Characterization of multiple bacteriocin-producing Lactiplantibacillus plantarum PUK6 isolated from misozuke-tofu

Abstract

Multiple bacteriocin-producing Lactiplantibacillus plantarum PUK6 was isolated from misozuke-tofu, tofu pickled in miso, a traditional fermented food that has a production history of more than 800 years in the Kuma district of Kumamoto Prefecture, Japan. The PUK6 strain could grow at below 7.5% NaCl and produced both D- and L-lactic acids. In addition, it exhibited potential probiotic properties, including resistance to gastric acid and a cholesterol-lowering effect. Bacteriocins produced by the PUK6 strain were purified from the culture supernatant by ammonium sulfate precipitation, dialysis, Sep-Pak Plus tC18, and reversed-phase high performance liquid chromatography (RP-HPLC). Three peaks with high antimicrobial activity were obtained by RP-HPLC. Based on amino acid sequencing and genetic analysis by PCR, they were considered to be plantaricins A, EF, and NC8, or similar substances.

Introduction

Lactic acid bacteria (LAB) have recently received increased attention because of their health potential as probiotic strains, with properties such as cholesterol-lowering (Devi and Halami, 2017) and anti-inflammatory (Thiraworawong et al., 2014) activities, and adhesion to intestinal epithelial cells (Jia et al., 2017). LAB are also industrially important owing to their functional role in many food fermentation processes (Behera et al., 2018), which is related to their ability to improve the flavor of food, increase nutrition, and extend food shelf-life. LAB produce numerous antimicrobial substances such as organic acids, diacetyl, hydrogen peroxide, and bacteriocins. Bacteriocins are ribosomally synthesized peptides or proteins, which generally show antimicrobial activities against closely related strains of producers (Klaenhammer, 1988). Bacteriocins are divided into three classes according to their structural characteristics: class I, small (<5 kDa) lantibiotics; class II, small (<10 kDa) heat-stable and non-lantibiotics; class III, large (>10 kDa), heat-labile and non-lantibiotics (Alvarez-Sieiro et al., 2016). Bacteriocins produced by LAB are generally recognized as safe (GRAS) substances (Leroy and de Vuyst, 2004). Most preservatives for processed, ready-to-eat fresh, and easily prepared foods are chemical substances. However, at present, a large portion of the population prefers to consume natural ingredient foods, such as fermented foods, rather than chemically preserved foods. For instance, nisin A, which is produced by some strains of Lactococcus lactis, is used as a natural preservative for dairy or meat products in more than 50 countries. In other cases, pediocin PA-1/AcH produced by Pediococcus acidilactici is also commercially used in the USA (Zou et al., 2018). Many potent LAB bacteriocins have been studied, and their use as biopreservatives is expected to increase. When nisin is added to certain fermented foods or when a nisin-producing strain is used as a starter culture, it sometimes eliminates not only harmful bacteria or pathogens, but also the bacteria responsible for the original taste, thereby triggering a decline in food quality. On the contrary, if bacteriocin-producing inhabitant LAB or bacteriocins can be utilized, they may control the bacteria in fermented foods more effectively without affecting the essential bacteria and flavors. In Japan, there are many processed products and fermented foods made from soybeans such as tofu, miso, natto and soy sauce. Misozuke-tofu, tofu pickled in miso, is a traditional fermented food in the Kuma district of Kumamoto Prefecture, Japan. It has been considered a source of protein and has been used to extend the shelf-life for over 800 years. LAB have been found in tofu pickled in miso (Takebe et al., 2016) or in soybean products (Srinivasan et al., 2012; Liu et al., 2015; Sartono et al., 2019). Especially, Lactiplantibacillus plantarum (formerly Lactobacillus plantarum) has been found in various kinds of plant-based fermented foods (Behera et al., 2018). Recently, we isolated a bacteriocin-producing LAB, L. plantarum PUK6, from misozuke-tofu, which had been traditionally produced for more than 800 years. LAB and/or bacteriocins produced by LAB are considered to contribute significantly to the preservation of misozuke-tofu. In this study, we characterized the isolated multiple bacteriocin-producing strain. This is the first report of a bacteriocin-producing probiotic L. plantarum isolated from misozuke-tofu.

Materials and Methods

Bacterial strains and media The bacterial strains used in this study are listed in Table 1. Weizmannia coagulans JCM 2257^T, Niallia circulans JCM 2504^T, Bacillus subtilis subsp. subtilis JCM 1465^T, and Listeria innocua ATCC 33090^T were grown in nutrient broth (NB) medium (1% meat extract, 1% Bacto peptone, 0.5% NaCl, pH 7.0). Lactobacilli, Leuconostoc mesenteroides subsp. mesenteroides JCM 6124^T, Enterococcus faecalis JCM 5803^T, Enterococcus faecium TUA 1344L, and Pediococcus pentosaceus JCM 5885 were grown in De Man, Rogosa, Sharpe (MRS) broth (Oxoid, Hampshire, United Kingdom). Kocuria rhizophila NBRC 12708 and Escherichia coli JM109 were grown in LB medium (1% peptone, 1% NaCl, 0.5% yeast extract, pH 7.0). All strains were stored at -80 °C in their respective media with 15% glycerol until use and were cultivated at the optimum growth temperature.

Table 1. The strains used in this study and the antimicrobial spectrum of the bacteriocins produced by Lactiplantibacillus plantarum PUK6.

Indicator stain	Antimicrobial activity (AU/mL)
	Culture supernatant of PUK6	Crude bacteriocin
Weizmannia coagulans JCM 2257T	0	1 600
Niallia circulans JCM 2504T	0	200
Bacillus subtilis subsp. subtilis JCM 1465T	100 – 200	1 600 – 3 200
Kocuria rhizophila NBRC 12708	0	0
Enterococcus faecalis JCM 5803T	0	100
Enterococcus faecium TUA 1344L	0	0
Lacticaseibacillus casei JCM 1134T	0	100 – 200
Loigolactobacillus coryniformis subsp. coryniformis JCM 1164T	100 – 200	200 – 400
Lactiplantibacillus plantarum ATCC 14917T	0	0
Latilactobacillus sakei subsp. sakei JCM 1157T	1600 – 3 200	6 400 – 12 800
Lactococcus lactis subsp. lactis ATCC 19435T	0	0
Lactococcus lactis subsp. lactis JCM 7638	0	200
Leuconostoc mesenteroides subsp. mesenteroides JCM 6124T	0	0
Listeria innocua ATCC 33090T	0	0
Pediococcus pentosaceus JCM 5885	0	100
Eschericha coli JM109	0	0

ATCC, American Type Coluture Collection

JCM, Japan Collection of Microorganisms

NBRC, National Institute of Technology and Evaluation Biological Resource Center

TUA, Tokyo University of Agriculture

AU, Arbitary Unit

Bacteriocin activity assay The antimicrobial activity was investigated according to the spot-on-lawn method as described previously (Ennahar et al., 2001) with some modifications. In brief, 10 µL of a series of two-fold dilutions of a bacteriocin preparation was spotted onto a double layer composed of 5 mL of MRS broth supplemented with 1.2% agar, which was inoculated with an overnight culture of the indicator strains at ca. 10⁷ CFU/mL, and overlaid on a MRS agar plate. After the overnight incubation at set temperatures for the indicator strains, the bacterial lawns were checked for inhibition zones. The activity titer, expressed in arbitrary units per milliliter (AU/mL), was defined as the reciprocal of the highest dilution causing a clear zone of inhibition in the indicator lawn.

Screening of bacteriocin-producing lactic acid bacteria (LAB) Misozuke-tofu, which was produced by the traditional handmade method of soaking in miso paste, was purchased from a local company in the Kuma district of Kumamoto Prefecture in Japan, and bacteriocin-producing LAB were isolated from the misozuke-tofu as follows. During the first screening, the sample was homogenized and statically cultured in a tube containing 5 mL of MRS broth at 30 °C for 72 h. Then, the culture broth was inoculated by streaking on the MRS plate (containing 0.04% cycloheximide and 0.5% CaCO₃) to confirm the formation of clear zones caused by the production of lactic acid every 24 h. After the plate was cultured overnight at 30 °C, the colonies that formed a clear zone were stab-inoculated on the MRS plate containing 0.5% CaCO₃ and incubated overnight at 30 °C. Subsequently, the colonies that formed a clear zone were selected as LAB candidates. During the second screening, 5 mL of the indicator strain culture media containing 1.2% agar was layered on the colonies of LAB candidates stab-inoculated on the MRS plate in the same manner as the bacteriocin activity assay described above. Latilactobacillus sakei subsp. sakei JCM 1157^T, K. rhizophila NBRC 12708 and L. innocua ATCC 33090^T were used as the indicator strains to screen bacteriocin-producing LAB. After the plate was cultivated overnight at 30 °C, the colonies that formed a clear inhibitory zone against the indicator strains were isolated as bacteriocin-producing LAB candidates. During the third screening, the antimicrobial activities of the culture supernatants of the isolated strains, whose pH levels were adjusted to 6 to eliminate the inhibitory effect of the lactic acid produced, were examined. Finally, the PUK6 strain was selected as a bacteriocin-producing LAB.

Identification of the isolated PUK6 strain The carbohydrate fermentation pattern of the PUK6 strain was tested with the API 50 CHL identification system (Sysmex Corporation, Hyogo, Japan) according to the manufacturer's instructions. Molecular identification of the strain was performed by 16S rRNA gene sequence analysis using the universal primers HDA1 (5′-ACTCCTACGGGAGGCAGCAGT-3′) and HDA2 (5′-GTATTACCGCGGCTGCTGGCAC-3′), or 16S Ec1100F (5′-AACGAGCG(A/C)(A/G)ACCC-3′) and 16S Ec1400R (5′- GACGGGCGGTGTGT(A/G)C-3′). To investigate the salt tolerance of the PUK6 strain, the strain was cultivated at 30 °C for 72 h in MRS broth supplemented with 3.0, 4.0, 6.5, 7.5, 10.0, 12.0, 15.0, 18.0, or 20.0% NaCl. Cell growth was measured by absorbance at 600 nm. The lactic acid concentration of the culture supernatant was determined by a F-kit D-Lactic acid/L-Lactic acid (JK International, Tokyo, Japan).

Tolerance of PUK6 strain to artificial digestive fluid The gastric acid resistance of the PUK6 strain was investigated according to the method reported by Watanabe et al. (2012) with some modifications. Artificial gastric juice was prepared by adding pepsin in sterilized MRS broth at a concentration of 0.32%, and adjusted to pH 2.5 or 3.0. The PUK6 strain was cultured in MRS broth at 30 °C for 18 h, while 1% (v/v) of the culture broth was inoculated into 5 mL of the prepared gastric juice broth and incubated at 37 °C for 4 h with shaking at 50 strokes/min. Subsequently, the culture broth was sampled after 0, 2, and 4 h, and the viable cell number was measured.

Cholesterol-lowering effect of PUK6 strain The cholesterol-lowering assay was performed according to the method reported by Watanabe et al. (2012) with some modifications. The PUK6 strain was cultured in 5 mL MRS broth at 30 °C for 24 h with shaking at 120 strokes/min, washed with sterile saline, and resuspended in sterile saline to a cell density sufficient to yield an optical density of 0.15 at 600 nm. An aliquot of 1% (v/v) of the cell suspension was inoculated into 5 mL of MRS-THIO medium (MRS broth containing 0.2% sodium thioglycolate) supplemented with 0.2% sodium taurocholate. Sterilized cholesterol solution (10 mg/mL in ethanol) was then added to the broth to a final concentration of 70 µg/mL. The PUK6 strain was incubated at 37 °C for 20 h with gentle shaking at 50 strokes/min, and the supernatant was collected by centrifugation at 2 800 × g for 10 min at 4 °C. A 6 mL-aliquot of 33% KOH and 30 mL ethanol were added to 2 mL of the supernatant collected above, and then incubated in a hot water bath at 37 °C for 30 min to saponify. A 50-mL aliquot of cold hexane and 30 mL of water were added to the saponified solution and stirred for 1 min. After the hexane was distilled out of the organic phase in an evaporator, the amount of cholesterol was determined using a F-kit Cholesterol (JK International). Subseguently, the amount of cholesterol in the culture supernatant was estimated.

Purification of bacteriocins The bacteriocins were isolated from 2 L of the culture, in which the PUK6 strain was grown in MRS broth containing 0.5% CaCO₃ for 9 h at 30 °C with shaking (100 strokes/min). The culture supernatant obtained by centrifugation at 15 000 g for 10 min at 4 °C was brought to 70% saturation by the slow addition of ammonium sulfate at 4 °C. The precipitate was collected by centrifugation at 15 000 g for 10 min at 4 °C and then suspended in a small amount of 20 mM sodium phosphate buffer (pH 5.0). The suspension was dialyzed against the same buffer (pH 5) and subsequently against 8 M urea-HCl (pH 5.0) in a Spectra/Por 7 membrane MWCO 1,000 (Spectrum Laboratories Inc., Rancho Dominguez, CA, USA). A Sep-Pak Plus tC18 cartridge (Waters, Milford, MA, USA) was equilibrated with 10% CH₃CN with 0.05% trifluoroacetic acid (TFA), and the active dialysate was loaded and eluted with 60% CH₃CN with 0.05% TFA. The pooled active eluate was subsequently loaded to a resource RPC column (GE Healthcare, Chicago, IL, USA) for reversed-phase high performance liquid chromatography (RP-HPLC). For the mobile phase, solvent A and B were 0.05% TFA in distilled water and CH₃CN, respectively. The bacteriocins were eluted with a linear gradient of 30–60% solvent B in solvent A for 60 min at a flow rate of 1 mL/min. The active fractions were collected and further RP-HPLC was performed by the elution with a gentle linear gradient of 30–40% solvent B in solvent A for 60 min at a flow rate of 1 mL/min.

Tricine-SDS-PAGE The resulting proteins were fractionated by tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Tricine-SDS-PAGE) (16.5% polyacrylamide gel) according to the method described by Schägger and von Jagow (1987). After the electrophoresis, each gel was stained for proteins with Bio-Safe CBB G-250 Stain (Bio-Rad) or Silver stain KANTO III (Kanto Chemical Co., Inc., Tokyo, Japan). To detect protein bands with antimicrobial activity, the gel was washed three times in ultrapure water (30 min each) at room temperature to remove the SDS. Then, soft agar medium (5 mL) containing cells of L. sakei subsp. sakei JCM 1157^T was overlaid to cover the whole gel (6 by 9 cm) using the method described by Martinez et al. (1996). Clear zones caused by protein bands with antimicrobial activity were detected after overnight incubation at 30 °C.

Mass spectrometry and amino acid sequencing The molecular mass of the purified bacteriocins was analyzed by electrospray ionization time-of-flight mass spectrometry (ESI-TOF MS) using a JMS-T100LC mass spectrometer (JEOL, Tokyo, Japan) as described previously (Zendo et al., 2005). The N-terminal amino acid sequencing of the purified bacteriocins was determined by Edman degradation using a PPSQ-31 gas phase automatic sequencer (Shimadzu, Kyoto, Japan).

DNA manipulations. The PUK6 strain was cultivated in a 300-mL flask containing 100 mL of MRS broth supplemented with 20 mM DL-threonine at 30 °C for 4-6 h by shaking (100 strokes/min) after the addition of 5 mL of the overnight culture. Total genomic DNA of the PUK6 strain was isolated as reported previously (Goto et al., 2018). Isolation of plasmids, DNA polymerase, agarose gel electrophoresis, and transformation of Escherichia coli were performed according to standard procedures (Sambrook et al., 1989) or as recommended by the manufacturer. To determine the genes encoding the bacteriocins of the PUK6 strain, PCR was performed using the total genomic DNA of the PUK6 strain and the primers specific for plantaricins A, EF, and NC8 reported so far (Table 2) (Remiger et al., 1996; Sáenz et al., 2009; Tai et al., 2015). Primer pairs, plnA-F and plnA-R, plnEF-F and plnEF-R, and plNC8-F and plNC8-R, were employed to amplify parts of the structural genes of plantaricins A, EF, and NC8, respectively. Ex Taq DNA polymerase (Takara Bio Inc., Shiga, Japan) was used according to the manufacturer's instructions. The DNA fragments amplified by PCR were purified using a QIAquick PCR Purification Kit (QIAGEN, Hilden, Germany) or a QIAEX II Gel Extraction Kit (QIAGEN) after agarose gel electrophoresis. Subsequently, the purified fragments were cloned into a pMD20-T vector (Takara) and transformed into E. coli DH5α. The resulting pMD20 derivative plasmids were sequenced using a GenomeLAB GeXP DNA sequencer (Beckman-Coulter, Brea, CA, USA). The sequencing reaction was performed using the specifications of the GenomeLab DTCS Quick Start Kit (Beckman-Coulter). The resulting nucleotide sequences were analyzed using the SDC-GENETYX genetic information processing software (Software Development Co., Tokyo, Japan).

Table 2. Primers used to detect bacteriocin genes in this study.

Gene	Primer name	Sequence (5′→3′)	Reference
plnA	plnA-F	GTACAGTACTAATGGGAG	Remiger et al., 1996
	plnA-R	CTTACGCCATCTATACG
plnEF	plnEF-F	GGCATAGTTAAAATTCCCCCC	Tai et al., 2015
	plnEF-R	CAGGTTGCCGCAAAAAAAG
plNC8βα	plNC8-F	GGTCTGCGTAAGCATCGC	Sáenz et al., 2009
	plNC8-R	AATTGAACATATGGGTGCTTTAAATTCC

Results

Screening, isolation, and identification of Lactiplantibacillus plantarum PUK6 A total of 43 potential LAB colonies were selected from misozuke-tofu from the first screening. From the second screening, 5 strains were selected. Finally, 2 strains (nos. 14 and 74) that inhibited the growth of the indicator strains in the 3rd screening were isolated. From the API 50 CHL identification system and 16S rRNA analysis, both strains were considered to be the same species and were identified as L. plantarum (formerly Lactobacillus plantarum). Strain no. 74, which exhibited superior growth ability, was selected and designated as L. plantarum PUK6. In addition, L. plantarum PUK6 could grow at 7.5% NaCl concentration.

Lactic acid production L. plantarum normally produces both D- and L-lactic acids. At 6, 9, and 12 h of cultivation, the total lactic acid produced by L. plantarum PUK6 was 4.3, 5.8, and 8.2 g/L, and the ratio of D-lactic acid to L-lactic acid was 1.47, 1.78, and 1.42, respectively (Table 3).

Table 3. Lactic acid production by L. plantarum PUK6.

Cultivation time (h)	D-lactic acid (g/L)	L-lactic acid (g/L)	Total lactic acid (g/L)	D/L (ratio)	OD600	Final pH
6	2.6	1.7	4.3	1.47	3.1	5.0
9	3.7	2.1	5.8	1.78	5.9	4.3
12	4.8	3.4	8.2	1.42	7.5	3.9

Potential as a probiotic Gastric and bile acids tolerance tests are important to determine the viability of probiotics in the gut. The ability to grow in the presence of pepsin was determined by counting viable cells. L. plantarum PUK6 showed high gastric acid tolerance in MRS broth containing 0.32% pepsin (pH 2.5 or 3.0) compared with other strains of lactic acid bacteria isolated in our laboratory (unpublished data), and the survival rate of the cells was 100% after 4-h cultivation. Fig. 1 shows the result under the condition at pH 2.5. In addition, L. plantarum PUK6 could grow in the MRS-THIO medium containing 0.2% sodium taurocholate, indicating that this strain could be resistant to bile acid, and the cholesterol adsorption rate was 28.7%. The gastric acid tolerance and cholesterol adsorption capacity were also higher than those of other strains isolated in our laboratory (Fig. 2). For these reasons, L. plantarum PUK6 is an attractive candidate for probiotics.

Fig. 1.

Tolerance of Lactiplantibacillus plantarum PUK6 in artificial gastric juice (pH 2.5). PUK11, PUK20, PUK25, PUK26, and PJR24 strains are lactic acid bacteria isolated in our laboratory. Closed circles, open circles, closed triangles, open triangles, closed squares, and open squares indicate the results of PUK6, PUK11, PUK20, PUK25, PUK26, and PJR24 strains, respectively.

Fig. 2.

Cholesterol-lowering effect of L. plantarum PUK6. PUK11, PUK20, PUK25, PUK26, and PJR24 strains are the lactic acid bacteria isolated in our laboratory.

Antimicrobial spectrum of bacteriocins The culture supernatant and crude bacteriocin (the active precipitate obtained by salting out of the culture supernatant) of L. plantarum PUK6 were used to determine the antimicrobial spectrum. The crude bacteriocin displayed antimicrobial activity against W. coagulans JCM 2257^T, N. circulans JCM 2504^T, B. subtilis subsp. subtilis JCM 1465^T, Lacticaseibacillus casei subsp. casei JCM 1134^T, Loigolactobacillus coryniformis subsp. coryniformis JCM 1164^T, L. sakei subsp. sakei JCM 1157^T, L. lactis subsp. lactis JCM 7638, and P. pentosaceus JCM 5885 (Table 1).

Purification of bacteriocins Purification of the bacteriocins of L. plantarum PUK6 was achieved by ammonium sulfate precipitation, dialysis, Sep-Pak Plus tC18, and RP-HPLC. Sep-Pak Plus tC18 resulted in a 3.1-fold increase in the specific activity, with a recovery of activity of 25.6% (Table 4). Two peak fractions with antimicrobial activity (Fractions 1 and 4) were obtained by RP-HPLC (Fig. 3). The molecular mass of the purified bacteriocins was initially estimated by Tricine-SDS-PAGE, and the electrophoresis gel was overlaid onto a MRS agar plate seeded with L. sakei subsp. sakei JCM 1157^T. As a result, the molecular mass of Fractions 1 and 4 were determined to be approximately 6.1 and 4.1 kDa, respectively (Fig. 4). Fraction AELTLLAGLQFSLGIANRQDQ. While this sequence did not show homology with any of the bacteriocins, it showed homology with the hypothetical protein (127 amino acid residues) of unknown function in L. plantarum LZ95 (GenBank accession number ALV16217.1) according to a homology search using the Basic Local Alignment Search Tool (BLAST) (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Since Fraction 1 contained multiple peaks, it was further purified by a second RP-HPLC with a gentle linear gradient (Fig. 5). Fraction 1 could be divided into eight peaks, from which three peaks (peaks D, G, and H) with high antimicrobial activity were recovered, lyophilized, and analyzed for amino acid sequence. The draft amino acid sequences of peaks D, G, and H were VSIAKSLQMGATAIKQVXKLFXKXG, VFHAKSARGVRNN(K/L)SAVGPADXVISAVRGFIHL, andGVPAMVLTLGIQILRQAKKHRKTIEWSPNW, respectively, indicating that they were similar to those of the bacteriocins plantaricins A, F, and NC8β reported elsewhere (Diep et al, 1996; Maldonado et al., 2003). In addition, the molecular mass of the purified bacteriocins was analyzed by ESI-TOF MS; however, no clear signal of possible bacteriocins was detected. Therefore, the genomic DNA of L. plantarum PUK6 was used as a template, and PCR was performed using the primers specific for the bacteriocin structural genes (plantaricins A, EF, and NC8) (Table 2), after which the amplified products were obtained (Fig. 6). The nucleotide sequences of the amplified products were identical to parts of plantaricins A, EF, and NC8, respectively, at the amino acid level.

Table 4. Purification of the bacteriocins produced by L. plantarum PUK6.

Sample	Volume	Activity	Total proteinb)	Total activity	Specific activity	Recovery	Purification
	(mL)	(AU/mL)	(mg)	(AU)	(AU/mg)	(%)	(-fold)
Culture supernatanta)	2 000	100	189.5	200 000	1 055	100	1.0
Ammonium sulfate precipitate (70% saturation)	20	6 400	88.7	128 000	1 443	64	1.4
Sep-Pak Plus tC18	1	51 200	15.9	51 200	3 220	25.6	3.1

a)  Culture supernatant was obtained from the culture broth of L. plantarum PUK6 after 9 h cultivation as described in Materials and Methods section.

b)  Protein was estimated by using Quick Start Bradford Protein assay kit (BIO-RAD).

Fig. 3.

Reversed-phase high-performance liquid chromatography (RP-HPLC) of the crude bacteriocin. The crude bacteriocin eluted with 60% acetonitrile by Sep-Pak Plus tC18 was injected into the resource RPC column and eluted with a linear gradient of 30%–60% solvent B in solvent A (solvent A, 0.05% TFA in distilled water; solvent B, 0.05% TFA in CH₃CN) for 60 min at a flow rate of 1 mL/min. Two active fractions with antimicrobial activities were obtained (Fractions 1 and 4) and a indicated by arrows.

Fig. 4.

Gel bioassay of the purified bacteriocins produced by L. plantarum PUK6. M, Precision Plus Protein Dual Xtra Prestained Protein Standards (Bio-Rad); 1 and 2, Fractions 1 and 4 obtained by RP-HPLC, respectively. The gel was overlaid with L. sakei subsp. sakei JCM 1157^T as an indicator strain.

Fig. 5.

Second RP-HPLC of Fraction 1 obtained from the first RP-HPLC. The bacteriocins were eluted with a linear gradient of 30%–40% solvent B in solvent A for 60 min at a flow rate of 1 mL/min. Three active peaks with high antimicrobial activities (peaks D, G, and H) were obtained and are indicated by arrows.

Fig. 6.

Agarose gel electorophoresis of PCR products with the primers specific for plantaricins A (lane 1), EF (lane 2), and NC8 (lane3). The genomic DNA of L. plantarum PUK6 was used as a template. M, 100 bp DNA ladder marker.

Discussion

LAB are microorganisms that have attracted attention not only because of their positive effects on humans as probiotics, but also because of their ability to enhance the shelf-life of foods. For human health benefits and microbial control of fermented foods, it is particularly important to explore bacteriocins and bacteriocin-producing LAB with various characteristics. In this study, bacteriocin-producing L. plantarum PUK6 was isolated from a fermented food, misozuke-tofu, which has been traditionally produced in the Kuma district of Kumamoto Prefecture, Japan for more than 800 years, and the probiotic properties of the strain were evaluated and the bacteriocins produced by the strain were purified. First, the optical activity of lactic acid produced by L. plantarum PUK6 was investigated. The results showed that the PUK6 strain produced both D-lactic acid and L-lactic acid during the cultivation period (6, 9, and 12 h), and the ratio of D-lactic acid to L-lactic acid was 1.47, 1.78, and 1.42, respectively. In addition, L. plantarum PUK6 showed tolerance to 7.5% NaCl, although L. plantarum is generally resistant to 6.5% NaCl, suggesting that it has potential as a starter culture for fermented foods with added salt.

To simulate stomach conditions, L. plantarum cells were resuspended in artificial gastric juice (MRS broth containing 0.32% pepsin at pH 2.5 or 3.0). To simulate intestinal conditions and evaluate bile acid resistance, the PUK6 strain was cultivated in MRS-THIO medium (MRS broth containing 0.2% sodium thioglycolate) supplemented with 0.2% sodium taurocholate. The PUK6 strain could grow well in these media, and a cholesterol-lowering effect was observed in the broth supplemented with 0.2% taurocholate and 70 µg/mL cholesterol. These results suggest that L. plantarum PUK6 is an attractive candidate for probiotics present in fermented foods as well as a biopreservative.

The bacteriocins of L. plantarum PUK6 were purified from the culture supernatant by ammonium sulfate precipitation, dialysis, Sep-Pak Plus tC18, and RP-HPLC. In general, LAB bacteriocins are purified by ion-exchange chromatography; however, the multiple bacteriocins of the PUK6 strain could not be successfully purified by ion-exchange chromatography. Therefore, we introduced a reversed-phase pretreatment column (Sep-Pak Plus tC18) to purify the crude bacteriocins. The first RP-HPLC produced two peaks with antimicrobial activity (Fractions 1 and 4) (Fig. 3). Fraction 4 produced a single peak, and an amino acid sequence analysis and homology search were performed. The molecular weight of the hypothetical protein of L. plantarum LZ95 (ALV16217.1) homologous to the amino acid sequence of Fraction 4 was estimated to be approximately 14 kDa, whereas that of Fraction 4 was 4.1 kDa by Tricine-SDS-PAGE. Hence, Fraction 4 appeared to be a degradation product of the hypothetical protein rather than a bacteriocin with antibacterial activity. Indeed, the amino acid sequence of Fraction 4 contained many basic amino acids commonly found in antibacterial peptides. On the contrary, Fraction 1 contained multiple peaks, all of which were collected for a second RP-HPLC with a gentle gradient condition. Fraction 1 was further divided into eight peaks (A-H), and three peaks with high antimicrobial activity (peaks D, G, and H) were analyzed for amino acid sequence. The results showed that each of the three peaks had homology with plantaricins A, F, and NC8β, respectively, indicating that L. plantarum PUK6 produces at least three bacteriocins. Although ESI-TOF MS of the bacteriocins purified by a second RP-HPLC was performed, the results were ambiguous. This may be due to the fact that the PUK6 strain produces multiple bacteriocins with similar hydrophobicity and strong interaction. Class IIb bacteriocins consisting of two peptides are difficult to purify because both are required in a 1 : 1 ratio to obtain complete antimicrobial activity (Garneau et al., 2002; Oppegård et al., 2007). Therefore, to identify the multiple bacteriocins produced by L. plantarum PUK6, we genetically analyzed them by performing PCR with the primers specific for plantaricins A, EF, and NC8 (Fig. 6). The results indicated that L. plantarum PUK6 would produce at least three bacteriocins (i.e., plantaricins A, EF, and NC8) or similar substances. However, it is necessary to clarify the entire structural genes of these bacteriocins and identify them in the near future.

In general, LAB produce only one type of a bacteriocin, but some LAB that produce multiple bacteriocins, such as E. faecium NKR-5-3 (Ishibashi et al., 2012) and L. plantarum C11 (Diep et al., 1996), are known. Multiple bacteriocin-producing strains, including strain PUK6, are anticipated to be more advantageous in controlling undesirable bacteria effectively. Since they can inhibit the growth of other bacteria using various bacteriocins that exhibit different antimicrobial spectra and intensities, they would be more useful in food-related industries.

Conclusions

We isolated a bacteriocin-producing LAB from misozuke-tofu and identified the bacterium as L. plantarum PUK6. The PUK6 strain was resistant to 7.5% NaCl and gastric acid. Furthermore, this strain was possibly resistant to bile acid and showed cholesterol-lowering potential. This expands the potential of the PUK6 strain present in misozuke-tofu as a probiotic. In addition, L. plantarum PUK6 produced at least three bacteriocins, probably plantaricins A, EF, and NC8. The results from this study on LAB isolated from misozuke-tofu, which produces multiple bacteriocins and has probiotic potential, will contribute to the production of various fermented foods.

Conflict of interest There are no conflicts of interest to declare.

References

•  Alvarez-Sieiro,  P.,  Montalbán-López,  M.,  Mu,  D., and  Kuipers,  O. P. (2016). Bacteriocins of lactic acid bacteria: extending the family. Appl. Microbiol. Biotechnol., 100, 2939-2951.
•  Behera,  S.S.,  Ray,  R.C., and  Zdolec,  N. (2018). Lactobacillus plantarum with functional properties: An approach to increase safety and shelf-life of fermented foods. Biomed. Res. Int., 9361614 (18 pages).
•  Devi,  S. M. and  Halami,  P. M. (2017). Genetic variation of pln loci among probiotic Lactobacillus plantarum group strains with antioxidant and cholesterol-lowering ability. Probiotics and Antimicro. Prot., 11, 11-22.
•  Diep,  D.B.,  Håvarstein,  L.S.,  Niseen-Meyer,  J., and  Nes,  I.F. (1996). Characterization of the locus responsible for the bacteriocin production in Lactobacillus plantarum C11. J. Bacteriol., 178, 4472-4483.
•  Ennahar,  S.,  Asou,  Y.,  Zendo,  T.,  Sonomoto,  K., and  Ishizaki,  A. (2001). Biochemical and genetic evidence for production of enterocins A and B by Enterococcus faecium WHE 81. Int. J. Food. Microbiol., 70, 291-301.
•  Garneau,  S.,  Martin,  N. I., and  Vederas,  J.C. (2002). Two-peptide bacteriocins produced by lactic acid bacteria. Biochimie, 84, 577-592.
•  Goto.  S.,  Motomura,  A.,  Kawahara  A.,  Shiratsuchi,  S.,  Tanaka  K., and  Matsusaki,  H. (2018). Cloning and heterologous expression of lactate dehydrogenase genes from acid-tolerant Lactobacillus acetotolerans HT. Food Sci. Technol. Res., 24, 861-868.
•  Ishibashi,  N.,  Himeno,  K.,  Fujita,  K.,  Masuda,  Y.,  Perez,  R.H.,  Zendo,  T.,  Wilaipun,  P.,  Leelawatcharamas,  V.,  Nakayama,  J., and  Sonomoto,  K. (2012). Purification and characterization of multiple bacteriocins and an inducing peptide produced by Enterococcus faecium NKR-5-3 from Thai fermented fish. Biosci. Biotechnol. Biochem., 76, 947-953.
•  Jia,  F.F.,  Zhang,  L.J.,  Pang,  X.H.,  Gu,  X.X.,  Abdelazez,  A.,  Liang,  Y.,  Sun,  S.R., and  Meng,  X.C. (2017). Complete genome sequence of bacteriocin-producing Lactobacillus plantarum KLDS1.0391, a probiotic strain with gastrointestinal tract resistance and adhesion to the intestinal epithelial cells. Genomics, 109, 432-437.
•  Klaenhammer,  T. R. (1988). Bacteriocins of lactic acid bacteria. Biochimie, 70, 337-349.
•  Leroy,  F. and  de Vuyst,  L. (2004). Lactic acid bacteria as functional starter cultures for the food fermentation industry. Trends Food Sci. Technol., 15, 67-78.
•  Liu,  X.,  Lee,  J.Y.,  Jeong,  S.J.,  Cho,  K.M.,  Kim,  G.M.,  Shin,  J.H.,  Kim,  J.S., and  Kim,  J.H.. (2015). Properties of a bacteriocin produced by Bacillus subtilis EMD4 isolated from ganjang (soy sauce). J. Microbiol. Biotechnol., 25, 1493-1501.
•  Maldonado,  A.,  Ruiz-Barba,  J.L., and  Jimenez-Diaz.  R. (2003). Purification and genetic characterization of plantaricin NC8, a novel coculture-inducible two-peptide bacteriocin from Lactobacillus plantarum NC8. Appl. Environ. Microbiol., 69, 383-389.
•  Martinez,  B.,  Suarez,  J. E., and  Rodriguez,  A. (1996). Lactococcin 972: a homodimeric lactococcal bacteriocin whose primary target is not the plasma membrane. Microbiology, 142, 2393-2398.
•  Oppegård,  C.,  Rogne,  P.,  Emanuelsen,  L.,  Kristiansen,  P.E.,  Fimland,  G., and  Nissen-Meyer,  J. (2007). The two-peptide class II bacteriocins: structure, production, and mode of action. J. Mol. Microbiol. Biotechnol., 13, 210-219.
•  Remiger,  A.,  Ehrman,  M.A., and  Vogel,  R.F. (1996). Identification of bacteriocin-encoding genes in lactobacilli by polymerase chain reaction (PCR). Sys. Appl. Microbiol., 19, 28-34.
•  Sáenz,  Y.,  Rojo-Bezares,  B.,  Navarro,  L.,  Díez,  L.,  Somalo,  S.,  Zarazaga,  M.,  Ruiz-Larrea,  F., and  Torres,  C. (2009). Genetic diversity of the pln locus among oenological Lactobacillus plantarum strains. Int. J. Food Microbiol., 134, 176-183.
•  Sambrook,  J.,  Fritsch,  E.F., and  Maniatis,  T. (1989). Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
•  Sartono,  G.,  Rizqiyah,  I.,  Asmarinah,  Heng  N.C.K., and  Malik,  A. (2019). Three bacteriocin peptides from a lactic acid bacterium Weissella confusa MBF8-1 with spermicidal activity. Curr. Pharm. Biotechnol., 20, 766-771.
•  Shägger,  H.J. and  von Jagow,  G. (1987). Tricine-sodium dodecyl sulfate polyacrylamide gel electrophoresis for the separation of protein in the range from 1 to 100 kDa. Anal. Biochem., 166, 368-379.
•  Srinivasan,  P.,  Assalam,  Khan,  K.,  Raja,  Perumal,  U.,  Venesh,  Kumar,  R.,  Suganya,  K., and  Rajalakshmi,  M. (2012). In vitro antibacterial activity of Lactobacillus plantarum isolated from soy milk. Int. J. Pharma. Bio. Sci., 3, 209-219.
•  Tai,  H.F.,  Foo,  H.L.,  Rahim,  R.A.,  Loh,  T.C.,  Abdullah,  M.P., and  Kimura,  Y. (2015). Molecular characterisation of new organisation of plnEF and plw loci of bacteriocin genes harbour concomitantly in Lactobacillus plantarum I-UL4. Microb. Cell. Fact., 14, 1-13.
•  Takebe,  Y.,  Takizaki,  M.,  Tanaka,  H.,  Ohta,  H.,  Niidome,  T., and  Morimura,  S. (2016). Evaluation of the biogenic amine-production ability of lactic acid bacteria isolated from tofu-misozuke. Food Sci. Technol. Res., 22, 673-678.
•  Thiraworawong,  T.,  Spinler,  J.K.,  Werawatganon,  D.,  Klaikeaw,  N.,  Venable,  S.F.,  Versalovic,  J., and  Tumwasorn,  S. (2014). Anti-inflammatory properties of gastric-derived Lactobacillus plantarum XB7 in the context of Helicobacter pylori infection. Helicobacter, 19, 144-155.
•  Watanabe,  S.,  Katsube,  T., and  Sonomoto,  K. (2012). Cholesterol-lowering effects of Lactobacillus brevis isolated from Turnip “Tsuda Kabu”. Food Sci. Technol. Res., 18, 825-834.
•  Zendo,  T.,  Eungruttanagorn,  N.,  Fujioka,  S.,  Tashiro,  Y.,  Nomura,  K.,  Sera,  Y.,  Kobayashi,  G.,  Nakayama,  J.,  Ishizaki,  A., and  Sonomoto,  K. (2005). Identification and production of a bacteriocin from Enterococcus mundtii QU 2 isolated from soybean. J. Appl. Microbiol., 2005, 99, 1181-1190.
•  Zou,  J.,  Jiang,  H.,  Cheng,  H.,  Fang,  J., and  Huang,  G. (2018). Strategies for screening, purification and characterization of bacteriocins. Int. J. Biol. Macromol., 117, 781-789.