Einkorn Wheat (Triticum monococcum) Mutant Extra-Early Flowering 4, Generated by Heavy-Ion Beam Irradiation, Has a Deletion of the LIGHT-REGULATED WD1 Homolog

Abstract

A mutant showing extra early-flowering and named extra early-flowering4 (exe4) was induced in a previous study by heavy-ion beam mutagenesis of Triticum monococcum strain KU104-1. The exe4 mutant shows heading about 45 days earlier than wild-type KU104-1 in the field. In the present study, we sought to identify the gene that was mutated in exe4 by performing a modified whole-genome sequencing analysis. This analysis exploited a short-read library preparation that uses a modified adaptor and duplex-specific nuclease (DSN) for the efficient elimination of highly repeated sequence elements within genomes. The whole-genome sequence analysis and PCR analysis using an M₂ segregation line indicated that the extra-early flowering phenotype of exe4 is associated with a deletion of a gene for a WD repeat protein, named here WHEAT WD REPEAT 1 (WWDR1). Phylogenetic analysis of amino acid sequences showed that the gene is a homolog of Arabidopsis LIGHT-REGULATED WD1 (LWD1) and LWD2, which are circadian clock regulatory genes.

During early development in plants, the shoot apical meristem (SAM) produces leaf primordia for the vegetative growth phase. Reproductive organs are developed at a later stage during the establishment of the body plan. The determination of the timing when the vegetative growth phase is switched to the reproductive phase (flowering) is controlled by internal and external signals. Flowering competency indicates that the plant body is ready to transit to the reproductive growth phase from the vegetative growth phase (Preston and Kellogg 2008). When plants attain flowering competency, they produce florigen in the leaves, which then moves via the phloem into the shoot apex; SAM then differentiates the inflorescence meristem that can develop into floral organs (Higuchi 2018). Early-flowering phenotypes are important in bread wheat (Triticum aestivum) cultivars as they enable the production of an early harvest. This characteristic is particularly beneficial in East Asia as it allows harvesting to occur before the onset of the rainy season. In autumn-sown wheat cultivars grown in central to southwestern Japan, reduced photoperiod sensitivity is the major determinant of earliness (Tanio et al. 2005). Elucidation of the mechanisms of the photoperiod response pathway will provide useful insights for wheat breeding.

Bread wheat is a hexaploid species with the genomic constitution AABBDD derived from three wild diploid ancestral species: the A genome from T. urartu, the B genome from Aegilops speltoides or another species classified in the Sitopsis section, and the D genome from Ae. tauschii. Therefore, the hexaploid wheat genome contains triplicated homoeologous genes; this property, unfortunately, increases the difficulty of screening for mutants in bread wheat. To avoid this problem, we used cultivated diploid einkorn wheat (T. monococcum) that carries the A^m genome, similar to the A genome in bread wheat, to develop a large-scale mutant panel (Murai et al. 2013). In this mutant panel, we identified four extra early-flowering mutants, named extra early-flowering1 (exe1), exe2, exe3, and exe4 (Nishiura et al. 2014). The four exe mutants fall into two groups: Type I which shows extra early-flowering and includes the exe1 and exe3 mutants; and Type II which shows extremely extra early-flowering and includes exe2 and exe4. Type I plants show reduced photoperiodic sensitivity, whereas Type II plants show a distorted photoperiod response.

In this study, to characterize the mutation in Type II exe4, we performed a modified whole-genome sequencing analysis with a short-read library; the analysis uses a modified adaptor and DSN for the efficient elimination of highly repeated sequence elements within genomes. The whole-genome sequence analysis and a segregation analysis suggested that the extra-early flowering phenotype of exe4 is associated with a deletion of a gene for a WD repeat protein. Phylogenetic analysis of amino acid sequences indicated that the gene is a homolog of Arabidopsis LWD1 and LWD2, which are genes involved in circadian clock regulation.

Materials and methods

Plant material

Wild-type (WT) diploid einkorn wheat (Triticum monococcum) strain KU104-1 and the extra early-flowering phenotype mutant line exe4 were used in the experiments. The exe4 mutation was generated by carbon-ion beam (50 keV μm⁻¹) irradiation in a previous study (Nishiura et al. 2014) and the exe4 mutant plant was identified among seven segregating M₂ individuals in a field screening experiment in season 2010/2011 at Fukui Prefectural University (Fig. 1). Six plants in the segregating M₂ line that showed normal flowering time were used in the PCR assay to examine co-segregation of the early-flowering phenotype and identification of a candidate gene for the mutation.

Fig. 1. The exe4 mutant plant (arrowed) was identified in an M₂ line. The mutant plant showed early-flowering/heading phenotype, resulting in early maturation and brown colored ears and culms compared to wild type plants.

Whole-genome sequence analysis

Whole-genome sequence analysis was conducted using genomic DNAs of WT and exe4 mutant plants as previously reported (Ichida and Abe 2019). Using a hairpin-structured adapter, randomly shared genomic libraries of WT and exe4 were constructed. The adapter sequence was 5′-GAT CGG AAG AGCacacgtctUUUtacacgac GCT CTT CCG ATC*T-3′, with phosphorylation at the 5′ end and a phosphorothioate linkage between the last two nucleotides (represented by an asterisk) that increases resistance to exonuclease degradation of the protruding thymine at the 3′ end. Library hybridization and DSN treatment were performed to eliminate highly repeated sequence elements in the genomes. The DSN-treated library was subjected to PCR amplification using KAPA HiFi hot start ready mix and primers DSN-P5-FL (5′-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTACACGACGCT CTT CCG ATC T-3′, where the underlined region corresponds to DSN-P5mini) and DSN-P7-FL (5′-CAA GCA GAA GAC GGC ATA CGA GAT[N6]GTG ACT GGA GTT CAG ACG TGT GCT CTT CCG ATC T-3′, where [N6] represents index sequences consisting of six unique nucleotide sequences). Whole-genome sequencing was performed as 150-bp paired-end sequencing by an Illumina HiSeq instrument (Illumina, San Diego, CA, USA). After quality filtering, the generated reads were mapped onto the A genome of the IWGSC reference genome sequence v1.0 (T. aestivum ‘Chinese Spring’) using BWA v0.7.15 (Li and Durbin 2009), then processed as described previously (Ichida et al. 2019). BEDTools (Quinlan and Hall 2010) was used to determine the read depth at exonic and CDS regions defined in the IWGSC annotation v1.0. A filtering program (bt_coverage_filter) was used to extract confident large deletions (Ichida et al. 2019).

Sequence analysis and segregation analysis of a candidate gene

The candidate gene of einkorn wheat strain KU104-1 corresponding TraesCS6A01G193300 was cloned and sequenced using the PCR method. The DNA sequence was determined by the direct sequencing method using the PCR products. The PCR primer sequence and amplification conditions are shown in Table 1. PCR analysis of genomic DNAs from the M₂ segregating line (one plant showed the extra-early flowering phenotype and the other six plants had a normal phenotype) was performed for a candidate gene for the mutant phenotype, TraesCS6A01G193300. The PCR primer sequence and amplification conditions are shown in Table 1. DNA amplification products were visualized by agarose gel electrophoresis.

Table 1. Primers used for PCR analyses.

Gene	Primer name	Sequence (5′–3′)	Annealing temperature (°C)	Extension time (sec.)	Product size (bp)	DNA polymerase
TraesCS6A01G193300	WD repeat L	ACAGAACATCCTCACCGCATAC	58.6	60	875	rTaq DNA polymerase (TOYOBO)
	WD repeat R	CCGCCAGAACTACTCTCATAGA
WWDR1	TraesCS6A01G193300_UnSS_1L	CCCACGTTTGCTACACAGAACATC	53	1	1954	KOD DNA polymerase (TOYOBO)
	TraesCS6A01G193300_UnSS_1954R	CTCTGCTGCGTCAAATCAACATAAG

Phylogenetic analysis of amino acid sequences of a candidate gene for the mutation phenotype

A phylogenetic tree for the amino acid sequences of TraesCS6A01G193300 and 240 wheat WD repeat proteins (TaWD40s) was constructed using ClustalW (Version 2.1) in the DNA Data Bank of Japan (DDBJ, https://www.ddbj.nig.ac.jp/index-e.html), MEGA X software (version 10.2.5), and the neighbor-joining (NJ) method. Bootstrap values based on 1,000 replicates were calculated. ID numbers of 240 TaWD40s were obtained from Hu et al. (2018). The 240 TaWD40s amino acid sequences were obtained from WheatMine (https://urgi.versailles.inra.fr/WheatMine/begin.do). Arabidopsis LWD1 (AT1G12910) and LWD2 (AT3G26640) amino acid sequences were obtained from KEGG (https://www.genome.jp/kegg/kegg_ja.html).

Alignment analysis of amino acid sequences

Using amino acid sequences of TraesCS6A01G193300, its corresponding gene of einkorn wheat strain KU104-1 (WWDR1), and two Arabidopsis LWDs, alignment was performed by ClustalW (Version 2.1) in the DDBJ.

Results

Whole-genome sequence analysis and PCR analysis identify TraesCS6A01G193300 gene as a candidate for the exe4 mutation

Using an improved whole-genome sequencing method that efficiently removes repetitive elements from complex plant genomes (Ichida et al. 2019), we identified a large deletion in chromosome 6 of the exe4 mutant compared with the wild-type genome (Fig. 2). Two protein coding genes are present in this region, TraesCS6A01G193300, and TraesCS6A01G193400, indicating that these genes are deleted in the exe4 mutant genome. To determine if the genes are associated with the exe4 mutant phenotype, we performed a PCR analysis using genomic DNAs from seven plants of the M₂ segregation line in which the exe4 mutant plant was first identified. The PCR primer set for amplification of TraesCS6A01G193300 was designed from genome sequence information obtained from WheatMine (Table 1). The results of the PCR assays for TraesCS6A01G193300 are shown in Fig. 3. Of the seven M₂ plants, plant #1 showed the exe4 phenotype and the others (plants #2–#7) had a normal phenotype (Fig. 1). No amplification product from TraesCS6A01G193300 was obtained for plant #1 whereas a product was produced from plants #2–#7, indicating that this gene co-segregates with the mutant phenotype. Because TraesCS6A01G193400 is closely linked with TraesCS6A01G193300, PCR segregation analysis was performed by using primer set for TraesCS6A01G193300.

Fig. 2. Diagram of the large deletion in the exe4 mutant genome. The deleted region is shown in relation to the normal 6A chromosome region of hexaploid wheat. The thick bar indicates the deleted region in exe4. In each gene, the black box indicates an exon and the line indicates an intron. The numbers indicate the location of the gene on chromosome 6 from genome information obtained from WheatMine.

Fig. 3. PCR analysis of a gene TraesCS6A01G193300 in seven plants of the segregating M₂ line. Plant #1 is the exe4 mutant with the extra early-flowering phenotype and plants #2–#7 show a normal flowering-time phenotype. PCR primer and condition information are provided in Table 1. Lane M is a molecular marker, φX174/Hae III (TaKaRa Bio).

TraesCS6A01G193300 is a homolog of Arabidopsis LWD1 and LWD2

A BLAST analysis indicated that TraesCS6A01G193300 showed a high similarity in amino acid sequence to Arabidopsis LWD1, which is associated with flowering time (Wu et al. 2008). On the other hand, TraesCS6A01G193400 encodes an unknown protein. Although we can’t exclude the possibility that the deletion of TraesCS6A01G193400 was a cause of exe4 mutation, TraesCS6A01G193300 is more likely to be a candidate gene for the extra early-flowering phenotype.

The gene family for WD repeat proteins contains numerous genes that are dispersed throughout the genome; 743 genes (240, 261, and 242 genes for the A, B, and D genomes, respectively) have been identified in hexaploid wheat and named TaWD40s (Hu et al. 2018). We performed a phylogenetic analysis of the amino acid sequences of the 240 TaWD40s, including TraesCS6A01G193300, located in the wheat A genome, together with Arabidopsis LWD1 (AT1G12910) and LWD2 (AT3G26640) genes (Fig. 4). The phylogenetic tree clearly indicated that, of the wheat TaWD40s tested, TraesCS6A01G193300 showed highest similarity to the Arabidopsis LWDs. Therefore, we named TraesCS6A01G193300 as WHEAT WD REPEAT 1 (WWDR1) in this study.

Fig. 4. Phylogenetic analysis of amino acid sequences of the 240 wheat WD repeat (TaWD40s) proteins located on the A genome and Arabidopsis thaliana (LWD1 and LWD2). The phylogenetic tree was constructed by ClustalW in the DDBJ and drawn with MEGA X software using the NJ method. Bootstrap values based on 1,000 replicates are shown on the branches. The IDs of the 240 TaWD40s were obtained from Hu et al. (2018) and the amino acid sequences were obtained from WheatMine. LWD1 (AT1G12910) and LWD2 (AT3G26640) amino acid sequences were obtained from KEGG.

To be exact, TraesCS6A01G193300 is a gene of hexaploid bread wheat (T. aestivum) cultivar Chinese Spring. Using PCR method, we cloned and sequenced the corresponding gene of einkorn wheat strain KU104-1, and found that one amino acid residue is differed with TraesCS6A01G193300. Figure 5 shows an amino acid sequence alignment of WWDR1 for hexaploid wheat cv. Chinese Spring and einkorn wheat strain KU104-1 and the Arabidopsis proteins LWD1/2. WWDR1 showed about 60% similarity in amino acid sequences across the whole region to Arabidopsis LWD1 and LWD2. Five WD repeat regions (WD-1 to WD-5) have been identified in Arabidopsis LWDs (Fig. 5). Although the similarity in WD-1 region between WWDR1 and LWDs was low, wheat WWDR1 showed high homology with other WD repeat regions of Arabidopsis proteins. This suggests that WWDR1 might have a similar function as Arabidopsis LWD1 and LWD2.

Fig. 5. Amino acid sequence alignment of WWDR1 for hexaploid wheat cv. Chinese Spring (TraesCS6A01G193300) and einkorn wheat strain KU104-1 and LWD1/2 of Arabidopsis Alignment was performed using ClustalW in the DDBJ. In the alignment, “*” indicates the same amino acid residue; “:” indicates a site belonging to a group exhibiting strong similarity; and “.” indicates a site belonging to a group exhibiting weak similarity. Shadowed regions indicate the conserved WD repeat domains of Arabidopsis LWD1 and LWD2 (Wu et al. 2008). LWD1 (AT1G12910) and LWD2 (AT3G26640) amino acid sequences were obtained from KEGG.

Discussion

We have reported that the four extra early-flowering (exe) mutants induced by heavy-ion beam irradiation were shown to fall into two types: Type I exe mutants (exe1 and exe3) that showed heading about 30 days earlier than WT plant in the field; and Type II exe mutants (exe2 and exe4) that had an extremely extra early-flowering phenotype (about 45 days earlier than WT plants) (Nishiura et al. 2014). Both Type I and II mutants had reduced or disrupted photoperiodic sensitivity, i.e., the mutants showed a reduced delay in flowering under short day (SD) conditions. Type II mutants also showed a greater loss of photoperiodic sensitivity than Type I mutants and could flower earlier under SD conditions (Nishiura et al. 2014).

We previously compared expression of the flowering promoter gene VERNALIZATION1 (VRN1) and florigen gene Wheat FLOWERING LOCUS T (WFT) expression patterns using cDNAs from leaves of non-vernalized exe3 and exe4 mutants and WT plants (Nishiura et al. 2014). Under long day (LD) conditions, the exe mutants showed higher VRN1 expression level from the 1-leaf stage than WT plants. Expression of VRN1 was higher in exe4 than exe3 plants. The pattern of VRN1 expression under SD conditions was similar in exe4 mutants to that observed under LD conditions; thus, the mutant showed a significantly higher level of expression at earlier leaf stages than WT plants. Under LD conditions, the WFT expression level was higher in exe3 and exe4 mutants compared to the WT plants; exe4 mutants showed a much higher level of expression than exe3 mutants. By contrast, WFT expression in exe3 mutants was reduced under SD conditions to a similar extent as in WT plants. Surprisingly, a significant up-regulation of WFT was observed in exe4 mutants, presumably as a consequence of their loss of photoperiodic response which would otherwise suppress WFT expression.

Previously, we demonstrated that the exe3 mutant has a deletion of the clock component gene PCL1/LUX (abbreviated as Wheat PCL1, WPCL1) (Nishiura et al. 2018). We proposed a model for the extra early-flowering phenotype in the exe3 mutants based on a model for wheat flowering gene network presented by Shimada et al. (2009). In this model, VRN1 acts as an integrator of the vernalization and circadian clock signals. VRN1 up-regulates the florigen gene WFT. In the exe3 mutants, the clock function is disrupted by the deletion of WPCL1, leading to the loss of SD-specific expression of clock-related genes, clock downstream genes, and photoperiod pathway genes, and induces high expression of VRN1. High levels of accumulation of VRN1 transcripts induce WFT expression, resulting in the extra early-flowering phenotype.

In this study, we performed whole-genome sequence analysis and segregation analysis to identify the gene involved in the exe4 mutation. Our analyses indicated the extra early-flowering phenotype of exe4 is associated with a deletion of a gene for a WD repeat protein. Phylogenetic analysis of amino acid sequences indicated that the gene is a homolog of Arabidopsis LWD1 and LWD2, circadian clock regulatory genes. In Arabidopsis, LWD1 and LWD2 encode proteins that have been identified as clock proteins regulating the circadian period length and photoperiodic flowering (Wu et al. 2008). The lwd1lwd2 double mutant in Arabidopsis shows an early-flowering phenotype under both SD and LD conditions. Interestingly, the double mutant also shows high expression of the FT gene under SD conditions. The increased FT gene expression under SD conditions is similar to that of the present wheat exe4 mutant, which lacks a WWDR1 gene. This indicates that WWDR1 has a similar function in wheat flowering as Arabidopsis LWD1 and LWD2. The question arises why Arabidopsis has two complementary genes involved in the early-flowering phenotype, whereas wheat has a single gene. In Arabidopsis, analysis of the lwd1lwd2 double mutant revealed that LWD1 and LWD2 play dual functions in the light input pathway and the regulation of the central oscillator, and the activities of these two genes depend on functional PSEUDO-RESPONSE REGULATOR9 (PRR9) and PRR7 (Wang et al. 2011). In a future study, we intend to identify the protein that conjugates with WWDR1. This may provide an answer to the question of why the two species differ in the number of genes for the very early flowering phenotype.

Acknowledgments

We are grateful to the National Bioresource Project—Wheat (NBRP-KOMUGI) for providing the WT wheat strain. This work was supported by Cabinet Office, Government of Japan, Cross-ministerial Strategic Innovation Promotion Program (SIP), “Technologies for creating next-generation agriculture, forestry and fisheries” (funding agency: Bio-oriented Technology Research Advancement Institution, NARO).

References

• Higuchi, Y. 2018. Florigen and anti-florigen: Flowering regulation in horticultural crops. Breed. Sci. 68: 109–118.
• Hu, R., Xiao, J., Gu, T., Yu, X., Zhang, Y., Chang, J., Yang, G. and He, G. 2018. Genome-wide identification and analysis of WD40 proteins in wheat (Triticum aestivum L.). BMC Genomics 19: 803.
• Ichida, H. and Abe, T. 2019. An improved and robust method to efficiently deplete repetitive elements from complex plant genomes. Plant Sci. 280: 455–460.
• Ichida, H., Morita, R., Shirakawa, Y., Hayashi, Y. and Abe, T. 2019. Targeted exome sequencing of unselected heavy-ion beam-irradiated populations reveals less-biased mutation characteristics in the rice genome. Plant J. 98: 301–314.
• Li, H. and Durbin, R. 2009. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25: 1754–1760.
• Murai, K., Nishiura, A., Kazama, Y. and Abe, T. 2013. A large-scale mutant panel in wheat developed using heavy-ion beam mutagenesis and its application to genetic research. Nucl. Instrum. Methods Phys. Res. B 314: 59–62.
• Nishiura, A., Kazama, Y., Abe, T., Mizuno, N., Nasuda, S. and Murai, K. 2014. Level of VERNALIZATION 1 expression is correlated with earliness in extra early-flowering mutant wheat lines. Breed. Sci. 64: 213–221.
• Nishiura, A., Kitagawa, S., Matsumura, M., Kazama, Y., Abe, T., Mizuno, N., Nasuda, S. and Murai, K. 2018. An early-flowering einkorn wheat mutant with deletions of PHYTOCLOCK 1/LUX ARRHYTHMO and VERNALIZATION 2 exhibits a high level of VERNALIZATION 1 expression induced by vernalization. J. Plant Physiol. 222: 28–38.
• Preston, J. C. and Kellogg, E. A. 2008. Discrete developmental roles for temperate cereal grass VERNALIZATION1/FRUITFULL-like genes in flowering competency and the transition to flowering. Plant Physiol. 146: 265–276.
• Quinlan, A. R. and Hall, I. M. 2010. BEDTools: A flexible suite of utilities for comparing genomic features. Bioinformatics 26: 841–842.
• Shimada, S., Ogawa, T., Kitagawa, S., Suzuki, T., Ikari, C., Shitsukawa, N., Abe, T., Kawahigashi, H., Kikuchi, R., Handa, H. and Murai, K. 2009. A genetic network of flowering time genes in wheat leaves, in which an APETALA1/FRUITFULL-like gene, VRN1, is upstream of FLOWERING LOCUS T. Plant J. 58: 668–681.
• Tanio, M., Kato, K., Ishikawa, N., Tamura, Y., Sato, M., Takagi, H. and Matsuoka, M. 2005. Genetic analysis of photoperiod response in wheat and its relation with the earliness of heading in the southwestern part of Japan. Breed. Sci. 55: 327–334.
• Wang, Y., Wu, J. F., Nakamichi, N., Sakakibara, H., Nam, H. G. and Wu, S. H. 2011. LIGHT-REGULATED WD1 and PSEUDO-RESPONSE REGULATOR9 form a positive feedback regulatory loop in the Arabidopsis circadian clock. Plant Cell 23: 486–498.
• Wu, J. F., Wang, Y. and Wu, S. H. 2008. Two new clock proteins, LWD1 and LWD2, regulate Arabidopsis photoperiodic flowering. Plant Physiol. 148: 948–959.