| To whom correspondence should be addressed: I Nengah Suwastika, Graduate School of Biostudies, Kyoto University, Yoshida Konoe-cho, Kyoto 606-8501, Japan. Tel & Fax: +81–75–753–7905 E-mail: suwastika@lif.kyoto-u.ac.jp |
Membrane trafficking is a process that maintains cellular homeostasis by delivering newly synthesized proteins to their correct destinations by transport vesicles. Transport vesicles carry cargo proteins from a donor compartment and discharge them by fusing with the membrane of the target compartment. Fusion between the membranes of specific transport vesicles and their target membranes is mainly regulated by the SNARE and Rab families of proteins (Sanderfoot et al., 2000; Ungar and Hughson, 2003; Vernoud et al., 2003; Uemura et al., 2004; Sanderfoot, 2007). The SNARE family is divided into four groups: Qa-, Qb-, Qc-, and R-SNAREs; according to the basis of their similarities in particular amino acid sequence called the SNARE motif. The functional SNARE complex, which drives specific membrane fusion process, consists of parallel hetero-oligomeric four-helix bundles. Each bundle contains one SNARE motif from each of the four distinct SNARE groups (Fasshauer et al., 1998).
The higher plants have evolved a complex membrane transport system; namely, the higher plant cell has multiple pathways to deliver cargo proteins to different types of vacuoles and cell surface sub-domains (Jürgens, 2004). In fact, an excess number of SNAREs (64) and Rabs (57) have been identified in the genome of Arabidopsis thaliana compared with those in animal or yeast genomes (Sanderfoot et al., 2000; Vernoud et al., 2003; Sanderfoot, 2007). Particularly, the SNAREs found on the plasma membrane (PM) of Arabidopsis are of many different types: to date, 9 Qa-SNAREs, 3 Qb-SNAREs and 5 R-SNAREs have been identified (Uemura et al., 2004). These PM-localized SNAREs seem to play a plant-specific role in higher-order functions such as pathogen resistance, cytokinesis and response to ABA (Collins et al., 2003).
Within the Arabidopsis SNARE molecules, the NPSN subfamily of Qb-SNAREs (consisting of NPSN11, 12, and 13) and the SYP7 subfamily in Qc-SNARE (consisting of SYP71, 72, and 73) appear to be unique to plants with no orthologs in other eukaryotes (Sanderfoot et al., 2000). NPSN11 is localized to the cell plate in dividing cells, and interacts with the Qa-SNARE KNOLLE/SYP111, which is specifically expressed during mitosis and also localized on the cell plate. NPSN11 is thought to play a critical role in membrane fusion during cell plate formation (Zheng et al., 2002; Surpin and Raikhel, 2004). The function of the SYP7 subfamily, on the other hand, is still largely unknown, although it is interesting to recall that the SYP7 subfamily proteins have also been found in the endoplasmic reticulum (ER) (Uemura et al., 2004). However, proteomic studies have indicated that SYP71 protein exists on purified PMs from tobacco and Arabidopsis cells (Marmagne et al., 2004; Morel et al., 2006; Mongrand et al., 2004; Alexanderson et al., 2004). Furthermore, using an inhibitory SNARE fragment of SYP71 blocks secretion of fluorescent secretion marker (Tyrrell et al., 2007). These results indicate that SYP71 functions in the secretion process in plants. In this study, we determined the detailed expression patterns of the SYP7 subfamily SNAREs and sub-cellular localization of one of SYP7s, SYP71, using promoter-GUS analysis and transgenic plant expressing the GFP-tagged SYP71, respectively. The results show that SYP71 is mainly localized to the PM and function as a Qc-SNARE on the PM. Interestingly, SYP71 is also localized to the ER in the dividing cells of various tissues. These results suggest that SYP71 may be involved in multiple membrane fusion steps during the secretion process in Arabidopsis.
Absolute signal intensity values as micro-array data were obtained from the Bio-Array Resource for Arabidopsis Functional Genomics (BAR) (http://bar.utoronto.ca/). Data corresponding to the developmental stages of Arabidopsis thaliana were normalized for gray scale such that the signal corresponding to intensity of 500 was assigned to the value of 100% (black) and absence of signal (white).
The Arabidopsis thaliana ecotype Columbia was used in this study. The plant was grown at a constant temperature of 25°C under continuous light. Arabidopsis suspension-cultured cells “Deep” (Glab et al., 1994) were cultured in the Murashige-Skoog (MS) medium at 23°C with continuous agitation in the dark.
The cytoplasmic regions of the SYP7 group proteins (Supplemental Fig. 1) were amplified from their cDNA and then were subcloned into pGEX 5X-1 expression vector (GE Healthcare, Chalfont St. Giles, Bucks, UK). The sets of primers used for the PCR amplification were as follows: for the SYP71 gene: 5'-GTGGCGGGATCCTTATGACTGTGATCGATA-3' and 5'-GTGAGGCCCGGGGCTAGATCTCAGCTGG-3' (equivalent to 241 amino acids from the N-terminal amino acid being inserted into the BamHI-SmaI sites); for the SYP72 gene: 5'-GTGGCGGGATCCTTATGCCGGTCATTGATA-3' and 5'-GTGAGGCCCGGGGCTGGATCGCATCTGC-3'; (equivalent to 242 amino acids from the N-terminal amino acid being inserted into the BamHI-SmaI sites); for the SYP73 gene: 5'-CGCGGCGTCGACCAATGGGCGTAATTGATT-3' and 5'-GTGGAAGTCGACGCTGGATCTCAACTTT-3' (equivalent to 238 amino acids from the N-terminal amino acid being inserted into the SalI site). Each GST-fused protein was expressed in E. coli (BL21) under IPTG induction, and purified on a glutathione-Sepharose 4B column (GE Healthcare, Chalfont St. Giles, Bucks, UK). Due to high similarity among SYP71, SYP72, and SYP73 (Supplemental Fig. 1), all purified recombinant proteins then mixed and were used as antigens for immunizing a rabbit. The antiserum produced was confirmed to recognize all GST tag-SYP7s proteins (data not shown).
The anti-SYP7s antiserum was used for detection of endogenous SYP7 family proteins in several tissues of Arabidopsis thaliana. Total proteins of the plant tissues were extracted with a grinding buffer (50 mM HEPES-KOH, pH 7.5, 5 mM MgCl2, 5 m MEGTA, 250 mM Sorbitol, 1 mM DTT, 1% polyvinylpyrrolidone, 1% ascorbic acid and a protease inhibitor mix (Roche, Basel, Switzerland). One μg of the total protein was subjected to 12% SDS/PAGE gel for separation, and then transferred into PVDF membrane for western blotting.
We analyzed the gene expression patterns of SYP7 genes based on GUS expression under the control of each SYP7 promoter. Firstly, we created transgenic plants in which GUS was fused to the promoters regions of SYP7 genes, by cloning the 2000-bp upstream regions of the SYP71 and SYP73 genes in the pBI101 vector. We also created a similar chimera using the 1000-bp promoter region of SYP72. We then introduced the constructed plasmids into each plant with Agrobacterium-mediated transformation methods (Clough and Bent, 1998). We detected GUS expression by staining with X-gluc (5-bromo-4-chloro-3-indoleyl-β-D-glucuronide) as described elsewhere (Jefferson et al., 1987).
In order to obtain clear separation pattern between the ER and the PM membranes, we performed a sucrose density gradient separation in buffers with or without Mg2+. We homogenized 5 g of Arabidopsis root in an extraction buffer (–Mg) (50 mM Tris-HCl, pH 7.5, 250 mM Sorbitol, 2 mM EGTA, 2 mM EDTA, a protease inhibitor mix (Roche, Basel, Switzerland)) or in an extraction buffer (+Mg) (50 mM Tris-HCl, pH 7.5, 250 mM Sorbitol, 2 mM MgCl2, the protease inhibitor mix). After it was homogenized in 10 ml extraction buffer, it was then filtered through four layers of Miracloth, and centrifuged at 10,000×g for 10 min at 4°C. The crude membrane was then precipitated from the supernatant fraction by centrifugation at 100,000×g for 30 min at 4°C. The pellet was resuspended in a resuspension buffer (–Mg) containing 250 mM Tris-HCl pH 7.5, 5% sucrose and 5mM EDTA or a resuspension buffer (+Mg) containing 250 mM Tris-HCl, pH 7.5, 5% sucrose and 2 mM MgCl2. The crude membrane fraction of each treatment then was layered on the top of the sucrose density gradient (15%–45%). The separation was performed by centrifugation on 110,000×g for 14 hr using a swing-out rotor. Sample was collected in each 0.5 ml fraction, and then the sucrose concentration was determined by using a hand-refractometer. The samples then were subjected to a SDS-PAGE followed by western blotting analysis using several antibodies. Quantitative analyses of the amounts of detected proteins were performed using the Image-J software.
The translational fusions between GFP and the SYP71 was generated using the fluorescent tagging of full-length protein (FTFLP) method described by Tian et al. (2004) with some modifications. Briefly, about 2.3 kbp of the upstream sequence of SYP71 with 5'-CACC sequence, a GFP sequence with GGSG-linker, and 1.0 kbp of the downstream sequence of SYP71, were separately amplified by PCR with following primer sets (upstream fragment, 5'-CACCAATTTGGGAATGTATAAACCATC-3' and 5'-TCGCCCTTGCTCACCATCTTCTTCCAAATCTATCACAAGAAGC; GFP fragment; 5'-GGTGAGCAAGGGCGAGG-3' and 5'-GCCACTACCTCCCTTGTACAGCTCGTCCATGCC-3'; downstream fragment, 5'-CTGTACAAGGGAGGTAGTGGCATGACTGTGATCGATATTCTGACTAGAG and 5'-AGTTGTCTCTATGTTTGCTTCGATATG-3'). Then the three DNA fragments were conjugated by the TT-PCR method. The fragment was subcloned into pENTR/D-TOPO (Invitrogen, Carlsbad, CA, USA), and then transferred into a binary vector pGWB1 (Nakagawa et al., 2007) according to the manufacture’s instruction. These constructs were introduced into Agrobacterium tumefaciens strain C58 Rif r/pGV2260 in order to transform Arabidopsis wild type plants (Col-0) by the floral dipping method (Clough and Bent, 1998). Screening of transgenic plants were performed on the MS plates containing 50 μg mL–1 hygromycin. T2 lines, which showed a segregation ratio of 3:1 for antibiotic resistance, were used for further experiments.
SYP7 subfamily SNAREs consist of three related genes, SYP71, SYP72, and SYP73, which share high amino acid sequence identity (>53% identity to each other) (Supplemental Fig. 1). According to the global microarray gene expression analysis throughout Arabidopsis development (Toufighi et al., 2005), only SYP71 is expressed in almost all vegetative tissues including root, shoot, leaf, and flower. Meanwhile, SYP72 is restrictedly expressed in mature pollen and SYP73 is less expressed through all tissues but weak expressions were observed in dry seeds, mature pollen and bicellular pollen (Supplemental Table 1).
In order to examine the detailed expression pattern of each gene, we generated transgenic Arabidopsis harboring a 1000–2000 bp promoter region of each SYP7 gene fused to the GUS reporter (Fig. 1). The histological GUS analysis showed that SYP71 was highly expressed in sepals, the filaments of stamen, and short styles of pistils, but less expressed in mature pollen (Fig. 1A, B, C, and J). A strong expression was also observed in the vascular bundles of various tissues including leaf and root in the mature and seedling stages (Fig. 1L and M). No expression was observed in young pollen and ovules (data not shown).
 View Details | Fig. 1. Promoter GUS expression patterns of SYP71, SYP72 and SYP73. GUS expression under the control of SYP71 promoter (A, B, C, J, K, L, and M), SYP72 promoter (D, E, F, N, O, P, and Q), and SYP73 promoter (G, H, I, R, S, T, and U) were detected on various plant tissues: early stage of flower development (A, D, and G), late stage of flower development (B, E, and H), anther (C, F, and I), pistil (J, N, and R), silique (K, O, and S), leaf (L, P, and T), and root (M, Q, and U). |
The transgenic plant harboring the SYP72 and SYP73 promoter GUS-reporter constructs showed strong GUS expression during pollen development, although the expressions of two genes had different profiles. The expression of SYP72 increased during pollen development, and maintained high levels in the mature pollen (Fig. 1F). The SYP72 promoter activity was also detected in stigmatic papillae and short styles of pistils (Fig. 1N), but not in leaves or roots (Fig. 1P and Q), nor during the seedling stage of plant development (data not shown). In contrast, the expression of SYP73 was observed in the early developmental stages of embryo and pollen development (Fig. 1G, H, I, R and S). Weak expression was observed in the root tip but not in the leaf (Fig. 1T, U). The expression of SYP73 during seed development is consistent with the microarray data of the molecule.
In summary, SYP71 is mainly expressed during vegetative growth, whereas SYP72 is mainly expressed in pollen development and SYP73 plays a role in the developmental processes of pollen and embryo.
Due to high similarity among the SYP7 subfamily proteins (Supplemental Fig. 1), it is difficult to generate antibodies which can distinguish each SYP7 protein. Therefore, in this study, we generated an anti-SYP7 antibody to immunize a rabbit with a mixture of three recombinant SYP7 proteins in order to increase the sensitivity of the antibody. As shown in Fig. 2, the anti-SYP7 antibody detected a 32.5-kDa polypeptide in all Arabidopsis vegetative tissues. Since only SYP71 is expressed in vegetative tissues, we concluded that the 32.5-kDa polypeptide recognized by the SYP7 antibody in vegetative tissues is SYP71. SYP71 detected almost all tissues including root, shoot, leaf, stem, flower, silique, and suspension cultured cells, with different levels of expression intensity. An especially strong expression was observed in rosette leaves. Intriguingly, less SYP71 protein was detected in flower, although strong expression was observed in flower tissues by the promoter-GUS and the microarray analyzes. We also found that two distinct bands existed in the blot of silique protein extract. The promoter-GUS and microarray analyzes indicated that SYP73 is expressed during seed maturation in addition to the SYP71 expression in silique. Therefore, it is likely that the two distinct bands detected in the silique fraction by the anti-SYP7 antibody are SYP71 and SYP73.
 View Details | Fig. 2. Immunoblot analysis of SYP71 protein in various vegetative tissues. Total proteins (1 μg) from different A. thaliana plant tissues and cultured cells were separated by SDS/PAGE, before western blotting detection using an anti-SYP7 antibody. |
To investigate the subcellular localization of endogenous SYP71 in Arabidopsis, we performed a sucrose density gradient centrifugation analysis using the crude membrane fraction prepared from the Arabidopsis root culture. As shown in Fig. 3, in the absence of Mg2+, the peak of the ER marker protein, AtSar1, was shifted to the lighter fraction (Fraction 16), and was completely separated from the peak fraction of the PM marker protein, H+-ATPase. AtSar1 was also detected in the lighter fractions not only in the presence of Mg2+, but also in the absence of Mg2+. The lighter peak of AtSar1 is likely a soluble form of the protein.
 View Details | Fig. 3. ER localization of SYP71 shown by subcellular fractionation. (A) Microsomal membrane fraction was isolated from 5 g of Arabidopsis root and was separated on a sucrose density gradient (15%–45%) with or without Mg2+. Twenty-three fractions were analyzed by immunoblotting, using antibodies against SYP7, AtSar1 and PM-H+-ATPase. (B) Quantitative analysis of the detected proteins was performed with the Image J software. |
In the separation without Mg2+, SYP71 peak was recovered in two distinct peak fractions, one corresponding to the ER marker and the other corresponding to the PM marker. The results clearly indicate that SYP71 is localized both to the ER and PM membranes. Similar results were obtained from the same analysis using Arabidopsis suspension culture cell (data not shown).
Furthermore, we confirmed the subcellular distribution of SYP71 by using a transgenic plant expressing GFP-SYP71 under the control of its native promoter. The expression of SYP71 protein under its promoter was observed throughout all plant tissues including root, leave, conductive tissue of root and stem, and flower with different fluorescent intensities (Fig. 4 and Supplemental Fig. 2). Especially, a weak fluorescence was observed in flower tissues such as stigma and stamen filament (Supplemental Fig. 2F and G). These weak expression intensities were inconsistent with those of transcriptions (Fig. 1A and J), but consistent with western blot data (Fig. 2). These results suggest that SYP71 proteins rapidly degraded in flower tissues in spite of the high level of transcription.
 View Details | Fig. 4. GFP-SYP71 expression under its native promoter was detected on the ER, the PM and the endosomes. The fluorescence of GFP-SYP71 was detected mainly in the PM of epidermal cells of root (A, B, and C), primordial region of the lateral root (D), developing lateral root (E), leaf (F), and in a young developing seed (G). Close observation of the dividing region of the root tip revealed GFP fluorescence was also observed in the ER in addition to the PM (A inset) and the endosomes as punctate structures (B). When the cells were treated with Brefeldin A (BFA), the punctate structures became aggregated and formed the BFA compartments (arrowheads in C). Clear ER structure was also detected in the dividing cells of primordial region of the lateral root (D) and in the young developing seed (G). Scale bar is 10 μm. |
Close observation under CLSM microscope indicated that SYP 71 was mainly observed in the PM of mature cells of various tissues (Fig. 4; Supplemental Fig. 2 B, D, and E). Additionally, the ER localization of GFP-SYP71 was obviously detected in the dividing regions including root tip (Fig. 4A inset, Supplemental Fig. 2A), lateral root primordial (Fig. 4D; Supplemental Fig. 2C), immature seed (Fig. 4G), and epidermis of ovules (Supplemental Fig. 2H). The ER localization of SYP71 of these tissues disappeared during cell maturation. These data suggested that SYP71 is mainly localized on the PM of the mature cells and is also localized on the ER in addition to the PM of the young cells under division or growth. Intriguingly, a closer observation revealed that SYP71 was localized not only on the PM but also in the punctate structures (Fig. 4B). When the cells were treated with Brefeldin A (BFA), which inhibits trafficking from the endosomes to the PM, the punctate structures aggregated and formed the so-called BFA compartment (Fig. 4C, arrowheads). These features were reminiscent of the endosomes.
SYP71 showed predominant expression in vegetative tissues, but almost no expression was observed in reproductive tissues such as pollen and embryos. SYP72 was specifically expressed at a late stage of pollen development, and SYP73 was strongly expressed in an early stage of pollen and embryo maturation. These data suggest that each SYP7 protein functions in a specific stage during plant development with little expression redundancy. In fact, no homozygous T-DNA insertion mutant of SYP71 was isolated from 123 progenies of SYP71/syp71 heterozygote (data not shown), indicating that the function of SYP71 in the vegetative tissues is essential for plant growth and development.
We demonstrated in this study that SYP71 was mainly localized on the PM/endosomes by a comparison of the subcellular localization obtained from different approaches including membrane fractionation analysis, and observations of transgenic plants expressing GFP-SYP7s driven by the native promoter.
In animals and yeasts, the PM-localized Qa-SNAREs form a SNARE complex by interacting with SNAP-25s (Qb/Qc-SNAREs) and the R-SNAREs called VAMPs or brevins (Bock et al., 2001). In plants, a SNAP-25 homologue, AtSNAP33 (Qb/Qc-SNARE), interacts with the Qa-SNARE, SYP111 (KNOLLE) during cell plate formation (Heese et al., 2001) or SYP121 in plant immune responses or general secretion event (Kwon et al., 2008; Geelen et al., 2002; Tyrrell et al., 2007). Yet a plant-specific Qb-SNARE (NPSN11) also forms a SNARE complex with SYP111 (KNOLLE) (Zheng et al., 2002), although it is not clear which Qc- and R-SNAREs are involved in this SNARE complex.
Our previous localization studies of Arabidopsis SNAREs have shown that 9 Qa-SNAREs, 5 VAMPs (R-SNARE), 3 Qb-SNAREs (NPSN11, NPSN12 and NPSN13) and 3 SNAP-25s (SNAP29, SNAP30 and SNAP33) are located on the PM, but no Qc-SNARE had been identified on the PM before the present study (Uemura et al., 2004). In the present study, we show that SYP71, which is a type of Qc-SNAREs, exists in the PM, and that they might form a SNARE complex with the plasma-membrane Qa-SNAREs (SYP11, 12, or 13), NPSN-type Qb-SNAREs and VAMP 72-type R-SNAREs. Namely, two types of SNARE complex could be formed on the plant PM: one might be a conventional SNARE complex consisting of Qa-SNARE, SNAP-25 and R-SNARE, and the other might be a plant-specific SNARE complex consisting of Qa-SNARE, NPSN1s (Qb), SYP7s (Qc) and R-SNARE. Recent studies have clearly shown that the recycling pathways between the endosomes and the PM are essential for the polar localization of an auxin efflux carrier, PIN1, for polar auxin transport (Geldner et al., 2001, Geldner et al., 2003) and for the cell plate localization of KNOLLE (SYP111) for cytokinesis (Jürgens, 2004; Lukowitz et al., 1996, Lauber et al., 1997). These two different types of PM-SNARE complexes may confer a complexity upon the membrane traffic to the PM to be involved in various membranes trafficking to the PM in higher plants.
Intriguingly, SYP71 is also localized on the ER membrane of dividing cells, and this ER localization pattern of SYP71 at the dividing cells raises the question of why SYP71 shows a dual localization pattern both to the ER and the PM at the dividing cells stage.
We have previously shown that SYP71 is localized to the ER membrane in transient expression condition (Uemura et al., 2004). This ER-localization might be due to an overexpression effect of strong 35S promoter. However, we could also observe the ER-localization of SYP71 in dividing cells even though SYP71 was expressed under the control of the native promoter. Furthermore, SYP71 is detected both in the ER and the PM membrane fractions of root tissues. These data indicate that authentic SYP71 localizes on the ER in dividing cells.
In yeast, Ufe1p (Qa), Sec20p (Qb), Use1p (Qc) and Sec22p (R) forms the SNARE complex on the ER membrane, involved in the retrograde transport to the ER (Burri et al., 2003; Dilcher et al., 2003). According to Sanderfoot (2007), the counterparts of the components of the ER SNARE complex are found in the Arabidopsis genome: SYP8 (Qa-SNARE, Ufe1p ortholog), AtSec20 (Qb-), AtUse1 (Qc-) and At Sec22 (R-), suggesting that the retrograde transport pathway to the ER is highly conserved across the eukaryotic kingdom. In plants, in addition to this conventional ER-resided SNARE complex, there might be an additional SNARE complex including SYP71 as another Qc-SNARE of the ER SNARE complex in order to confer complexity or flexibility to the membrane traffic during cell division.
The dominant negative SNARE fragment (Sp2) of SYP71 inhibits the secretion of a fluorescent secretion marker, secGFP, suggesting that SYP71 functions in the membrane traffic to the PM as a PM-Qc-SNARE (Tyrrell et al., 2007). Interestingly, the expressions of Sp2 fragment of SYP71 as well as the Sp2 fragments of SYP121 and SYP122 caused the ER-retention of the secretion marker. It is unknown why the Sp2 fragments of PM-localized SNAREs causes the ER-retention of the secretion marker. However, this observation might suggest that PM-resident SNAREs influence the transport pathway from the ER.
Generally, SNARE molecules are localized predominantly to specific subcellular compartment in order to achieve specific membrane trafficking processes. However, in order for the membrane fusion process to continue to cycle between the transport vesicles and the target membranes, it is necessary for SNAREs to be returned to their donor compartments via recycling pathways. Consequently, SNAREs reside not only in the target organelles, but also reside in the donor organelles (Jahn and Scheller, 2006). The dual localization pattern of SYP71 seen in the present study might be such a case, namely, SYP71 might be involved in the direct transport pathway from the ER to the PM.
In mammalian cells, the ER membranes are directly in contact with the PM and phagosomes during phagocytosis (Gagnon et al., 2002). This membrane-traffic process is mediated by an ER-localized SNARE protein called syntaxin 18 (Hatsuzawa et al., 2000). In transgenic Arabidopsis seed cells, the recombinant single-chain Fv-Fc antibodies are transported directly from the ER to the periplasmic space (Van Droogenbroeck et al., 2007). The SYP71 might be involved in a similar direct pathway from the ER to the PM at least in certain condition/type of plant cells, such as rapidly elongating or dividing cells. Of course, we could not completely exclude the possibility that we just only observed the transient localization of SYP71 at the ER membrane on the way to the final destination. Nonetheless, we have never observed the ER localization of other PM-resident SNAREs under the transient and/or the transgenic expression conditions (Uemura et al. 2004 and our unpublished data).
The other possible explanation of this localization pattern is that SYP71 is involved in more than one fusion step within one type of cell. It was reported that Vti1 (Fisher von Mollard and Stevens, 1999), Sed5 (Tsui and Banfield, 2000) and VAMP8 (Antonin et al., 2000; Wang et al., 2004) function in multiple membrane fusion steps in yeast and mammals. SYP71 might form distinct SNARE complexes on the PM and the ER. Further experiments are needed to confirm the precise function of SYP71 in the complex membrane traffic in higher plants.
We thank Ms. Y. Hori for her technical assistance. We also thank Drs. Y. Niwa and K. Matsuoka for their kind gifts of vectors. We also thank Dr. Y. Kasahara and Dr. A. Nakano for providing the Oryza sativa plasma membrane H+-ATPase and AtSar1 antibodies, respectively. This work was supported in part by grants from the Japanese Ministry of Education, Culture, Sport, Science and Technology, a grant-in-aid for Basic Science Research (C) and a grant-in-aid for Scientific Research on Priority Areas (MHS), as well as by a grant from the Yamada Science Foundation (MHS): a-grant-in-aid for JSPS Research Fellowships for Young Scientists (TU). INS was also recipient to a scholarship from the Japanese Ministry of Education, Culture, Sport, Science and Technology.
|
Index