Liquiritigenin Attenuated Collagen-Induced Arthritis and Cardiac Complication via Inflammation and Fibrosis Inhibition in Mice

Abstract

Rheumatoid arthritis (RA) is a common autoimmune disease with increased cardiovascular disease risk. Liquiritigenin (LG) is a triterpene with anti-inflammatory properties. Our study aimed to explore the effect of LG on RA and the cardiac complication. Collagen-induced arthritis (CIA) mice with LG treatment exhibited obvious alleviation in histopathological changes, accompanied by the decreased expression of tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, and IL-17A in synovium and serum. LG attenuated cartilage destruction by reducing matrix metalloproteinase (MMP)-3 and MMP-13 expression in the synovium of CIA mice. The echocardiography results proved the alleviation of cardiac dysfunction in CIA mice. The electrocardiogram, biochemical, and histochemical analysis proved the cardioprotection effect of LG against RA. The decreased expression of inflammatory factors (TNF-α, IL-1β, and IL-6) and fibrotic markers (fibronectin, Collagen I, and Collagen III) in cardiac tissues of CIA mice further corroborated the attenuation of myocardial inflammation and fibrosis by LG. Mechanistic studies showed that LG could inhibit transforming growth factor β-1 (TGF-β1) and phos-Smad2/3 expression in cardiac tissues of CIA mice. Our study suggested that LG could relieve RA and its cardiac complication probably by inhibiting the TGF-β1/Smad2/3 pathway. All these suggested that LG might be a potential candidate for RA and its cardiac complication therapy.

Introduction

Rheumatoid arthritis (RA) is the commonest form of chronic autoimmune inflammatory arthritis with a significant negative influence on patients’ ability to perform daily activities, including work and family tasks, and on health-related QOL.¹⁾ The incidence of RA is currently on the rise, with a worldwide prevalence of about 1%.²⁾ The prevalence of RA in China is 0.28–0.40%, with about 5 million people suffering from this disease.³⁾ RA is characterized by synovial inflammation (synovitis), progressive cartilage destruction, and bone erosion, ultimately leading to loss of integrity of the affected joint.⁴⁾ Persistent systemic inflammation in RA has been reported to cause tissue damage to organs such as the lung, heart, eye, and bone.⁵⁾ Among them, cardiac involvement is common and is correlated with significant morbidity and mortality.⁶⁾ Giles et al.⁷⁾ reported that the chronic form of inflammatory cytokines in RA may lead to myocardial dysfunction in RA patients. In addition, in the RA mice model, the activation of inflammation during RA has long-term effects on molecular remodeling and systolic function of the heart, further supporting that the development of cardiac injury should be attended to in RA disease.⁸⁾

Glycyrrhiza uralensis, also called Chinese liquorice (Gan-cao), was widely used as an herbal medicine in both Eastern and Western countries.⁹⁾ Their roots or rhizomes are the medicinal parts from which a large number of pharmacologically active triterpenoids and flavonoids are extracted, including liquiritin, glabridin, and liquiritigenin (LG). Among them, LG is one of the most interesting active flavonoids.¹⁰⁾ It processes a variety of pharmacological properties, such as anti-apoptotic, anti-inflammatory, anti-oxidant, and anti-fibrotic activities.¹¹⁾ In diabetic nephropathy, LG attenuated HG-induced oxidative stress and inflammation by depression of the nuclear factor-kappaB (NF-κB) and NLRP3 inflammasome pathways.¹²⁾ As previously reported, LG inhibited inflammation and cartilage matrix degradation induced by interleukin (IL)-1β in rat chondrocytes.¹³⁾ Studies have investigated the effect of LG on osteoblasts and identified positive effects on collagen synthesis, the promotion of osteoblasts differentiation as well as the suppression of osteoclasts differentiation.¹⁴⁾ In addition, there is evidence that LG impeded fibrosis and inflammatory response to protect against high-glucose feeding-induced cardiac injury.¹⁵⁾ These characteristics hinted that LG might have a therapeutic effect on RA and cardiac injury complications, and there are no similar reports on LG for RA and its complications.

Collagen-induced arthritis (CIA) is an experimental murine model of autoimmune inflammatory arthritis that shares features with human RA.¹⁶⁾ Thus, in our study, experimental mice were immunized with type II collagen to induce the RA model, followed by LG treatment to observe the therapeutic effects of LG on RA and cardiac injury complications.

Results

LG Alleviated Collagen-Induced Arthritis Development and Inflammation in Mice

Mice were immunized with collagen II to induce arthritis and then treated with LG to observe therapeutic effect, as shown in Fig. 1. During the modeling, the paws of CIA mice exhibited provoked swelling (Fig. 2a). The hind footpad thickness (Fig. 2b) and arthritic scores (Fig. 2c) were significantly higher than those in the control group. On the contrary, mice fed with LG exhibited an alleviation in arthritis severity, decreasing footpad thickness and arthritic scores (Figs. 2a–c). The production and secretion of inflammatory factors could induce and aggravate arthritis. The results showed that there were higher expression levels of tumor necrosis factor (TNF)-α, IL-1β, IL-6, and IL-17A both in synovial tissues (Fig. 2d) and in serum (Fig. 2e) in CIA-challenged mice compared to unchallenged mice. By contrast, treatment with LG significantly relieved those inflammatory factor levels. These observations indicated that the treatment of LG relieved the development and progression of RA.

Fig. 1. The Flow Diagram of Experimental Operation

On day 0, DBA/1 mice were immunized with type 2 collagen (CII) emulsified with an equal volume of complete Freund adjuvant (CFA) by tail subcutaneous injection and boosted 21 d later. After lesion, at 28 d, the mice received 20 mg/kg liquiritigenin (LG) by gavage every other day and were sacrificed at 48 d after drug treatment.

Fig. 2. LG Alleviated Collagen-Induced Arthritis Development and Inflammation in Mice

a–b. The represent pictures of arthritic joint phenotype (a) and the average hind paw thickness of the mice in each group (b). c. Represent hematoxylin and eosin (H&E)-stained synovial tissues from different group and the histological evaluation of synovial tissues by H&E. d–e. The concentrations of TNF-α, IL-1β, IL-6, and IL-17A in synovial tissues (d) and serum (e). ^&& p < 0.01 versus Control, ** p < 0.01 versus CIA. Results were represented as means ± standard deviation (S.D.). CIA: collagen-induced arthritis. LG: liquiritigenin.

LG Inhibited Collagen-Induced Cartilage Erosion in Mice with RA

The development of inflammation in RA is accompanied by the destruction of cartilage and bone. Hyaline cartilage stained positive for Safranin O (red) and fibrocartilage stained for Fast Green FCF (green). The Safranin O/fast green staining proved the erosion of articular cartilage erosion with increased-OARSI scores (Fig. 3a), whereas LG pretreatment suppressed collagen-induced cartilage erosion (Fig. 3a). Matrix metalloproteinases (MMPs) are important mediators of cartilage destruction in RA. Our results showed that LG significantly reversed the gene and protein expression levels of MMP-3 and MMP-13 induced by collagen, suggesting that LG might attenuate the disruption of cartilage through the suppression of MMPs (Figs. 3b–c).

Fig. 3. LG Inhibited Collagen-Induced Cartilage Erosion in Mice with RA

a. The represent picture of Safranin O-fast green-stained articular cartilage tissues from each group and OARSI scores of articular cartilage slides. b–c. The mRNA (b) and protein (c) expression of MMP-3 and MMP-13 in synovial tissues from different group. ^&& p < 0.01 versus Control, * p < 0.05, ** p < 0.01 versus CIA. Results were represented as means ± S.D. CIA: collagen-induced arthritis. LG: liquiritigenin.

LG Protected Cardiac Injury in Collagen-Induced Arthritis Mice

Subsequently, the effect of LG on CIA-induced cardiac injury was conducted. Heart function was accessed by echocardiography (Fig. 4a). Compared with sham-operated mice, cardiac damage occurred in CIA mice that manifested lower left ventricular fractional shortening (LVFS) and left ventricular ejection fraction (LVEF) with the enlarged left ventricular end-diastolic diameter (LVEDD) and left ventricular end-systolic diameter (LVESD) (Fig. 4b). Remarkably, these were reversed by LG pretreatment (Fig. 4b). Moreover, LG pretreatment had a significant effect, reducing the heart weight to body weight ratio (Fig. 4c). Further, the cardiac injury markers, such as lactate dehydrogenase (LDH) (Fig. 4d), creatine kinase-MB (CK-MB) (Fig. 4e), and cardiac troponin T (cTnT) (Fig. 4f) were detected. The plasma levels of these markers were elevated in CIA mice, and these changes were inhibited by LG pretreatment (Figs. 4d–f). The above results suggested that LG could protect the heart from collagen-induced cardiac dysfunction.

Fig. 4. LG Protected Cardiac Injury in Collagen-Induced Arthritis Mice

a–b. The represent echocardiographic images of each group (a) and the quantification of left ventricular end-diastolic diameter (LVEDD), left ventricular end-systolic diameter (LVESD), the percentage of left ventricular ejection fraction (EF) and fractional shortening (FS) values (b). c. The heart body weight ratio in each group. d–f. The activity of lactate dehydrogenase (LDH) (d) and creatine kinase-MB (CK-MB) (e), and the levels of cardiac troponin T (cTnT) (f) in serum. ^&& p < 0.01 versus Control, * p < 0.05, ** p < 0.01 versus CIA. Results were represented as means ± S.D. CIA: collagen-induced arthritis. LG: liquiritigenin.

LG Alleviated Cardiac Inflammation in Collagen-Induced Arthritis Mice

Given the significant increase in cardiac complications of RA in our study, we further explored the cardiac changes in CIA mice. The Hematoxylin–eosin (H&E) staining of cardiac tissues revealed that the myocardial fibers in CIA mice were disorderly arranged with irregular nuclei and extensive inflammatory cell infiltration (Fig. 5a). After pretreatment with LG, structural disorders of myocardial fibers were observed to be improved, accompanied by decreased infiltrated inflammatory cells (Fig. 5a), suggesting LG pretreatment alleviated the morphological changes of cardiac tissues. Meanwhile, LG abrogated collagen-induced elevated cardiac levels of IL-6, TNF-α, and IL-1β (Fig. 5b).

Fig. 5. LG Alleviated Cardiac Inflammation and Fibrosis in Collagen-Induced Arthritis Mice

a. Represent hematoxylin–eosin (H&E)-stained cardiac tissues from different group. b. The mRNA expression of TNF-α, IL-1β, and IL-6 in cardiac tissue from different group. ^&& p < 0.01 versus Control, ** p < 0.01 versus CIA. Results were represented as means ± S.D. CIA: collagen-induced arthritis. LG: liquiritigenin.

LG Alleviated Cardiac Fibrosis in Collagen-Induced Arthritis Mice

The Masson’s trichrome-stained cardiac tissues revealed fibrosis in collagen-treated mice (fibrotic area appeared blue after Masson staining) (Fig. 6a). Further, the fibrosis gene expression was evaluated. As Fig. 6b showed that LG pretreatment could rescue the increased expression of Fibronectin, Collagen I, and Collagen III induced by collagen. Transforming growth factor β-1 (TGF-β1) served as a potent mediator in inflammation and tissue fibrosis. The increased expression of TGF-β1 was proved in cardiac tissues, and it was obviously inhibited by LG pretreatment (Figs. 6c–d). Then, we next assessed the phosphorylation of Smad2 and 3 (the important downstream signaling molecules). Similarly, p-Smad2/3 protein expression showed almost identical results to TGF-β1 (Figs. 6c–d). These results suggested that LG might achieve the alleviation of inflammation and fibrosis in cardiac tissue via the inhibition of the TGF-β1/Smad2/3 pathway.

Fig. 6. LG Alleviated Cardiac Fibrosis in Collagen-Induced Arthritis Mice

a. Represent Masson-stained cardiac tissues from different group. b. The mRNA expression of Fibronectin, Collagen I, and Collagen III in cardiac tissues from different group. c–d. The protein expression of TGF-β1, p-Smad2/3, and Smad2/3 in cardiac tissues from different group. ^&& p < 0.01 versus Control, * p < 0.05, ** p < 0.01 versus CIA. Results were represented as means ± S.D. CIA: collagen-induced arthritis. LG: liquiritigenin.

Discussion

RA is recognized as a multifactorial autoimmune rheumatic disease. The currently used drugs for RA treatment have been reported to have a number of side effects due to their highly toxic response in the body.¹⁷⁾ Natural products are abundant and structurally diverse, can target a wide range of biological processes, and are considered to be relatively comprehensive and safe compared to synthetic drugs.¹⁸⁾ LG, the principal ingredient from Glycyrrhiza uralensis, has been widely reported to exert anti-inflammatory activities in many diseases.¹⁹⁾ In our study, we firstly reported the therapeutic effects of LG on RA and cardiac injury in CIA mice.

In an anti-inflammatory evaluation experiment with LG, LG was evaluated to be an anti-inflammatory compound that could attenuate carrageenan-induced paw edema and inflammatory factors release.²⁰⁾ The use of LG was found to attenuate RA symptoms including paw swelling, synovitis, and the pathological changes of synovia tissues in CIA mice. It has been shown that most of the pathological characteristics observed in joints of RA patients are related to various pro-inflammatory cytokines effects, such as TNF-α, IL-6, IL-1β, and IL-17A.²¹⁾ Previous studies have reported the inhibition effect of LG on inflammatory factors release. LG significantly inhibited the levels of TNF-α, IL-6 IL-1β, and IL-17A in synovium and serum, suggesting that LG could alleviate RA progression via the inhibition of inflammatory factors production and release.

Despite synovitis, the release of inflammatory factors responds to cartilage and joint destruction by recruiting and activating immune cells to release cytokines to the inflammatory microenvironment.²²⁾ The Safranin O/fast green staining results from our study proved the cartilage destruction in CIA mice, and that was alleviated by LG. Tu et al.¹³⁾ have reported the protective role of LG on inflammation and cartilage matrix degradation in rat chondrocytes induced by IL-1β probably by promoting the degradation of MMPs (MMP-3 and MMP-13). MMPs have been reported to be involved in cartilage destruction, and its elevated expression is frequently observed in RA.²³⁾ Among a multitude of MMP isoforms, MMP-3 and MMP-13 play a dominant role in cartilage matrix degradation.²⁴⁾ The degradation of MMPs induced by LG suggested that MMPs inhibition might be the core to restrain cartilage destruction.

In addition, systemic inflammation caused by RA is a potent independent risk factor for cardiovascular disease (ventricular hypertrophy, myocardial fibrosis, and coronary atherosclerosis), and cardiovascular risk components further contribute to the inflammatory burden of RA.²⁵⁾ Studies have shown that the incidence of cardiovascular complications in RA patients is about 1.5 times higher in RA patients than in non-RA patients.²⁶⁾ The increased heart weight inferred the occurrence of hypertrophy. LVEDD, LVESD, LVEF, and LVFS are vital indicators for cardiac function evaluation.²⁷⁾ The alternation of these indicators suggested the reduction of cardiac function in CIA mice. While, LG had a positive impact on all of the above indices, suggesting that cardiac dysfunction induced by collagen could be attenuated by LG treatment. The cardiac enzymes, such as LDH, CK-MB, and cTnT, are biomarkers to assess cardiac injuries published-previous research for RA with cardiac complications.²⁸⁾ The decrease in elevated LDH, CK-MB, and cTnT levels induced by LG in CIA mice confirmed the cardioprotective effect of LG, which has been reported in previous studies.²⁹⁾

Moreover, our H&E and Masson staining showed that the disorganized myocardial filament arrangement, massive inflammatory infiltration, and extensive fibrous connective tissue formation were relieved by LG, further indicating the presence of cardiac involvement in RA and the protective role of LG on inflammation and fibrosis in the heart. The fibrotic reaction in the heart is a dynamic process in which TGF-β1 is a pivotal fibrogenic cytokine that regulates organ fibrosis and dysfunction.³⁰⁾ In previous studies, it has been reported that the activation of the TGF-β1/Smad2/3 pathway by inflammatory cytokines LG TNF-α, IL-1β, and IL-6 potentiated myocardial fibrosis biomarker expression α-smooth muscle actin (α-SMA) and the production of collagen, leading to myocardial fibrosis.^31,32) It is noteworthy that the potential effect of LG in reducing the expression of fibrotic markers expression in multiple organs has been reported.¹²⁾ Recently, it has been reported in the literature that LG treatment inhibited diabetes-related cardiac injury by suppressing the expression of α-SMA, collagen I, and collagen II.¹⁵⁾ Li et al.³³⁾ reported the potent inhibition of the TGF-β1/Smad2/3 pathway by LG treatment in a mouse model of myocardial fibrosis. Unsurprisingly, in our LG-treated CIA mice, decreased α-SMA fibronectin, collagen I, collagen II, TGF-β1, and phos-Smad2/3 expression in cardiac tissues was observed. Therefore, our study firstly confirmed the protective role of RA-related cardiac injury by inhibiting the TGF-β1/Smad2/3 pathway.

There are also some deficiencies in our research. Firstly, we only used only one dosage (20 mg/kg) based on the earlier work of LG on multiple diseases, despite the therapeutic effects that were attained. A serial dose response was not investigated. Secondly, we did not set up the LG blank control or positive control group, as it was our first study applying LG to treat RA and the cardiac injury. The management of LG on heart disease has been illustrated, and its definite side effects were partially understudied. In the future, the dose-response combined with the treatment side effects of LG on RA and the cardiac injury could be explored, and learning a detailed mechanism.

Conclusion

In summary, we concluded that LG could relieve RA symptoms via inflammation inhibition and MMP degradation. Moreover, we proved the cardio-protective effects of LG in CIA mice. LG restrained inflammation and cardiac fibrosis in the heart probably by inhibiting the TGF-β1/Smad2/3 pathway, thereby reducing the expression of fibrotic biomarkers and inflammatory factors. Overall, our study was the first to demonstrate that LG could alleviate RA and cardiac complication, which provided the basis for its potential exploitation as a novel, safe natural approach to the treatment of RA and its complications.

Experimental

Animals and Modeling

DBA/1 mice (male, 6–8 weeks) were purchased from Tianjing Hengrong Biotech, Co., Ltd. (China). All animal experiments were conducted in strict accordance with the Ethics Committee of Hebei General Hospital (2021-(71)). Mice were raised in a specific environment with 45–55% humidity, at 22 ± 1 °C, and under a 12 h light/12 h dark cycle, with access ad libitum to food and chow. After environmental adaption for a week, the CIA model was developed in mice as previously described.³⁴⁾ On day 0, mice were immunized with type 2 collagen (CII) (Shanghai yuanye Bio-Technology Co., Ltd., China) emulsified with an equal volume of complete Freund adjuvant (CFA) by tail subcutaneous injection. The dose was 100 µg CII. A booster immunization was conducted 21 d later. At 28 d, the mice received 20 mg/kg LG by gavage every other day.³⁵⁾ LG was purchased from Aladdin (China) (Cat. L115716), with a purity greater than 98%. LG was dissolved in 40% polyethylene glycol 400 (PEG-400) in 0.9% normal saline. The corresponding volume of the vehicle was administered to control mice. During this time, the severity of arthritis development was quantified by clinical scoring of hind and fore limbs every three days as previously published criteria.³⁴⁾ In addition, the swelling of hind paws was quantified by the increase in hind paw thickness every three days. Mice were then sacrificed after 48 d to collect blood samples, ankle samples, synovial tissues, and cardiac tissues.

H&E and Safranin O/Fast Green Staining

The pathological changes in synovia and cardiac tissues were observed using H&E staining. The fixed tissues were dehydrated in gradient alcohol and embedded in paraffin and cut into 5 µm slides. Paraffin slides were dewaxed and rehydrated with a series of xylene and ethanol. Then, slides were stained with hematoxylin (5 min) and eosin (3 min) to observe the tissue changes and inflammation status of synovial and cardiac tissues. The synovial inflammation was scored from the literature standard.³⁶⁾ The Safranin O (5 min) and Fast Green (1 min) staining was performed in cartilage slides to observe cartilage destruction followed by scoring according to the ORAIS classification system.³⁷⁾

Cardiac Function Indexes

After modeling, LVEF, LVFS, LVESD, and LVEDD were measured using echocardiograms. Then, the cardiac tissue was obtained to gain heart weight, and the heart weight/body weight ratio was determined.

Masson Staining

The cardiac fibrosis was observed by Masson staining. The 5 µm cardiac slides were stained with Regaud hematoxylin solution for 6 min. After water washing, the slides were exposed to 1% hydrochloric acid for 3 s followed by Lichun magenta solution (Sinopharm, China) incubation (1 min), phosphomolybdic acid solution (Sinopharm) differentiation (5 min), and aniline blue solution counterstaining (5 min). After the final wash with 0.2% glacial acetic acid, the myocardial fibrosis was observed under a microscope (Olympus, Japan).

Immunofluorescence (IF) Staining

To examine the α-SMA antigen, the 5 µm cardiac slides were placed in citric acid buffer at high temperature for antigen repair. The slides were sealed with blocking buffer and incubated with primary (anti-α-SMA, Proteintech, China) and secondary (Cy3-conjugated goat anti-rabbit immunoglobulin G (IgG), Invitrogen, U.S.A.) antibodies. Afterward, the slides were counterstained with 4′, 6-diamidino-2-phenylindole (DAPI) (Aladdin). Staining images were observed under a fluorescence microscope.

Western Blot

The total protein was harvested using radio immunoprecipitation assay (RIPA) lysis buffer (Beyotime, China) for Western blot. The protein lysates were boiled in a water bath in the presence of a loading buffer (Beyotime) for 5 min. The prepared protein samples were loaded on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (10 or 15% acrylamide, 80 V), and transferred onto polyvinylidene difluoride (PVDF) (Thermo Scientific, U.S.A.) membrane (80 V) that was then blocked in 5% bovine serum albumin (BSA). The membranes were incubated with each primary antibody followed by corresponding secondary antibody incubation. After washing, the membranes were probed using the enhanced chemiluminescence (ECL) kit. The information for the antibodies was listed below: MMP-3 antibody (ABclonal, China; Catalog#A11418), MMP-13 antibody (Affinity; Catalog#AF5355), TGF-β1 antibody (Abcam, U.S.A.; Catalog#ab215715), p-SMAD2/3 antibody (ABclonal; Catalog#AP0548), SMAD2/3 antibody (ABclonal; Catalog#A18674), β-actin antibody (Proteintech, China; Catalog#60008-1-Ig), HRP-conjugated goat anti-mouse (Proteintech, China; Catalog#SA00001-1), HRP-conjugated goat anti-rabbit IgG (Proteintech; Catalog#SA00001-2).

Reverse Transcription Quantitative Real-Time PCR (RT-qPCR)

RNA from tissues was isolated using TRIpure reagent (BioTeke, China), followed by chloroform/isopropanol procedure. The RNA purity and concentration were evaluated using a Nanodrop 2000 (Thermo Scientific), and subjected to reverse transcription using BeyoRT II M-MLV reverse transcriptase (Beyotime). The cDNA template was conducted for PCR amplification using SYBR Green PCR Master Mix on Exicycler 96. The relative expression of different genes was calculated using the 2^−ΔΔCt method. β-actin served as a housekeeping gene. The information for the primer sequences were listed in Table 1.

Table 1. Primer Sequences for RT-qPCR

Gene	Primer-F	Primer-R
MMP-3	CCTATTCCTGGTTGCTG	AGAGTTAGACTTGGTGGG
MMP-13	AGAATCTATGATGGCACTG	TGTAGCCTTTGGAACTG
IL-6	ATGGCAATTCTGATTGTATG	GACTCTGGCTTTGTCTTTCT
IL-1β	CTCAACTGTGAAATGCCACC	GAGTGATACTGCCTGCCTGA
TNF-α	CAGGCGGTGCCTATGTCTCA	GCTCCTCCACTTGGTGGTTT
Collagen I	AAGAACCCTGCCCGCACATG	GAATCCATCGGTCATGCTCT
Collagen III	GCCCACAGCCTTCTACACCT	GATAGCCACCCATTCCTCCC
Fibronectin	CAATGCCGTGGTCCTAA	AATGAGTTGGCGGTGAT

Commercial Kit Detection

Serum LDH and CK-MB activity were measured using commercial kits from Nanjing Jiancheng Bioengineering Institute (China). The levels of cTnT, TNF-α, IL-1β, IL-6, and IL-17A were detected using corresponding commercial ELISA kits from Wuhan Fine Biotech Co., Ltd. (China) and MultiSciences Biotech (China). All procedures followed the operation steps of manufacturers’ protocols.

Statistical Analysis

GraphPad Prism 8.0 was used for data analysis in our study. The statistical significance of the collected data was analyzed by One-way ANOVA at p < 0.05. All data were exhibited as mean (± standard deviation). Each experiment was repeated three times and reproducible results were obtained.

Acknowledgments

This research was supported by the Grant from the 2018 Medical Science Research Key Project Plan of Hebei Provincial Health Commission (Grant number 20180119).

Conflict of Interest

The authors declare no conflict of interest.

References

• 1) Singh J. A., Saag K. G., Bridges S. L. Jr., et al., Arthritis Rheum., 68, 1–26 (2016).
• 2) Alamanos Y., Drosos A. A., Autoimmun. Rev., 4, 130–136 (2005).
• 3) Li R., Sun J., Ren L. M., Wang H. Y., Liu W. H., Zhang X. W., Chen S., Mu R., He J., Zhao Y., Long L., Liu Y. Y., Liu X., Lu X. L., Li Y. H., Wang S. Y., Pan S. S., Li C., Wang H. Y., Li Z. G., Rheumatology (Oxford), 51, 721–729 (2012).
• 4) Lautenbach M., Millrose M., Langner I., Eisenschenk A., Int. Orthop., 37, 2409–2413 (2013).
• 5) Turesson C., O’Fallon W. M., Crowson C. S., Gabriel S. E., Matteson E. L., Ann. Rheum. Dis., 62, 722–727 (2003).
• 6) Ntusi N. A., Sever E., Lockey J., Francis J. M., Piechnik S. K., Ferreira V. M., Matthews P. M., Wordsworth P. B., Neubauer S., Karamitsos T. D., J. Cardiovasc. Magn. Reson., 17 (S1), Q65 (2015).
• 7) Giles J. T., Fernandes V., Lima J. A., Bathon J. M., Arthritis Res. Ther., 7, 195–207 (2005).
• 8) Pironti G., Bersellini-Farinotti A., Agalave N. M., Sandor K., Fernandez-Zafra T., Jurczak A., Lund L. H., Svensson C. I., Andersson D. C., Heart, 104, 2026–2034 (2018).
• 9) Birari R. B., Gupta S., Mohan C. G., Bhutani K. K., Phytomedicine, 18, 795–801 (2011).
• 10) Wang L., Yang R., Yuan B., Liu Y., Liu C., Acta Pharm. Sin. B., 5, 310–315 (2015).
• 11) Peng F., Du Q., Peng C., Wang N., Tang H., Xie X., Shen J., Chen J., Phytother. Res., 29, 969–977 (2015).
• 12) Zhu X., Shi J., Li H., Biomed. Pharmacother., 106, 976–982 (2018).
• 13) Tu C., Ma Y., Song M., Yan J., Xiao Y., Wu H., Eur. J. Pharmacol., 858, 172445 (2019).
• 14) Uchino K., Okamoto K., Sakai E., Yoneshima E., Iwatake M., Fukuma Y., Nishishita K., Tsukuba T., Phytother. Res., 29, 1714–1721 (2015).
• 15) Xie X. W., Biomed. Pharmacother., 86, 694–704 (2017).
• 16) Cremer M. A., Hernandez A. D., Townes A. S., Stuart J. M., Kang A. H., J. Immunol., 131, 2995–3000 (1983).
• 17) Du H., Zhang X., Zeng Y., Huang X., Chen H., Wang S., Wu J., Li Q., Zhu W., Li H., Liu T., Yu Q., Wu Y., Jie L., Front. Immunol., 10, 1620 (2019).
• 18) Karimi A., Majlesi M., Rafieian-Kopaei M., J. Nephropharmacol., 4, 27–30 (2015).
• 19) Yu J. Y., Ha J. Y., Kim K. M., Jung Y. S., Jung J. C., Oh S., Molecules, 20, 13041–13054 (2015).
• 20) Kim Y. W., Zhao R. J., Park S. J., Lee J. R., Cho I. J., Yang C. H., Kim S. G., Kim S. C., Br. J. Pharmacol., 154, 165–173 (2008).
• 21) Brennan F. M., McInnes I. B., J. Clin. Invest., 118, 3537–3545 (2008).
• 22) Bottini N., Firestein G. S., Nat. Rev. Rheumatol., 9, 24–33 (2013).
• 23) Firestein G. S., McInnes I. B., Immunity, 46, 183–196 (2017).
• 24) Davidson R. K., Waters J. G., Kevorkian L., Darrah C., Cooper A., Donell S. T., Clark I. M., Arthritis Res. Ther., 8, R124 (2006).
• 25) Im C. H., Kim N. R., Kang J. W., Kim J. H., Kang J. Y., Bae G. B., Nam E. J., Kang Y. M., Rheumatology (Oxford), 54, 808–815 (2015).
• 26) Symmons D. P., Gabriel S. E., Nat. Rev. Rheumatol., 7, 399–408 (2011).
• 27) Garrard C. L. Jr., Weissler A. M., Dodge H. T., Circulation, 42, 455–462 (1970).
• 28) Chen J., Norling L. V., Proc. Natl. Acad. Sci. U.S.A., 118, e2020385118 (2021).
• 29) Xu Z., Hu Z., Xu H., Zhang L., Li L., Wang Y., Zhu Y., Yang L., Hu D., Exp. Cell Res., 411, 113008 (2022).
• 30) Dobaczewski M., Chen W., Frangogiannis N. G., J. Mol. Cell. Cardiol., 51, 600–606 (2011).
• 31) Accornero F., van Berlo J. H., Correll R. N., Elrod J. W., Sargent M. A., York A., Rabinowitz J. E., Leask A., Molkentin J. D., Mol. Cell. Biol., 35, 2154–2164 (2015).
• 32) Nicola P. J., Crowson C. S., Maradit-Kremers H., Ballman K. V., Roger V. L., Jacobsen S. J., Gabriel S. E., Arthritis Rheum., 54, 60–67 (2006).
• 33) Li L., Fang H., Yu Y. H., Liu S. X., Yang Z. Q., Mol Med-Rep., 24, 686 (2021).
• 34) Brand D. D., Latham K. A., Rosloniec E. F., Nat. Protoc., 2, 1269–1275 (2007).
• 35) Lee E. H., Park K. I., Kim K. Y., Lee J. H., Jang E. J., Ku S. K., Kim S. C., Suk H. Y., Park J. Y., Baek S. Y., Kim Y. W., Phytomedicine, 62, 152780 (2019).
• 36) Krenn V., Morawietz L., Burmester G. R., Kinne R. W., Mueller-Ladner U., Muller B., Haupl T., Histopathology, 49, 358–364 (2006).
• 37) Pritzker K. P., Gay S., Jimenez S. A., Ostergaard K., Pelletier J. P., Revell P. A., Salter D., van den Berg W. B., Osteoarthritis Cartilage, 14, 13–29 (2006).