and changes in these parameters are common intermediate phenotypes in psychiatric disorders. A recent study also showed that chronic glucocorticoid-treated mice have decreased brain pH and increased lactate.¹⁸⁾ However, the mechanism through which glucocorticoids affect brain pH and the possible association of the increase in lactate with decreased brain pH are unclear.

Astrocytes are glial cells that organize the structural architecture and neural plasticity of the brain.¹⁹⁾ Storage of glycogen and production of lactate are important roles of astrocytes in maintaining neuronal activation.^20,21) Neurons use both glucose and lactate as energy sources, and lactate is the major source of energy for particularly active neurons.²²⁾ We hypothesized that glucocorticoids affect lactate release in astrocytes in the brain, resulting in a decrease in the extracellular pH. In this study, we investigated the effects of glucocorticoids on extracellular pH and lactate release in cultured astrocytes.

MATERIALS AND METHODS

Cell Culture, Treatment, and Transfection

Experimental procedures concerning the use of animals were approved by the Committee for Ethical Use of Experimental Animals of Setsunan University and conducted according to the Guide for the Care and Use of Laboratory Animals. Primary astrocytes were isolated from cerebral cortices of 3-d-old neonatal Wistar rats, which were purchased with their dams from Shimizu Laboratory Supplies (Kyoto, Japan). The cortices were isolated from the whole brain, and the meninges were removed from the cortices under a stereomicroscope. The cortices were cut into pieces of less than 1 × 1 mm, and these pieces were then digested with 0.5 g/L Trypsin–0.2 mmol ethylenediaminetetraacetic acid (EDTA) solution and 0.2 mg/mL DnaseI (11284932001; Roche Diagnostics, Mannheim, Germany). The cell suspension was cultured in Dulbecco’s modified Eagle’s medium (DMEM) High Glucose (10% fetal bovine serum (FBS), 100 units/mL Penicillin, 100 µg/mL Streptomycin) in a Primaria™ Cell Culture Flask (353824; Corning, NY, U.S.A.) at 37 °C under 5% CO₂. One week later, the mixed glial cells were shaken at 180 rpm for 16 h and then the floating cells were discarded to remove microglia. Adherent cells were cultured as astrocytes in DMEM Low Glucose (10% FBS, 100 units/mL Penicillin, 100 µg/mL Streptomycin). Cultured astrocytes contained around 90% glial fibrillary acidic protein (GFAP)-positive cells as verified by immunostaining.

Astrocytes seeded at 90% confluency were treated for a week with 1 µM corticosterone (CORT) or vehicle (0.0001% dimethyl sulfoxide (DMSO)) and then used for each experiment. Treatment with 100 µM spironolactone (S0260; Tokyo Chemical Industry, Tokyo, Japan), 30 µM mifepristone (M3321; LKT Laboratories, St. Paul, MN, U.S.A.), and KPLH1130 (HY-128578; MedChemExpress, Monmouth Junction, NJ, U.S.A.) were given at the same time as CORT treatment. The medium was changed once every 3 d with a fresh medium with each drug.

A pyruvate dehydrogenase kinase 4 (PDK4) expression plasmid vector pcDNA3-PDK4 and an empty plasmid were transfected into cells using Lipofectamine 2000 (Thermo Scientific, Waltham, MA, U.S.A.). Astrocytes were seeded at 2.5 × 10⁵ cells in 35-mm dishes and transfected with 2.5 µg of plasmid vector according to the manufacturer's instructions. In astrocytes transfected with enhanced green fluorescent protein (EGFP) expression plasmid vectors, the percentage of EGFP-positive cells was about 40–50%. Over-expression of PDK4 was confirmed by Western blot analysis (Supplementary Fig. 1). Transfected cells were cultured for one week and then used for each analysis.

Plasmids

The PDK4 expression plasmid vector was generated by cloning the cDNA sequence of the PDK4 gene from cDNA prepared from rat primary astrocytes into the CMV promoter downstream of the pcDNA3 plasmid vector (Thermo Scientific).

Lactate Measurement

Astrocytes were seeded in 35-mm dishes at 90% confluency and treated with drugs or transfected with plasmids as described above. The cells were washed with phosphate buffered saline (PBS)(−) and the medium was replaced with fresh DMEM Low Glucose (FBS free), after which the cells were cultured for 24 h. For measurement of extracellular lactate, the culture supernatants were collected. For measurement of intracellular lactate, 1.0 × 10⁵ cells were collected and lysed with 300 µL of 0.1% Triton-X. The cell lysates were centrifuged at 8000 × g for 5 min and the supernatants were collected. The supernatants were transferred to a VIVASPIN 500 (VS0141, MWCO 100000, PES; Sartorius, Göttingen, Germany) and centrifuged at 12000 × g for 10 min. The filtrates were collected as the measurement samples. Extracellular and intracellular lactate concentrations were measured using a Lactate Assay Kit-WST (L256; Dojindo Laboratories, Kumamoto, Japan) according to the manufacturer's instructions. Extracellular lactate levels were normalized to the absorbance of crystal violet staining. Cells were fixed with 4% paraformaldehyde, incubated for 30 min with 0.2% crystal violet solution, and then washed three times with PBS(−), after which the medium was replaced with 1% sodium dodecyl sulfate (SDS) solution. The cells were then incubated for 1 h at room temperature and the lysate was quantified by measuring absorbance at 595 nm to evaluate relative cell numbers.

Pyruvate Measurement

Astrocytes were seeded in 100-mm dishes at 90% confluency and treated with drugs as described above. After washing with PBS(−), 5.0 × 10⁶ cells were collected as a measurement sample. Intracellular pyruvate was measured using a Pyruvate Assay Kit (700470; Cayman Chemical, Ann Arbor, MI, U.S.A.) according to the manufacturer’s instructions.

pH Measurement

Astrocytes were seeded in 35-mm dishes at 90% confluency and treated with drugs or transfected with plasmids as described above. The cells were washed with PBS(−), after which the medium was replaced with fresh DMEM Low Glucose (FBS free, sodium bicarbonate free) and the cells were cultured for 24 h. The extracellular pH was determined by measuring the pH of the collected culture supernatant with a pH Meter (AS800; As One, Osaka, Japan).

RT-Quantitative PCR (qPCR)

Total RNA was prepared using a Sepasol^®-RNA I Super G Kit (Nacalai Tesque, Kyoto, Japan) according to the manufacturer’s instructions. To produce cDNA, 1 µg of total RNA was reverse transcribed with a ReverTra Ace^® qPCR RT Kit (Toyobo, Osaka, Japan). The mRNA expression level relative to β-actin was determined using THUNDERBIRD^® SYBR^® qPCR Mix (Toyobo, Osaka, Japan) for real-time PCR (Thermal Cycler Dice^® Real Time System TP850; TaKaRa Bio, Shiga, Japan). Relative expressions were calculated using the ∆∆Ct method. All primer sequences are listed in Table 1.

Table 1. Primer Sequences Used for qPCR

Gene	Forward (5′–3′)	Reverse (5′–3′)
Pdk4	CCCCGTTACCAATCAAAATC	TCAAAGGCATCTTCGACTACTG
Slc2a1	ACCCTGCATCTCATTGGTCT	CCAAAGATGGCCACGATACT
Pkm1	CTCTGGAGGCTGTTCGCAT	CGGACTCCGTCAGAACTATC
Pkm2	GGCTGCCATCTACCACTTG	TCCTGCCAGACTTGGTGAGC
Ldha	GCAAACTGCTCATCGTCTCAAACC	TTCAGACTTCAGGGAGACG
Ldhb	CTCCGTGACAGCCAATTCTAAG	GGCTGTACTTGACGATCTGAG
Slc16a1	GTGGCTTGATTGCAGCTTCT	GTTGAAAGCAAGCCCAAGAGC
Slc16a3	TGCTGCTGTTAGAGGCTGTG	CGCCAGGATGAACACATACTT
Basigin	GTGGATGAGTGGGTCTGGTTTAAG	GACAGCTCAGGCGTGGATATAATG
Actb	ACCCACACTGTGCCCATCTA	GCCACAGGATTCCATACCCA

Western Blotting

Cells were lysed using RIPA buffer containing 1× protease inhibitor cocktail (Nacalai Tesque, Kyoto, Japan). Protein concentration was determined in cell lysates using Pierce™ BCA Protein Assay Kits (Thermo Scientific). The cell lysates were mixed with an SDS-polyacrylamide gel electrophoresis (PAGE) sample buffer and boiled for 3 min at 94 °C. The samples containing equal amounts of protein (20–40 µg) were loaded into wells and were electrophoresed on 10% polyacrylamide gels. The proteins were transferred from the gel to an Immobilon-P membrane (IPVH00010; Millipore, Burlington, MA, U.S.A.). The samples were blocked in 5% skim milk for 2 h at room temperature and incubated overnight at 4 °C with primary antibodies for PDK4 (12949-1-AP, 1 : 1500; Proteintech Group, Rosemont, IL, U.S.A.), MCT4 (sc-376140, 1 : 200; Santa Cruz Biotechnology, Dallas, TX, U.S.A.) and β-actin (66009-1-Ig, 1 : 2000; Proteintech Group), followed by incubation for 1 h at room temperature with secondary antibodies for HRP-linked rabbit immunoglobulin G (IgG) (7074, 1 : 10000) and HRP-linked mouse IgG (7076, 1 : 10000) (Cell Signaling Technology, Beverly, MA, U.S.A.). The signal was detected with Chemi–Lumi One L or Chemi–Lumi One Super (Nacalai Tesque, Kyoto, Japan). Chemiluminescence images were obtained using ChemiDoc MP (Bio-Rad Laboratories, Hercules, CA, U.S.A.). Protein band intensities were quantified using ImageJ.

Statistical Analysis

Statistical analyses were performed using JMP-Pro 15.0 (SAS Institute, Cary, NC, U.S.A.). Data are presented as mean ± standard error. The p-value for each experiment was calculated using the method described in each figure legend, with p < 0.05 considered to be significant.

RESULTS

Chronic CORT Decreases Extracellular pH via GRs in Cultured Astrocytes

We first investigated whether CORT affects the extracellular pH of cultured astrocytes. Acute CORT treatment for up to 24 h did not affect the extracellular pH of astrocytes (F_{5, 12} = 0.85, p = 0.54, Fig. 1A). In contrast, chronic CORT treatment for one week decreased the extracellular pH (Fig. 1B). The CORT-induced decrease in extracellular pH was inhibited by the glucocorticoid receptor (GR) antagonist mifepristone, but not the mineralocorticoid receptor (MR) antagonist spironolactone (F_{3, 8} = 25.46, p = 0.0002, Fig. 1C, Supplementary Fig. 2). These results suggest that chronic CORT decreases the extracellular pH via GR in cultured astrocytes.

Fig. 1. Effects of Acute and Chronic CORT Treatment on the Extracellular pH of Cultured Astrocytes

(A, B) Extracellular pH of acute (≤24 h) (A) and chronic (one week) (B) CORT-treated astrocytes (n = 3). (C) Effects of spironolactone (100 µM) and mifepristone (30 µM) on the CORT-induced decrease in extracellular pH (n = 3). Data were compared by one-way ANOVA followed by a Dunnett post hoc test (A), Student t-test (B), and one-way ANOVA followed by a Tukey–Kramer post hoc test (C). * p < 0.05, ** p < 0.01 vs. Control, ^# p < 0.05 vs. CORT/DMSO.

Chronic CORT Increases Lactate Release via GRs in Cultured Astrocytes

To investigate whether CORT affected lactate release from cultured astrocytes, we assessed the extracellular lactate levels of astrocytes treated with CORT. CORT treatment for one week increased extracellular lactate (Fig. 2B), whereas treatment for up to 24 h did not do so (Fig. 2A, F_{5, 12} = 0.63, p = 0.68). As for the extracellular pH, the CORT-induced increase in extracellular lactate levels was inhibited by mifepristone, but not by spironolactone (Fig. 2C, F_{3, 8} = 16.49, p = 0.0009). We further examined whether CORT changed the expression of monocarboxylate transporter 1 (MCT1; Slc16a1), monocarboxylate transporter 4 (MCT4; Slc16a3), and CD147 (Basigin), which are involved in lactate release from astrocytes. CORT increased the level of mRNA for MCT4 (Slc16a3) (Fig. 2D), which is a high-affinity transporter for export of lactate.²³⁾ The protein level of MCT4 was also upregulated by CORT (Fig. 2E, Supplementary Fig. 3A). These results suggest that chronic CORT may increase lactate release from cultured astrocytes by upregulating MCT4 via GR.

Fig. 2. Effects of Acute and Chronic CORT Treatment on Lactate Release from Cultured Astrocytes

(A, B) Extracellular lactate levels in acute (≤24 h) (A) and chronic (one week) (B) CORT-treated astrocytes (n = 3). (C) Effects of spironolactone (100 µM) and mifepristone (30 µM) on the CORT-induced increase in extracellular lactate (n = 3). (D) mRNA levels of genes involved in lactate release (n = 6). (E) Protein level of MCT4 in astrocytes (n = 3). Data were compared by one-way ANOVA followed by a Dunnett post hoc test (A), Student t-test (B, D), one sample t-test (E), and one-way ANOVA followed by a Tukey–Kramer post hoc test (C). * p < 0.05 vs. Control, ^# p < 0.05 vs. CORT/DMSO.

Chronic CORT Affects Lactate Production via Upregulation of PDK4 in Cultured Astrocytes

We next investigated the effect of chronic CORT on the metabolic process involved in lactate production in cultured astrocytes. CORT increased intracellular pyruvate (Fig. 3A), but not intracellular lactate (Fig. 3B). We next examined whether chronic CORT changed the expression levels of PDK4, facilitated glucose transporter member 1 (GLUT1; Slc2a1), pyruvate kinase PKM isoform b (PKM1), pyruvate kinase PKM isoform a (PKM2), L-lactate dehydrogenase A (LDHA) and L-lactate dehydrogenase B (LDHB), which are all involved in the metabolic process associated with lactate production in astrocytes. CORT upregulated PDK4 at the mRNA (Fig. 3C) and protein (Fig. 3D, Supplementary Fig. 3B) levels. These results suggest that chronic CORT affects lactate production via upregulation of PDK4 in astrocytes.

Fig. 3. Effects of Chronic CORT Treatment on the Intracellular Pyruvate Levels and Lactate Levels, and the mRNA Expression of the Genes Related to Lactate Production in Astrocytes

(A, B) Intracellular lactate (A) and pyruvate (B) levels in CORT-treated astrocytes (n = 3). (C) mRNA levels of genes involved in lactate production (n = 6). (D) Protein levels of PDK4 in astrocytes (n = 3). Data were compared by Student t-test (A–C) and one sample t-test (D). * p < 0.05 vs. Control.

Upregulation of PDK4 by Chronic CORT in Cultured Astrocytes Decreases Extracellular pH and Increases Lactate Release

To investigate whether upregulation of PDK4 affects the extracellular lactate level and pH of astrocytes, lactate and pH were measured in PDK4-transfected astrocytes. Overexpression of PDK4 increased extracellular lactate and decreased extracellular pH in the astrocytes (Figs. 4A, B). To determine whether PDK upregulation contributes to the CORT-induced decrease in extracellular pH and increase in lactate release, astrocytes were treated with a PDK inhibitor, KPLH1130, along with CORT for one week. The CORT-induced increase in lactate release and decrease in extracellular pH were suppressed by PDK inhibition (Fig. 4C, CORT; F_{1, 20} = 65.75, p < 0.0001, KPLH; F_{1, 20} = 29.57, p < 0.0001, CORT × KPLH; F_{1, 20} = 1.05, p = 0.32, Fig. 4D, CORT; F_{1, 20} = 47.38, p < 0.0001, KPLH; F_{1, 20} = 273.19, p < 0.0001, CORT × KPLH; F_{1, 20} = 134.15, p < 0.0001). These results suggest that CORT decreases the extracellular pH by increasing lactate release via upregulation of PDK4 in astrocytes.

Fig. 4. PDK4 Upregulation Induces an Increase in Lactate Release and a Decrease in Extracellular pH

(A, B) Extracellular lactate (A) and pH (B) in PDK4-overexpressed astrocytes (n = 3). (C, D) Extracellular lactate (C) and pH (D) in CORT-treated astrocytes in the presence of KPLH1130 (10 µM) (n = 6). Data were compared by Student t-test (A, B) and two-way ANOVA followed by a Tukey–Kramer post hoc test (C, D). * p < 0.05 vs. Control, ^# p < 0.05 vs. CORT, ^& p < 0.05 vs. KPLH1130.

DISCUSSION

The mechanism through which glucocorticoids affect pH in the brain is poorly understood. This study showed that chronic CORT treatment decreases the extracellular pH and increases lactate release by promoting accumulation of intracellular pyruvate in cultured astrocytes. Under physiological conditions, astrocytes are the main glycolytic cells providing lactate to neurons in the brain.^24,25) Lactate is a byproduct of glucose metabolism via glycolysis. PDK4 is highly expressed in astrocytes and decreases conversion of pyruvate to acetyl-CoA by inhibiting pyruvate dehydrogenase activity.^26,27) These data support the idea that PDK4 upregulation contributes to the effects of CORT on extracellular pH and lactate release in astrocytes.

KPLH1130, a pan-PDK inhibitor, decreased the extracellular lactate levels of astrocytes not treated with CORT (Fig. 4C). PDK4 is the major isoform in astrocytes, so KPLH1130 is predicted to have a greater effect on lactate production via PDK4 activity in astrocytes. Additionally, astrocytes were cultured without other cell types in this study, whereas astrocytes provide lactate to neurons in the brain. It is considered that cultured astrocytes release lactate produced without neurons, a supply source of lactate, to inhibit the increase in intracellular lactate levels and the decrease in intracellular pH. Thus, KPLH1130 may inhibit lactate production and consequently prevent lactate release from cultured astrocytes not treated with CORT.

Astrocytes have a strong intracellular pH buffering capacity, and maintenance of intracellular pH is regulated by multiple factors, including proton extrusion by Na⁺/H⁺ exchangers, V-type ATPase, and proton co-transpoters.²⁸⁾ MCT1 and MCT4 regulate intracellular pH by proton co-transport in efflux of lactate and are modulated by CD147 to localize to the plasma membrane.^23,29,30) In this study, CORT did not change the intracellular lactate levels in astrocytes (Fig. 3B), but increased the intracellular pyruvate levels (Fig. 3A) and upregulated MCT4 expression (Fig. 2E). These findings suggest that MCT4 upregulation may prevent a decrease in intracellular pH due to increased lactate production with CORT in astrocytes.

PDK4 is upregulated by several hormones, including glucocorticoids,³¹⁾ and glucocorticoids regulate target gene expression by binding to GR or MR. GR binding sites are located in the human PDK4 promoter region and PDK4 upregulation by glucocorticoids requires these binding sites.³²⁾ The rat PDK4 promoter has been identified,³³⁾ but the presence of GR binding sites in this promoter has not been explored. However, two putative GR binding sites have been predicted in the rat PDK4 promoter using JASPAR,³⁴⁾ and these sites are located at similar regions to those in the human PDK4 promoter, which suggests that CORT upregulates PDK4 expression via GR binding to the rat PDK4 promoter. Several studies have shown that glucocorticoids downregulate MCT4 in myeloid-derived suppressor cells and chondrocytes,^35,36) but no GR binding sites have been identified in the MCT4 promoter. The phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K)-RAC-alpha serine/threonine-protein kinase (AKT) pathway and the transcription factor hypoxia-inducible factor 1-alpha (HIF-1α) regulate the expression of MCT4.^37–39) The acidic condition and the excessive intracellular lactate activate the PI3K-AKT pathway and HIF-1α.^40–42) Thus, MCT4 upregulation by CORT may be a consequence of the decrease in the intracellular pH.

As shown in Figs. 1A and B, chronic CORT decreased the extracellular pH and increased lactate release, while acute CORT did not affect astrocytes. Acute glucocorticoid treatment has been shown to upregulate PDK4 in cultured astrocytes,^43,44) and similarly, our results showed that chronic CORT upregulated PDK4 in these cells (Figs. 3C, D). These data suggest that a sustained increase in PDK4 causes an increase in intracellular sufficient to increase lactate release, resulting in a CORT-induced increase in lactate release and a decrease in extracellular pH. We note that a previous study found that chronic CORT treatment did not change PDK4 levels in vivo,⁴⁵⁾ and it is still unclear whether PDK4 levels are persistently elevated in astrocytes in vivo. Previous results were obtained by measuring expression levels in hippocampal tissue composed of diverse cell types including astrocytes.⁴⁵⁾ PDK4 expression levels in cultured astrocytes were examined in this study, so our results may have differed from the previous study. Further studies are warranted to examine if PDK4 upregulation is a key factor in the decrease in brain pH in vivo.

In conclusion, this study shows that increased lactate release by CORT induces a decrease in the extracellular pH in cultured astrocytes. Pyruvate accumulation via upregulation of PDK4 by CORT promotes lactate release in cultured astrocytes, which contributes to the acidic extracellular environment. These findings advance understanding of the contribution of glucocorticoids to the decrease in brain pH during chronic exposure to stress. Further in-depth investigation of the effects of metabolic processes on brain pH may help to reveal the mechanism underlying psychiatric disorders.

Acknowledgments

We thank Ms. Riona Oka, Ms. Mai Shigematsu, Mr. Hiroki Kudo, Ms. Ai Ryo and Mr. Tomoyuki Narusawa for technical assistance.

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

This article contains supplementary materials.

REFERENCES

• 1) de Kloet ER, Joëls M, Holsboer F. Stress and the brain: from adaptation to disease. Nat. Rev. Neurosci., 6, 463–475 (2005).
• 2) LaBar KS, Cabeza R. Cognitive neuroscience of emotional memory. Nat. Rev. Neurosci., 7, 54–64 (2006).
• 3) Smith SM, Vale WW. The role of the hypothalamic-pituitary-adrenal axis in neuroendocrine responses to stress. Dialogues Clin. Neurosci., 8, 383–395 (2006).
• 4) Herman JP, McKlveen JM, Ghosal S, Kopp B, Wulsin A, Makinson R, Scheimann J, Myers B. Regulation of the hypothalamic-pituitary-adrenocortical stress response. Compr. Physiol., 6, 603–621 (2016).
• 5) Odaka H, Adachi N, Numakawa T. Impact of glucocorticoid on neurogenesis. Neural Regen. Res., 12, 1028–1035 (2017).
• 6) Halim ND, Lipska BK, Hyde TM, Deep-Soboslay A, Saylor EM, Herman M, Thakar J, Verma A, Kleinman JE. Increased lactate levels and reduced pH in postmortem brains of schizophrenics: medication confounds. J. Neurosci. Methods, 169, 208–213 (2008).
• 7) Lipska BK, Deep-Soboslay A, Weickert CS, Hyde TM, Martin CE, Herman MM, Kleinman JE. Critical factors in gene expression in postmortem human brain: focus on studies in schizophrenia. Biol. Psychiatry, 60, 650–658 (2006).
• 8) Mistry M, Gillis J, Pavlidis P. Meta-analysis of gene coexpression networks in the post-mortem prefrontal cortex of patients with schizophrenia and unaffected controls. BMC Neurosci., 14, 105 (2013).
• 9) Dogan AE, Yuksel C, Du F, Chouinard V-A, Öngür D. Brain lactate and pH in schizophrenia and bipolar disorder: a systematic review of findings from magnetic resonance studies. Neuropsychopharmacology, 43, 1681–1690 (2018).
• 10) Hagihara H, Catts VS, Katayama Y, Shoji H, Takagi T, Huang FL, Nakao A, Mori Y, Huang K-P, Ishii S, Graef IA, Nakayama KI, Shannon Weickert C, Miyakawa T. Decreased brain pH as a shared endophenotype of psychiatric disorders. Neuropsychopharmacology, 43, 459–468 (2018).
• 11) Young AM, Campbell E, Lynch S, Suckling J, Powis SJ. Aberrant NF-kappaB expression in autism spectrum condition: a mechanism for neuroinflammation. Front. Psychiatry, 2, 27 (2011).
• 12) Dager SR, Friedman SD, Parow A, Demopulos C, Stoll AL, Lyoo IK, Dunner DL, Renshaw PF. Brain metabolic alterations in medication-free patients with bipolar disorder. Arch. Gen. Psychiatry, 61, 450–458 (2004).
• 13) Machado-Vieira R, Zanetti MV, Otaduy MC, De Sousa RT, Soeiro-de-Souza MG, Costa AC, Carvalho AF, Leite CC, Busatto GF, Zarate CA Jr, Gattaz WF. Increased brain lactate during depressive episodes and reversal effects by lithium monotherapy in drug-naive bipolar disorder: a 3-T 1H-MRS study. J. Clin. Psychopharmacol., 37, 40–45 (2017).
• 14) Rowland LM, Pradhan S, Korenic S, Wijtenburg SA, Hong LE, Edden RA, Barker PB. Elevated brain lactate in schizophrenia: a 7 T magnetic resonance spectroscopy study. Transl. Psychiatry, 6, e967 (2016).
• 15) Soeiro-de-Souza MG, Pastorello BF, Leite C da C, Henning A, Moreno RA, Garcia Otaduy MC. Dorsal anterior cingulate lactate and glutathione levels in euthymic bipolar I disorder: 1H-MRS study. Int. J. Neuropsychopharmacol., 19, pyw032 (2016).
• 16) Kato T, Murashita J, Kamiya A, Shioiri T, Kato N, Inubushi T. Decreased brain intracellular pH measured by 31P-MRS in bipolar disorder: a confirmation in drug-free patients and correlation with white matter hyperintensity. Eur. Arch. Psychiatry Clin. Neurosci., 248, 301–306 (1998).
• 17) Sullivan CR, Mielnik CA, Funk A, O’Donovan SM, Bentea E, Pletnikov M, Ramsey AJ, Wen Z, Rowland LM, McCullumsmith RE. Measurement of lactate levels in postmortem brain, iPSCs, and animal models of schizophrenia. Sci. Rep., 9, 5087 (2019).
• 18) Hagihara H, Shoji H, Hattori S, et al. Large-scale animal model study uncovers altered brain pH and lactate levels as a transdiagnostic endophenotype of neuropsychiatric disorders involving cognitive impairment. eLife, 12, RP89376 (2024).
• 19) Nedergaard M, Ransom B, Goldman SA. New roles for astrocytes: redefining the functional architecture of the brain. Trends Neurosci., 26, 523–530 (2003).
• 20) Bélanger M, Allaman I, Magistretti PJ. Brain energy metabolism: focus on astrocyte-neuron metabolic cooperation. Cell Metab., 14, 724–738 (2011).
• 21) Alberini CM, Cruz E, Descalzi G, Bessières B, Gao V. Astrocyte glycogen and lactate: new insights into learning and memory mechanisms. Glia, 66, 1244–1262 (2018).
• 22) Karagiannis A, Gallopin T, Lacroix A, Plaisier F, Piquet J, Geoffroy H, Hepp R, Naudé J, Le Gac B, Egger R, Lambolez B, Li D, Rossier J, Staiger JF, Imamura H, Seino S, Roeper J, Cauli B. Lactate is an energy substrate for rodent cortical neurons and enhances their firing activity. eLife, 10, e71424 (2021).
• 23) Dimmer K-S, Friedrich B, Lang F, Deitmer JW, Bröer S. The low-affinity monocarboxylate transporter MCT4 is adapted to the export of lactate in highly glycolytic cells. Biochem. J., 350, 219–227 (2000).
• 24) Barros LF. Metabolic signaling by lactate in the brain. Trends Neurosci., 36, 396–404 (2013).
• 25) Pellerin L, Magistretti PJ. Glutamate uptake into astrocytes stimulates aerobic glycolysis: a mechanism coupling neuronal activity to glucose utilization. Proc. Natl. Acad. Sci. U.S.A., 91, 10625–10629 (1994).
• 26) Zhang Y, Chen K, Sloan SA, Bennett ML, Scholze AR, O’Keeffe S, Phatnani HP, Guarnieri P, Caneda C, Ruderisch N, Deng S, Liddelow SA, Zhang C, Daneman R, Maniatis T, Barres BA, Wu JQ. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. J. Neurosci., 34, 11929–11947 (2014).
• 27) Kumar Jha M, Jeon S, Suk K. Pyruvate dehydrogenase kinases in the nervous system: their principal functions in neuronal-glial metabolic interaction and neuro-metabolic disorders. Curr. Neuropharmacol., 10, 393–403 (2012).
• 28) Chesler M. Regulation and modulation of pH in the brain. Physiol. Rev., 83, 1183–1221 (2003).
• 29) Bergersen L, Wærhaug O, Helm J, Thomas M, Laake P, Davies AJ, Wilson MC, Halestrap AP, Ottersen OP. A novel postsynaptic density protein: the monocarboxylate transporter MCT2 is co-localized with δ-glutamate receptors in postsynaptic densities of parallel fiber–Purkinje cell synapses. Exp. Brain Res., 136, 523–534 (2001).
• 30) Pierre K, Pellerin L. Monocarboxylate transporters in the central nervous system: distribution, regulation and function. J. Neurochem., 94, 1–14 (2005).
• 31) Jeong JY, Jeoung NH, Park K-G, Lee I-K. Transcriptional regulation of pyruvate dehydrogenase kinase. Diabetes Metab. J., 36, 328–335 (2012).
• 32) Connaughton S, Chowdhury F, Attia RR, Song S, Zhang Y, Elam MB, Cook GA, Park EA. Regulation of pyruvate dehydrogenase kinase isoform 4 (PDK4) gene expression by glucocorticoids and insulin. Mol. Cell. Endocrinol., 315, 159–167 (2010).
• 33) Ma K, Zhang Y, Elam MB, Cook GA, Park EA. Cloning of the rat pyruvate dehydrogenase kinase 4 gene promoter: activation of pyruvate dehydrogenase kinase 4 by the peroxisome proliferator-activated receptor γ coactivator. J. Biol. Chem., 280, 29525–29532 (2005).
• 34) Rauluseviciute I, Riudavets-Puig R, Blanc-Mathieu R, Castro-Mondragon JA, Ferenc K, Kumar V, Lemma RB, Lucas J, Chèneby J, Baranasic D, Khan A, Fornes O, Gundersen S, Johansen M, Hovig E, Lenhard B, Sandelin A, Wasserman WW, Parcy F, Mathelier A. JASPAR 2024: 20th anniversary of the open-access database of transcription factor binding profiles. Nucleic Acids Res., 52 (D1), D174–D182 (2024).
• 35) Lu Y, Liu H, Bi Y, Yang H, Li Y, Wang J, Zhang Z, Wang Y, Li C, Jia A, Han L, Hu Y, Zhao Y, Wang R, Liu G. Glucocorticoid receptor promotes the function of myeloid-derived suppressor cells by suppressing HIF1α-dependent glycolysis. Cell. Mol. Immunol., 15, 618–629 (2018).
• 36) Li Q, Chen H, Li Z, Zhang F, Chen L. Glucocorticoid caused lactic acid accumulation and damage in human chondrocytes via ROS-mediated inhibition of monocarboxylate transporter 4. Bone, 155, 116299 (2022).
• 37) Ullah MS, Davies AJ, Halestrap AP. The plasma membrane lactate transporter MCT4, but not MCT1, is up-regulated by hypoxia through a HIF-1α-dependent mechanism. J. Biol. Chem., 281, 9030–9037 (2006).
• 38) Baenke F, Dubuis S, Brault C, Weigelt B, Dankworth B, Griffiths B, Jiang M, Mackay A, Saunders B, Spencer-Dene B, Ros S, Stamp G, Reis-Filho JS, Howell M, Zamboni N, Schulze A. Functional screening identifies MCT4 as a key regulator of breast cancer cell metabolism and survival. J. Pathol., 237, 152–165 (2015).
• 39) Otake S, Kobayashi M, Narumi K, Sasaki S, Kikutani Y, Furugen A, Watanabe M, Takahashi N, Ogura J, Yamaguchi H, Iseki K. Regulation of the expression and activity of glucose and lactic acid metabolism-related genes by protein kinase C in skeletal muscle cells. Biol. Pharm. Bull., 36, 1435–1439 (2013).
• 40) Rafiee P, Theriot ME, Nelson VM, Heidemann J, Kanaa Y, Horowitz SA, Rogaczewski A, Johnson CP, Ali I, Shaker R, Binion DG. Human esophageal microvascular endothelial cells respond to acidic pH stress by PI3K/AKT and p38 MAPK-regulated induction of Hsp70 and Hsp27. Am. J. Physiol. Cell Physiol., 291, C931–C945 (2006).
• 41) Gan X, Zhang R, Gu J, Ju Z, Wu X, Wang Q, Peng H, Qiu J, Zhou J, Cheng F, Lu L. Acidic microenvironment regulates the severity of hepatic ischemia/reperfusion injury by modulating the generation and function of tregs via the PI3K-mTOR pathway. Front. Immunol., 10, 2945 (2020).
• 42) Wei S, Zhang J, Zhao R, Shi R, An L, Yu Z, Zhang Q, Zhang J, Yao Y, Li H, Wang H. Histone lactylation promotes malignant progression by facilitating USP39 expression to target PI3K/AKT/HIF-1α signal pathway in endometrial carcinoma. Cell Death Discov., 10, 121 (2024).
• 43) Carter BS, Meng F, Thompson RC. Glucocorticoid treatment of astrocytes results in temporally dynamic transcriptome regulation and astrocyte-enriched mRNA changes in vitro. Physiol. Genomics, 44, 1188–1200 (2012).
• 44) Slezak M, Korostynski M, Gieryk A, Golda S, Dzbek J, Piechota M, Wlazlo E, Bilecki W, Przewlocki R. Astrocytes are a neural target of morphine action via glucocorticoid receptor-dependent signaling. Glia, 61, 623–635 (2013).
• 45) Carter BS, Hamilton DE, Thompson RC. Acute and chronic glucocorticoid treatments regulate astrocyte-enriched mRNAs in multiple brain regions in vivo. Front. Neurosci., 7, 139 (2013).