Index INTRODUCTION MATERIALS AND METHODS Fungal strains and culture. Phenotypic analysis. Disruption of pkac-1 gene. PKA assays. Real-time quantitative RT-PCR. RESULTS Isolation of RIP-induced mutants of cAMP-dependent protein kinase pkac-1 gene. Characterization of pkac-1 mutants. PKA activity in pkac-1 mutant. PKAC-1 mediates mcb growth polarity. DISCUSSION References

INTRODUCTION

A cyclic AMP (cAMP)-signaling pathway has been reported to regulate a variety of processes in filamentous fungi, including morphogenesis, sexual development and virulence (Kronstad et al. 1998; Lengeler et al. 2000; Borges-Walmsley and Walmsley 2000; D'Souza and Heitman 2001; Lee et al. 2003). cAMP is produced from ATP by adenylate cyclase and acts as a secondary messenger. cAMP-dependent protein kinase (PKA) has been found in all eukaryotes, and is the major downstream effecter of cAMP. PKA is a tetrameric protein that is composed of two regulatory subunits and two catalytic subunits. In most cases, the holoenzyme tetramer is inactive and unable to phosphorylate substrate proteins. Binding of cAMP to the regulatory subunits results in the release of two active catalytic subunits, which are able to phosphorylate target proteins.

In the yeast Saccharomyces cerevisiae, cAMP-signaling pathways regulate the resistance to environmental stress, growth on various carbon sources, glycogen accumulation, cell cycle progression, sporulation, and pseudohyphal growth (Thevelein and de Winde 1999). Three catalytic subunits, Tpk1, Tpk2, and Tpk3, have been identified and found to be involved in the regulation of pseudohyphal differentiation (Toda et al. 1987). Tpk2 promotes filamentous growth while Tpk1 and Tpk3 inhibit filamentous growth (Robertson and Fink 1998; Pan and Heitman 1999). Moreover, PKA has been reported to be involved in fungal pathogenesis in many kinds of filamentous fungi such as Magnaporthe grisea (Adachi and Hamer 1998; Xu and Hamer 1996; Mitchell and Dean 1995), Colletotrichum trifolii (Yang and Dickman 1999), and Ustilago maydis (Durrenberger et al. 1998; Gold et al. 1997). In the rice blast pathogen M. grisea, the deletion of the MAC1 gene encoding adenylate cyclase has been demonstrated to disrupt appressorium differentiation, while in the pleiotropic effects are observed on growth, conidiation, and sexual development (Choi and Dean 1997). A mutation of the regulatory subunit of PKA, sum-99, was subsequently found to suppress the mac1 phenotype (Adachi and Hamer 1998). Mutants with disruption of the catalytic subunit of the PKA gene exhibit a delay in appressorium development and are unable to colonize intact plants, indicating that the PKA signaling pathway plays important roles in successful penetration of this fungus into host plants (Mitchell and Dean 1995).

In Neurospora crassa, an adenylate cyclase mutant, cr-1 (crisp-1), lacks a detectable amount of cAMP (Terenzi et al. 1974). When the cr-1 mutant is cultured on a solid medium, it grows colonially, lacks appreciable aerial hyphae, and prematurely produces macroconidia directly on the surface of the mycelium. In addition, the cr-1 mutant shows inappropriate conidiation in submerged culture and exhibits thermotolerance. The mcb (microcyclic conidiation) mutant, a morphological mutant known to have a defect in the regulatory subunit of PKA, forms defined hyphae at 25°C, but it shows a complete loss of growth polarity when hyphal filaments are transferred to 37°C. The phenotype of the mcb mutant is restored by transformation with the wild-type mcb gene. The cr-1 mutation is epistatic to the mcb mutation, because a cr-1 mcb double mutant shows normal conidial germination at 37°C (Bruno et al. 1996). The cot-1 gene encodes a Ser/Thr protein kinase (Yarden et al. 1992), and the colonial temperature-sensitive (cot) mutants exhibit abnormal polar extension and branching patterns when grown at the restrictive temperature. The cot-1 phenotype could be partially suppressed by direct inhibition of PKA with KT-5720 (Gorovits and Yarden 2003).

In the present study, we isolated RIP-induced mutants of a catalytic subunit gene, pkac-1, in N. crassa, and compared their phenotypes with those of cr-1 and mcb mutants. To investigate the function of the catalytic subunit of PKA in growth, conidiation, and growth polarity, we characterized three double mutants, pkac-1 mcb, pkac-1 cot-1, and pkac-1 fl. The fl gene encodes a transcription factor, C6 zinc cluster protein, and is required for normal conidial formation (Bailey and Ebbole 1998).

MATERIALS AND METHODS

Fungal strains and culture.

N. crassa strains used in this study are listed in Table 1. C1-T10-37A and C1-T10-19a are wild-type strains closely related to the standard Oak Ridge wild type (Tamaru and Inoue 1989). The cr-1 (FGSC 4008; allele B123), mcb (FGSC 7094; allele no#), and fl (FGSC 6683; allele P) mutants were obtained from the Fungal Genetic Stock Center (Kansas City, MO, USA). The cot-1 strain (TY-C102-5) was derived from a cross of 74-OR31-14a (al-2, pan-2, cot-1; FGSC 4934) with C1-T10-37A. The strains were basically grown on agar-solidified Vogel’s medium N (VM) plus 1.2% (w/v) sucrose at 25°C (Vogel 1964).

View Details

Table 1. Neurospora strains used in this study

Phenotypic analysis.

Colony growth and morphology were assessed by inoculating conidia on VM agar medium, followed by incubation at 25°C. Linear growth of mycelia was estimated in race tubes (40 cm length × φ1.5 cm). Conidia were spotted at the edge of the race tube and incubated at 25°C. The growth distance from the front of the elongating tip was then measured at 24-hr intervals. For analyses of conidiation in submerged cultures, cultures with conidia at 1 × 10⁶ cells/ml were incubated in liquid VM medium with shaking at 200 rpm for 32 hr and then photographed. To measure thermotolerance, 200 μl of conidial suspension that had been germinated for 3 hr at 25°C was exposed to 52°C for 5 min to 20 min in a water bath. Percent survival was calculated by dividing the number of colonies on plates containing heated germlings by that on plates from non-treated germlings.

Disruption of pkac-1 gene.

Two oligonucleotide primers, PKACF1 (TTTCCAACCAGTCTCTCTCGGGACGG) and PKACR1 (AAAGCCCTGCACGAGAGCTTCGTCTC), were used to amplify the pkac-1 gene using genomic DNA of the wild-type strain. The PCR products resulted were further amplified through a second PCR by the use of two primers, PKACF1 and PKACR2 (TCCCTCTTGGGCGCGGTATTCTTACC). The amplified 4.4-kb DNA fragments containing the genomic pkac-1 gene were cloned into pT7blue-2 to produce pPKA1. The pPKA1 was digested by HindIII and ligated with the 1.5-kb hygromycin resistance gene derived from HindIII digestion of pTCHYG (Ito et al 1997), yielding pPKA1-hyg. The spheroplasts of the wild-type strain were transformed by pPKA1-hyg. Transformation was performed as described by Vollmer and Yanofsky (1986). The transformants were selected on medium containing hygromycin B at 500 μg/ml. After three cycles of single colony isolation to make homokaryons, each transformant was crossed with the wild-type strain of the opposite mating type for disruption of the gene through the process of repeat-induced point (RIP) mutation (Selker 1990). Crosses were performed on synthetic crossing medium as described by Davis and De Serres (1970). To confirm mutations induced by RIP, genomic DNAs of the putative mutants were isolated as described previously (Ochiai et al. 2001). An analysis of the DNA sequence was conducted by using the ABI Model 373A Auto Sequence System (Perkin Elmer/Applied Biosystems) and fluorescent dye terminator dideoxynucleotides according to the PCR cycle sequencing protocol.

PKA assays.

PKA assays were performed using a nonradioactive PKA assay kit (Promega) according to the manufacturer’s instructions. PKA activity was visualized by agarose gel electrophoresis of a fluorescent PKA model substrate (Kemptide). The mycelia grown in VM liquid medium for 2 days were harvested by filtration and frozen in liquid nitrogen. About 100 mg of mycelia (wet weight) was mixed with 1ml of extraction buffer (20 mM Tris, 10 mM MgCl₂, 0.5 mM PMSF) and 0.4 g of glass beads (0.5 mm), and then shaken with a bead beater (FastPrep Instruction, Bio101) for 20 seconds. Protein concentration was determined using the Bradford protein assay kit (Bio-Rad) with bovine serum albumin as a standard, and was adjusted to 1.5 mg/ml.

Real-time quantitative RT-PCR.

For isolation of total RNA, mycelia of 2-day-old cultures in liquid VM medium at 25°C were collected by vacuum filtration and frozen in liquid nitrogen. Total RNA was isolated using a FastRNA Pro Red kit (BIO101). To remove contaminating genomic DNA, RNA samples were treated with 2 U of DNase I (Takara) per 50 μl of RNA at 37°C for 1 h. Each RNA sample (total RNA 50 ng) was subject to one-step PCR amplification. Real-time PCR was performed using the LightCycler system (Roche Diagnostics) with SYBR Green detection. The QuantiTect™ SYBR^® Green RT-PCR kit was purchased from Qiagen, (Qiagen, Hilden, Germany). Amplification conditions consisted of three consecutive phases: (i) a reverse transcription step (50°C for 20 min), (ii) an initial denaturation step to activate the HotStarTaq DNA polymerase (95°C for 15 min), and (iii) an amplification step consisting of 50 cycles (94°C for 15 sec, 65°C for 20 sec, and 72°C for 20 sec). Two forward PCR primers, con10F1 (CATTTCTCCAGCCCCAAGGA-AGA) and con10F2 (AACCCAAAACAGCGCGAAATTGC), and one reverse primer, con10R1 (TGATGACCTCTACTCATCGTCG), were used to quantify the gene expression of the con-10 gene. To avoid problems associated with DNA contamination, forward primers were selected that span at least one intron of the genomic sequence. β-tubulin primers, NC-Bt2a (GGTAACCAAATCGGTGCTGCTTTC) and NC-Bt2b (ACCCTCAGTGTAGTGACCCTTGGC), were also used for real-time PCR analysis. The relative values of gene expression were calculated by comparing the cycle number in the real-time PCR analysis for each mutant with that for the wild-type strain.

RESULTS

Isolation of RIP-induced mutants of cAMP-dependent protein kinase pkac-1 gene.

The N. crassa genome was recently sequenced by the Whitehead Institute/MIT Center for Genome Research (www-genome.wi.mit.edu). A search of the N. crassa genome sequence predicts two dis-tinct catalytic subunits of PKA named pkac-1 (NCU06240.1, AAF75276) and pkac-2 (NCU00682.1). Two such subunits are present in most filamentous fungi. The deduced amino acid sequence of the pkac-1 gene product is similar to the sequences of Ct-PKAC (AF046921) from Colletotrichum trifolii and CPKA (U12335) from Magnaporthe grisea, which have 71.8% and 69.1% identity with the pkac-1 gene product, respectively (Fig. 1). They have a short conserved sequence in the N-terminal region and a glutamine-rich sequence in the linker region. The kinase domains in the C terminal regions are highly conserved. In contrast, the putative amino acid sequence of the pkac-2 gene product has 40.5% homology with pkac-1, but 62.0% and 47.5% identity with CPK2 (AY179835) from M. grisea and uka1 (AF025290) from U. maydis, respectively (data not shown). The catalytic subunit genes of PKA that are similar to pkac-1, such as M. grisea CPKA and U. maydis adr1, are known to play an important role in cell morphology, as shown by disruptant analysis, while the deletion of pkac-2-like genes, as shown for M. grisea CPK2 and U. maydis uka1, does not seem to affect fungal morphology or pathogenicity (Lee et al. 2003).

View Details

Fig. 1. Alignment of the deduced pkac-1 gene product with cAMP dependent protein kinase catalytic subunits of other fungi. Residues identical in the three sequences are indicated by boxes. GenBank accession numbers for the nucleotide sequences of the genes are as follows: Colletotrichum trifolii, AF046921; Magnaporthe grisea, U12335. The solid line indicates the glutamine–rich region.

These data prompted us to isolate the disruptant mutants of the pkac-1 gene of N. crassa by using repeat-induced point mutation (RIP). The RIP phenomenon has been successfully used to generate null mutants. The plasmid pPKAC1-hyg, containing a 4.2-kb fragment of wild-type pkac-1 and the hygromycin resistance gene hyg, was constructed and introduced into the wild-type strain (see Materials and Methods). Hygromycin-resistant transformants were isolated and crossed with the opposite mating type of the wild-type strain. Eighty-four progeny were picked up and cultured on VM solid medium. Among them, 7 progeny were different from the wild-type strain in mycelial growth and morphology. They showed repression of aerial hyphae and stimulated conidiation, as shown in three representative ripped strains, OB-PCRIP5, OB-PCRIP6 and OB-PCRIP8 (Fig 2A). To confirm the RIP-induced mutations in these progeny with abnormal morphology, the N-terminal coding regions of the pkac-1 gene in 6 ripped mutants were sequenced, and the nucleotide sequences were compared with that of the wild-type. All strains examined had C-to-T and G-to-A transitions in the sequenced region, indicating RIP-induced mutations. The mutations within the open reading frame in the pkac-1 genes of three representative strains are shown in Table 2. Multiple nonsynonymous codon changes, including nonsense codons, were detected in the coding regions of three mutant alleles. Based on these results, we concluded that these strains with abnormal morphology are pkac-1 null mutant strains and used them for further analysis.

View Details

Fig. 2. Comparison of growth and morphology of the pkac-1 gene mutants on agar medium with those of the cr-1 and mcb mutants. A) Standing test-tube cultures. Strains were inoculated onto 1.5 ml of VM agar medium and cultured for 7 days at 25°C. B) Linear growth length per 24 hr at 25°C in race tubes. The growth rate at 25°C in race tubes containing VM agar medium was measured (see Materials and Methods). Standard error bars are shown for three replicates. C) Effect of cAMP and temperature on mycelial growth. Conidia was inoculated on VM agar medium and cultured for 3 days at 25°C (control) or 37°C. cAMP was added at 5 mM.

View Details

Table 2. Amino acid substitutions in gene products of RIP-induced pkac-1 mutants in N. crassa

Characterization of pkac-1 mutants.

The phenotypes of pkac-1 mutants were compared with those of the wild-type, adenylate cyclase mutant cr-1, and PKA regulatory subunit mutant mcb (Fig. 2). The pkac-1 mutants and cr-1 mutant conidiated close to the surface of agar medium in a small test-tube, while the wild-type strain and mcb mutant conidiated on aerial hyphae (Fig. 2A). Both the pkac-1 and cr-1 mutants grew colonially on VM agar plates containing 1.2% sucrose, at an average 0.8 ± 0.2 mm and 0.6 ± 0.3 mm per day, respectively (Fig. 2B), while the wild-type strain grew at a rate of 8.6 ± 0.9 mm per day. The mcb mutant grew at a rate of 6.5 ± 0.6 mm per day, although its initial growth was very slow due to the abnormal morphology during conidial germination (data not shown).

Colonial growth and hyper-conidiation of the cr-1 mutant were partially corrected by exogenous cAMP at a concentration of 5 mM, as described previously (Terenzi et al. 1974; Rosenberg and Pall 1979). However, the addition of cAMP did not affect the phenotypes of pkac-1 mutants (Fig. 2C). The growth of both pkac-1 and cr-1 mutants at 37°C was similar to that at 25°C, whereas the mcb mutant was sensitive to high temperature (Fig. 2C). The phenotypes of three pkac-1 mutants, OB-PCRIP5, OB-PCRIP6 and OB-PCRIP8, were very similar to each other, and therefore we used strain OB-PCRIP8 as a representative pkac-1 mutant in the following study.

Morphological observations were also made on growth habits in submerged culture. The wild-type strain of N. crassa did not conidiate in submerged glucose culture. In contrast, the pkac-1 mutant produced inappropriate conidia in submerged shaking culture within 32 hr, as shown in Fig. 3A. Submerged conidiation of the pkac-1 mutant was faster than that of the cr-1 mutant, because the cr-1 mutant began conidiation within 32 hr but prolonged cultivation (48 hr) was necessary for production of a large amount of conidia in liquid culture. The mcb strain formed round hyphae during germination followed by elongated normal hyphae, but did not conidiate in liq-uid culture. To further analyse conidiation in submerged cultures of the pkac-1 mutants, the transcript level of the conidiation-specific con-10 gene was assayed by RT-PCR (Fig. 3B). The con-10 transcript level of the pkac-1 mutant grown in submerged culture was estimated to be more than 100 times greater (8.9 cycles and 8.4 cycles faster for primer F1-R1 and primer F2-R1, respectively) than those of the wild type, whereas expression of the β-tubulin gene was similar in both types of cell. As in previous observations, the con-10 transcript was not detected in the wild-type strain grown in submerged culture but was detected in the cr-1 mutant (Kays et al. 2000; Ivey et al. 2002). Consistent with the morphology observed in submerged culture, the con-10 transcript was produced faster in the pkac-1 mutant than in the cr-1 mutant; con-10 expression in the pkac-1 mutant was high even after 1 day of submerged culture, but cr-1 strain did not accumulate the con-10 gene transcript in 1 day (data not shown).

View Details

Fig. 3. Conidiation and conidiation-specific gene expression in submerged cultures. (A) Conidiation in liquid culture. Conidia at 1 × 106 cells/ml were inoculated into VM liquid medium, incubated with shaking in the dark at 25°C for 36 hr and then photographed. (B) con-10 gene expression in submerged culture. Total RNA (50 ng) isolated from strains was analyzed by real-time PCR using two sets of con-10 specific primers (PrimerF1-R1 and PrimerF2-R1). β-tubulin expression was analyzed as an internal control for RNA. Quantification of mRNA is presented as a relative value for each mutant compared with mRNA for the wild-type strain: the wild-type (white boxes), cr-1 (gray boxes), mcb (hashed boxes), and pkac-1 (black boxes). Standard error bars are shown for three replicates. Real-time PCR products detected by agarose gel electrophoresis were photographed.

Thermotolerance of conidial germlings was also observed in both cr-1 and pkac-1 mutants. The wild type and mcb mutant were sensitive to 5-min exposure to a lethal heat treatment (52°C). On the other hand, half of the germlings of cr-1 and pkac-1 mutants survived (Fig. 4). Moreover, we found that the pkac-1 mutant possessed greater thermotolerance than the cr-1 mutant, because the rate of survival of the pkac-1 mutant exposed to 20-min heat treatment was higher than that of the cr-1 mutant (Fig. 4). These data indicate that the phenotypes previously found in cr-1 mutants, namely submerged conidiation and thermotolerance, were also found in the pkac-1 mutant, but those of the pkac-1 mutant were more severe than those of the cr-1 mutant. Therefore, at least colonial growth, restriction of aerial hyphae formation, hyper-conidiation, submerged conidiation, and thermotolerance in the cr-1 mutant are thought to be due to the lack of the activity of PKAC-1.

View Details

Fig. 4. Thermotolerance assays. The viability of 3-hr-old germlings of wild-type (open circles), mcb (closed circles), cr-1 (triangles), and pkac-1 (squares) strains was determined after exposure to a lethal temperature (52°C) for the indicated time. The number of colonies from plates containing heated germlings was determined 5 days later. Each point represents an average of three independent experiments.

PKA activity in pkac-1 mutant.

We assayed PKA activity in crude extracts of mycelia from the wild-type and pkac-1 strains of N. crassa (Fig. 5). The wild-type strain contained detectable levels of protein kinase activity. Addition of KT-5720 at 150 μM decreased the PKA activity of the wild type. PKA activity was undetectable in the cell extract of the pkac-1 mutant with or without KT-5720. The PKA activity in the wild-type strain was decreased drastically when cAMP was not included in the assay mixture (data not shown). These data suggest that the pkac-1 gene encodes cAMP-dependent protein kinase and its product seems to be the major catalytic subunit of PKA in the mycelia of N. crassa.

View Details

Fig. 5. PKA activity in wild-type and pkac-1 strains of N. crassa. Extracts were prepared from mycelia of submerged cultures after 3 days. Each cell extract (1.2 μg of protein) was incubated with Kemptide (0.2 μg) in the reaction mixture (25 μl: 20 mM Tris-HCl pH7.4, 10 mM MgCl2, 1 mM ATP, 1 μM cAMP) at room temperature for 1 hr. Each sample (15 μl) was separated on 0.8% agarose gel at 100 V for 15 min (phosphorylated substrate migrating toward the anode) and photographed using a UV transilluminator. PKA activity was determined with (+) or without (–) the addition of PKA inhibitor KT-5720 (150 μM).

PKAC-1 mediates mcb growth polarity.

In the N. crassa genome, there is only one gene, mcb, for the regulatory subunit of cAMP dependent protein kinase (Borkovich et al. 2004). The mcb mutant exhibits loss of polarity at restrictive temperatures. To clarify the correlation of cell polarity with the PKA catalytic subunit, we made the double mutant pkac-1 mcb by crossing the pkac-1 mutant with the mcb mutant. The pkac-1 mcb double mutant showed colonial growth with hyper-conidiation, resembling the single pkac-1 mutant (Fig. 6A). The temperature sensitivity of the mcb mutant was abolished in the pkac-1 mcb double mutant. When the conidia of the mcb mutant were inoculated on VM solid medium at 37°C, the conidia swelled without forming germination tubes. However, the double mutant pkac-1 mcb grew well at the restrictive temperature (Fig. 6B).

View Details

Fig. 6. Phenotypes of the double mutants, MF-PM-4 (pkac-1 mcb), MF-PF-13 (pkac-1 fl), and MF-PC-27 (pkac-1 cot-1). (A) Growth and conidiation on VM agar medium. (B) Morphology in germination of pkac-1 mcb and pkac-1 cot-1 mutants grown at the restrictive temperature (37°C). Conidia were inoculated on VM agar medium and cultured at 37°C for 24 hr. Morphological observation by light microscope and photographs were made at the same magnitude.

Furthermore, we constructed two other double mutants, pkac-1 cot-1 and pkac-1 fl. The cot-1 gene encodes a Ser/Thr protein kinase (Yarden et al. 1992). The cot mutant exhibits abnormal polar extension and branching patterns when grown at restrictive temperatures. This cot-1 phenotype could be partially suppressed by KT-5720 (Gorovits and Yarden 2003). The growth of the double mutant pkac-1 cot-1 on VM agar medium at 25°C was more restricted than that of the single mutant pkac-1 strain (Fig. 6A). Moreover, it could not grow at 37°C. The morphology was essentially similar to that of the single mutant cot-1 strain: however, the swelling of the conidia found in the cot-1 mutant was partially suppressed in the double mutant (Fig. 6B). The fl gene, which encodes a transcription factor, C6 zinc cluster protein, is required for normal conidial formation (Bailey and Ebbole 1998). The pkac-1 fl double mutant exhibited colonial growth but was less pigmented than the pkac-1 mutant. (Fig. 6A). Less pigmentation is known to occur in many aconidial mutants, including fl. Light microscopic observation revealed that the pkac-1 fl strain was defective in microconidia production (data not shown). Thus, the fl mutation suppressed hyper-conidiation of the pkac-1 mutant, but not colonial growth.

DISCUSSION

A BLAST search of the catalytic subunit of PKA suggested that two types of genes generally exist in filamentous fungi. N. crassa also seems to have two corresponding genes, pkac-1 and pkac-2, which have high homology with CPKA1 andCPKA2 in M. grisea and also with adr1 and uka1 in U. maydis, respectively. In the present study, we isolated the pkac-1 mutants through the process of repeat-induced point mutation (RIP). Sequence analysis of three RIP-induced mutants strongly suggests that they are null mutants of the pkac-1 gene (Table 2). The disruptants exhibited colonial growth and premature conidiation on the short aerial hyphae or directly on the surface of agar medium (Fig. 2). The abnormal morphology of pkac-1 disruptants was very similar to that of the cr-1 mutant, which is deficient in adenylate cyclase. Phenotypic similarity between mutants of adenylate cyclase and of the catalytic subunit of PKA is commonly observed in several filamentous fungi (Durrenberger et al. 1998; Mitchell and Dean 1995), and can be explained as follows: cAMP-dependent protein kinase (PKA) is an inactive heterotetramer consisting of a regulatory dimer and two molecules of catalytic subunits. Upon binding cAMP, the regulatory dimer releases the two molecules of active catalytic subunits. Thus, the lack of adenylate cyclase in cr-1 mutant results in the lack of catalytic subunit protein kinase activity, which is also lacking in pkac-1 mutants. The addition of cAMP recovered the cr-1 phenotype, probably due to the release of active catalytic subunits from the regulatory subunits in cr-1 mutants. In contrast, the pkac-1 disruptants lacking active catalytic subunit did not recover when supplemented with external cAMP. These results indicate that the pkac-1 product acts downstream of adenylate cyclase in the signal transduction pathway.

Neurospora cr-1 mutants have pleiotropic phenotypes not only in vegetative growth and conidiation but also conidiation in submerged culture and thermotolerance (Cruz et al. 1988; Ivey et al. 2002; Kays et al. 2000). Conidiation in submerged culture is induced by starvation of the carbon source in N. crassa (Cortat and Turian 1974; Madi et al. 1997). The submerged conidiation phenotype was observed in the other N. crassa mutants, including the mutants of gna-3, gna-1 and rco-3, which encode the α-subunit of G protein, β-subunit of G protein, and a putative glucose sensor, respectively (Kays et al. 2000; Yang et al. 2002; Madi et al. 1997). Among them, gna-1 mutants, like cr-1 mutants, possess increased thermotolerance, whereas strains with GTPase-deficient alleles of gna-1 are more sensitive to lethal temperatures than the wild type, suggesting an inverse correlation between cAMP signaling and resistance to temperatures in N. crassa. Submerged conidiation and thermotolerance were also observed in the pkac-1 mutants (Fig. 3 and Fig. 4). The submerged-conidiation phenotype of pkac-1 mutants was well correlated with conidiation-specific con-10 gene expression, although the submerged conidiation as well as con-10 expression in the pkac-1 mutants were more distinct than those observed in the cr-1 strain. Similar results were obtained regarding thermotolerance in cr-1 and pkac-1 mutants. The pkac-1 mutant showed a higher tolerance to lethal temperature than the cr-1 mutant. The reasons why the submerged conidiation and thermotolerance in pkac-1 mutants are more marked than those of cr-1 mutants are unknown. It is possible that the mutation in cr-1 mutants might be leaky so that the cAMP signaling pathway works only slightly, or alternatively that a negative feedback in the PKA pathway may work in cr-1 mutants but not in pkac-1 mutants.

Our data indicate that most of phenotypic characteristics of the cr-1 mutant were essentially the result of the suppression of the activity of pkac-1 products. PKA activity in mycelial extracts was undetectable in pkac-1 disruptant strains under the conditions in which cAMP dependent- and KT-5720-sensitive PKA activity was detected in the wild-type strain (Fig 5). These data also support the notion that the pkac-1 gene product is the major PKA at least in mycelia of N. crassa. The function of the pkac-2 gene, another catalytic subunit of PKA, remains to be clarified. Deletion of M. grisea CPK2 and U. maydis uka1, which are highly homologous to pkac-2, did not cause any detectable change in phenotypes (Lee et al. 2003).

The mcb (microcyclic conidiation) mutant of N. crassa, which is known to be a mutant of the PKA regulatory subunit gene, exhibits loss of growth polarity at restrictive temperatures, possibly due to altered organization of actin patches at the cell cortex (Bruno et al. 1996). The morphology of the double mutant pkac-1 mcb resembles that of the pkac-1 mutants (Fig. 6). Suppression of the abnormal growth polarity of the mcb strain by the pkac-1 gene mutation indicates that PKAC-1 activity is essen-tial for the mcb phenotype. The mcb mutant has increased expression of two overlapping transcriptional units, and loss of polarity is suppressed by cr-1 (Bruno et al. 1996), suggesting that the mcb mutant is not a null mutant of the regulatory subunit gene. Further studies will be necessary to clarify the function of the regulatory subunit in cell polarity in the mcb mutant of N. crassa.

In addition, we characterized pkac-1 cot-1 double mutants. The cot-1 (colonial temperature-sensitive 1) gene encodes a Ser/Thr protein kinase and its mutant confers a defect in hyphal extension at restrictive temperatures. Partial suppression of the cot-1 phenotype by the PKA inhibitor KT-5720 indicates the link between PKA activity and COT-1 function (Gorovits and Yarden 2003). The pkac-1 mutation did not suppress the temperature sensitivity or hyper-branching during germination in cot-1, but partially suppressed the swelling of conidia during germination in the cot-1 mutant. The existence of some interaction between PKAC-1 and COT-1 was thus suggested.

To examine the correlation between colonial growth and hyper-conidiation in pkac-1 mutants, we crossed a pkac-1 mutant with aconidial mutant fl, whose gene encodes a C6 zinc cluster transcription factor. The double mutants exhibited colonial growth without conidiation. Therefore, colonial growth in pkac-1 mutants is not due to the hyper-conidiation.

In the present study, we demonstrated that the defect of PKA activity restricts the hyphal growth and aerial hyphae formation and that it stimulates immature conidiation. High homology among pkac-1-related genes in various filamentous fungi was thus demonstrated. Although the various mutant phenotypes were different from each other, it was commonly observed that PKA is essential for virulence among pathogenic fungi. Neurospora is not pathogenic, but this model organism can be a powerful tool for elucidating the complexity of the signal transduction pathway mediated by cAMP-PKA.

This work was supported in part by a Grant-in-Aid for Scientific Research (No. 1066052) from the Ministry of Education, Science, Sports, and Culture of Japan.