2024 Volume 89 Issue 4 Pages 277-283
To investigate the role of KLF6 in nasopharyngeal carcinoma (NPC) cells. NPC C666-1 cells were transfected with si-NC, si-KLF6, miR-181-5p mimics, and miR-NC. The transfection efficiency was evaluated using qRT-PCR to measure the expression of miR-181-5p and KLF6. The protein expression level of KLF6 was detected using WB assay. Cell proliferation was assessed using the CCK8 assay to determine the effect of KLF6. Flow cytometry was used to detect apoptosis and changes in the cell cycle of NPC cells after KLF6 inhibition. The targeting relationship between miR-181-5p and KLF6 was verified using dual fluorescein assay. The qRT-PCR results demonstrated successful transfection of si-NC, si-KLF6, miR-181-5p mimics, and miR-NC. Inhibition of KLF6 led to a decrease in miR-181 expression, whereas overexpression of miR-181-5p increased KLF6 expression. Furthermore, suppressing KLF6 expression resulted in inhibited proliferation of C666-1 cells and enhanced apoptosis. This led to an increase in S-phase cells and a decrease in G2/M-phase cells. The dual luciferase results confirmed the targeted binding between miR-181-5p and KLF6. Inhibition of KLF6 suppresses NPC cell proliferation and promotes apoptosis through induction of cell cycle arrest.
Nasopharyngeal carcinoma (NPC) is a type of epithelial cancer commonly found in the oropharynx. NPC is rare in most parts of the world, but is more prevalent in East Africa and Asia, particularly southern China (Liu et al. 2021; Liao et al. 2023). Based on histologic features, including the degree of keratinization and differentiation of tumor cells, NPC can be classified into different types based on its keratinization and differentiation. These types include keratinized, non-keratinized differentiated, non-keratinized undifferentiated, and basal squamous cell carcinoma. Among these subtypes, non-keratinized NPC is the most prevalent, accounting for over 95% of cases in areas where the disease is endemic (Wong et al. 2021; Li et al. 2023).
Located on chromosome 10 of the human genome, the Kruple-like factor 6 (KLF6) gene comprises three splice variants (SV1, SV2, and SV3) (Syafruddin et al. 2020). A comprehensive analysis of large-scale RNA-sequencing data from The Cancer Genome Atlas (TCGA) demonstrated that the expression of the KLF6 gene varies across different types of cancer. KLF6 expression was also found to be downregulated in other cancer types compared to their respective normal tissues (Tang et al. 2017). KLF6 has also been found to be inactivated or downregulated in a significant proportion of cases of colorectal cancer (Reeves et al. 2004), non-small cell lung cancer (Ito et al. 2004), glioma (Camacho-Vanegas et al. 2007) and hepatocellular carcinoma (Kremer-Tal et al. 2007). Scientific evidence has firmly established the crucial role of KLF6 in regulating genes associated with controlling the cell cycle, apoptosis, and senescence, thus effectively executing its anti-proliferative mechanism (Gao et al. 2017; Sabatino et al. 2019; Guo et al. 2021). However, the involvement of KLF6 in NPC has not been documented.
In this study, we used KLF6 as a target to investigate its role in NPC. Its upstream target was predicted to be miR-181, and the effect of miR-181 regulation of KLF6 on NPC cell proliferation and cell cycle was investigated by cellular experiments.
Experiments were conducted using RPMI1640 medium (including 5% fetal bovine serum, 100 U mL−1 of penicillin, and 100 U mL−1 of streptomycin, in terms of volume) to culture C666-1 cells. The cells were incubated at 37°C with 5% CO2 saturated humidity, and for further analysis, cells in the logarithmic growth phase were collected.
Cell transfectionThe si-NC, si-KLF6, miR-181 mimics and NC (Sangon) were transfected into C666-1 cells using Lipofectamine 3000 (Invitrogen, U.S.A.) following the manufacturer’s instructions.
qRT-PCRC666-1 cells’ total RNA was extracted using the kit’s instructions. Reverse transcription was then used to create cDNA. As directed by the manufacturer, cDNA was treated to RT-qPCR. By determining the proportion of transcripts present in the samples, the expression levels of KLF6 and miR-181 were calculated. For the purpose of calculating relative expression, GAPDH served as an internal reference. Table 1 lists the primer sequences used for RT-qPCR.
| Primers | Sequence (5′→3′) | |
|---|---|---|
| KLF6 | Forward | ATGAAACTTTCACCTGCGCTCCCG |
| Reverse | TCAGAGGTGCCTCTTCATGTGCAG | |
| miR-181-5p | Forward | ACACTCCAGCTGGGAACATTCAACGCTGTCGG |
| Reverse | TGGTGTCGTGGAGTCGA | |
| GAPDH | Forward | ATGCTGCCCTTACCCCGGGGTCC |
| Reverse | TTACTCCTTGGAGGCCATGTAGG | |
| U6 | Forward | CTCGCTTGGGCAGCACA |
| Reverse | AACGCTTCACGAATTTGCGT | |
| miR-181-5p mimics | GGUGAGGUCGGGGCUGAGAC | |
| miR-NC | UCUACCGCGUGUCACGACAAU | |
| si-KLF6 | Forward | GCATGCGCACTGAGGCCTTTAGTGGGTGGGAT |
| Reverse | ATCCCACCCACTAAAGGCCTCAGTGCGCATGC | |
| si-NC | Forward | AAAAAAGCAGTTTGGCCTTTTTGTGTGTGAGG |
| Reverse | CCTCACACACAAAAAGGCCAAACTGCTTTTTT | |
Species: (Homo sapiens) Human nasopharyngeal carcinoma (NPC) cell species.
C666-1 was inoculated into 96-well plates at approximately 1×105 cells/well, and 100 µL/well of complete culture medium was added. After 24 h of culture, the culture medium was aspirated and si-NC or si-KLF6 was added, with 6 replicate wells in each group. After 24, 48, and 72 h of incubation, 100 µL/well of RPMI1640 containing 10% CCK-8 by volume was added and then incubated at 37°C for 1 h. The absorbance values of each well were measured at 450 nm using an enzyme immunoassay detector.
Flow cytometryApoptosis: C666-1 cells were placed in 6-well plates overnight at a density of 5×105 cells per well. Si-NC or si-KLF6 was cultured in each well for a total of 72 h. After being washed three times with cold PBS, the collected cells were resuspended in 1× binding buffer. Following the manufacturer’s instructions, a membrane-associated protein v-FITC-propidium iodide (PI; Thermo Fisher Scientific, Inc.) was used and allowed to incubate at room temperature for 20 min. Utilizing a flow cytometer (BD Biosciences), the outcomes were examined.
Cell cycle: C666-1 cells in logarithmic growth phase were taken to prepare single cell suspension, inoculated into 6-well plate according to 1×105 cells/well, incubated in warm box for 24 h, then divided into Con group, si-NC group and si-KLF6 group, further incubated for 24 h, and then cells in each group were collected, The volume fraction of 70% cold ethanol fixation overnight, all steps were performed according to the kit instruction manual, and the distribution of cycle time phase was detected by PI staining method using the flow cytometer to calculate the proportion of cycle time phase of cell cycle in each group.
Western blotCollect C666-1 cells in the logarithmic growth phase, make a single cell suspension, inoculate 5×105 cells per dish onto a 6-cm culture dish, incubate for 24 h, and then split the cells into three groups: control, si-NC, and KLF6. The total protein was extracted after the cells had been collected and lysed. The protein concentration was determined by BCA method and subjected to SDS-PAGE electrophoresis. The proteins on the gel were transferred to a PVDF membrane, which was then submerged in a sealing solution made up of 5% skimmed milk and shaken at 37°C for 1 h. Following membrane sealing, the primary antibody (1 : 1,000) was incubated for an overnight period at 4°C, followed by three 10 min TBST washes. The corresponding secondary antibody (1 : 1,000) was then incubated for 2 h at 4°C. The films were then scanned after the membranes had been subjected to the horseradish peroxidase HRP-ECL fluorescent solution in a dark environment. Using ImageJ software, the integral gray values of the protein bands were computed and standardized as the relative expression of the target proteins in the population.
Dual luciferase reporter analysisWild-type (WT) and mutant (MUT) KLF6-3′UTR were co-transfected with miR-181 mimic or miR-181-nc into a luciferase reporter vector. Cells were cultured in 24-well plates for 24 h. Dual-luciferase was used in cells transfected. After 48 h of culture in reporter gene, the detection system measured luciferase activity. Divide the luminosity of Renilla luciferase by the luminescence of fireflies to get the relative luciferase activity. The experiment was carried out three times.
Statistical analysisThe mean±SD was used to express the experimental results. The LSD-t test was employed to compare two groups, while ANOVA was used to compare several groups. Software GraphPad Prism 9.0 was utilized for statistical graphing and analysis. When the p<0.05, the results were deemed statistically significant.
To investigate the effects, we suppressed the expression of KLF6 in NPC cells C666-1 and simultaneously overexpressed miR-181-5p. The results of qRT-PCR and WB assay confirmed that the expression of KLF6 was significantly inhibited (p<0.0001) upon transfection with si-KLF6. Additionally, qRT-PCR analysis demonstrated a significant reduction in the expression of miR-181-5p after KLF6 inhibition (p<0.0001), whereas overexpression of miR-181-5p led to a significant increase in KLF6 expression (p<0.01) (Fig. 1).

** p<0.01, **** p<0.0001.
The effect of KLF6 on the proliferative effect of NPC cells was investigated using a CCK8 assay (Fig. 2). The results demonstrated that inhibiting KLF6 expression consistently reduced the proliferation rate of C666-1 cells. After 72 h, the cellular activity was only about 50%, as compared to the control and NC groups, this was significantly lower.

**** p<0.0001, compared to Control group, ####, compared to NC group.
The impact of KLF6 on NPC cell apoptosis was also explored using flow cytometry (Fig. 3). The results exhibited a significant rise in the rate of C666-1 cell apoptosis upon repression of KLF6 expression (p<0.0001).

(A) Control group. (B) NC group. (C) si-KLF6 group. (D) Apoptosis rates. **** p<0.0001.
In addition to examining the impact of KLF6 on C666-1, an analysis of its influence on the cellular cycle was conducted utilizing flow cytometry (Fig. 4). Our findings indicated that there were no statistically significant changes in the G0/G1 phase cells (Fig. 4D, p>0.05). Conversely, there was an observed rise in the quantity of cells in the S phase (Fig. 4E, p<0.05) and a decline in the number of cells in the G2/M phase (Fig. 4F, p<0.05) following the inhibition of KLF6. These observations imply that the inhibition of KLF6 could potentially disrupt the cellular cycle of C666-1.

(A) Control group. (B) NC group. (C) si-KLF6 group. (D) Percentage of cells in the G0/G1 phase. (E) Percentage of cells in the S phase. (F) Percentage of G2/M cells. * p<0.05.
The targeting relationship between miR-181-5p and KLF6 was verified through a dual luciferase assay (Fig. 5). The results demonstrated that the fluorescence intensity of WT-KLF6, when co-transfected with miR-181-5p mimics, was significantly reduced. However, there was no significant change in the fluorescence intensity of MUT-KLF6, indicating the binding of miR-181-5p and KLF6.

** p<0.01.
NPC is a highly malignant tumor affecting the nasopharynx. Patients are often diagnosed after the onset of noticeable symptoms, with over 70% already presenting with advanced disease at diagnosis (Huang et al. 2023). NPC is characterized by high aggression, rapid metastasis, poor prognosis, and complex clinical outcomes (Chen et al. 2023). Standard treatments for NPC include surgery, chemotherapy, and radiotherapy. However, distant metastasis following initial treatment remains a critical issue, and therapeutic outcomes for metastatic NPC are unsatisfactory (Yang et al. 2022). Consequently, studying tumor proliferation, metastasis, apoptosis, and other biological behaviors is crucial for improving diagnosis, treatment, and prognosis evaluation.
MicroRNAs (miRNAs) are a subclass of short non-coding RNAs, typically 18–24 nucleotides in length, that regulate gene expression by binding to target mRNAs, thereby inhibiting their translation (Zhang et al. 2022). miRNAs significantly impact various malignancies, including NPC (Treiber et al. 2019). Dysregulated miRNAs can influence the expression of target genes, contributing to cancer progression, with these target genes often being highly expressed in malignancies. Moreover, miRNAs affect the therapy and prognosis of NPC patients by targeting multiple downstream genes (Chen et al. 2020; Shi et al. 2020; Lv et al. 2021; Zhao et al. 2021). For instance, miR-873 was found to be downregulated in NPC tissues, and its upregulation inhibited NPC progression by suppressing stem-like properties and tumorigenicity through the downregulation of ZIC2 and disruption of the AKT signaling pathway (Lv et al. 2021). However, the functional roles of many miRNAs in NPC are still under-explored, necessitating further research to fully understand their contributions to carcinogenesis and tumor progression. Our study found that miR-181 expression decreased following KLF6 inhibition in NPC cell line C666-1, whereas miR-181 overexpression increased KLF6 expression. Dual luciferase assays demonstrated that miR-181 binds to KLF6, indicating that miR-181 plays a role in NPC and could serve as a therapeutic target.
Cell proliferation is often associated with cell death mechanisms, particularly involving molecules in the late S and G1 phases that execute apoptotic pathways (Li et al. 2022). Critical checkpoints in the cell cycle, specifically the G1, G2, and M checkpoints, ensure proper cell cycle progression and prevent malfunction (Matthews et al. 2022; Cheung et al. 2023). Defects in these checkpoints can trigger apoptosis and eliminate cancerous cells (Oh et al. 2023). Controlling cell cycle progression is thus a pivotal strategy in inhibiting cancer spread, as dysregulated cell cycles are common in malignancies (Suski et al. 2021; Matthews et al. 2022; Zhang et al. 2023). Anomalies in cell cycle control can lead to irregularities in cell metabolism and proliferation (Luan et al. 2023). Our study demonstrated that KLF6 inhibition increased the number of C666-1 cells in the S phase and decreased the number in the G2/M phase, suggesting that KLF6 inhibition induced cell cycle arrest. Coupled with CCK8 and apoptosis assay results, KLF6 inhibition was shown to inhibit C666-1 cell proliferation and promote apoptosis.
Our investigation aimed to assess the impact of KLF6 inhibition on the NPC cell line C666-1. The results indicated that suppressing KLF6 led to reduced cell proliferation and enhanced apoptosis in C666-1 cells. Additionally, an increase in S-phase cells and a decrease in G2/M-phase cells were observed. These findings suggest that KLF6 inhibition hinders NPC cell proliferation and induces apoptosis by causing cell cycle arrest. Therefore, KLF6 may serve as a potential therapeutic target for NPC treatment.
There are no potential conflicts of interest to disclose.
DL is resposible for the guarantor of integrity of the entire study, study concepts & design, definition of intellectual content, clinical studies, data acquisition & analysis, manuscript editing; HC is resposible for the study concepts & design, clinical studies, data acquisition, manuscript editing; ZYL is resposible for the study concepts, literature research, data analysis, manuscript review. All authors read and approved the final manuscript.