| Edited by Hisaji Maki. Naotake Ogasawara: Corresponding author. E-mail: nogasawa@bs.naist.jp |
GTP-binding proteins (GTPases) function as crucial molecular switches in a broad variety of biochemical processes. Bacterial genome sequencing has led to the identification of a novel family of P-loop GTPases that are often essential for growth, and possibly involved in biogenesis of the 30S or 50S ribosomal subunits (Caldon et al., 2001; Brown, 2005; Comartin and Brown, 2006). Bacillus subtilis Obg and Escherichia coli Era are representatives of this Obg/Era family, with five other known members in the bacterial genome (Morimoto et al., 2002; Cladiere et al., 2004). Interestingly, the B. subtilis genome contains all the members, including Obg, Era, YlqF, YphC, YsxC, YqeH, and YloQ. Among these, Obg, Era, YphC, YsxC, and YloQ are conserved universally in bacteria, while YlqF and YqeH are mainly restricted to low-GC gram-positive bacteria. Intriguingly, YlqF and YqeH orthologs are present in some archaea and eukaryotes.
B. subtilis YlqF and E. coli ObgE (ortholog of B. subtilis Obg) are non-ribosomal factors required for the maturation of the 50S ribosomal subunit. Depletion of YlqF or ObgE results in an altered ribosome profile displaying a reduced level of 70S ribosome and emergence of the 50S subunit precursor (Jiang et al., 2006; Matsuo et al., 2006). Furthermore, YlqF associates with the free 50S subunit in vivo (Uicker et al., 2006; Matsuo et al., 2006), binding to a region between the A and P sites, located at helices 38, 81 and 85 of 23S rRNA (Matsuo et al., 2006). Clearly, YlqF is involved in the late stages of 50S subunit biogenesis. ObgE preferentially interacts with the free 50S subunit in vivo, indicative of direct involvement in 50S formation (Sato et al., 2005; Jiang et al., 2006). Consistent with these results, a recent study demonstrates accumulation of 50S precursors in B. subtilis cells depleted of YsxC or YphC (Schaefer et al., 2006).
On the other hand, Era and YloQ are non-ribosomal factors that participate in assembly of the 30S subunit. E. coli Era is the most extensively characterized GTPase of the Obg/Era family. However, Era mutants display a variety of phenotypes (Lerner and Inouye, 1991; Britton et al., 1998; Sayed et al., 1999; Meier et al., 2000; Inoue et al., 2003), thus making it difficult to ascertain the precise function of the protein. Recently, Sharma and colleagues (2005) reported a plausible cryo-electron microscopic map of the Era-30S complex of Thermus thermophilus. Era localization is mapped to a site within the 30S subunit, which overlaps the ribosomal protein S1 binding site. Binding of Era to the 30S subunit induces a conformation that inhibits 50S subunit association. Therefore, Era modulates the final stage of 30S assembly, and is replaced by S1, thus defining the completion of the 30S subunit assembly. B. subtilis YloQ and its E. coli ortholog, YjeQ, additionally associate with the 30S subunit (Daigle et al., 2004; Levdikov et al., 2004; Campbell et al., 2005). The GTPase activity of YjeQ is enhanced several fold upon addition of the 30S subunit (Himeno et al., 2004; Daigle et al., 2004).
YqeH is a member of the Obg/Era family, whose function remains to be elucidated. The 41 kDa protein possesses a central localized circular permuted GTP-binding domain with a G4-G1-G2-G3 motif (Leipe et al., 2002; Anand et al., 2006) and an N-terminal putative zinc finger domain with a conserved CXGCGXnCXRC motif (Levdikov et al, 2004). Interaction between the zinc finger domain and rRNA may be involved in the protein function (Anand et al., 2006). However, the C-terminus displays poor homology with proteins of known function, and is composed of nearly 20% of positively-charged amino acids, such as arginine, lysine and histidine. A recent study by Uicker et al. (2007) showed that YqeH depletion results in slow growth and decreased mature 16S rRNA, suggesting a potential role in proper ribosome assembly in B. subtilis. Here, we present detailed functional analysis of YqeH. We observed a reduction in the 70S ribosome level, and accumulation of the free 50S subunit, but not free 30S, in YqeH-depleted cells. Consistent with the alleged involvement of YqeH in 30S subunit biogenesis, a precursor of 16S rRNA and its degraded products were detected. However, the reduction of free 30S subunit was not observed in Era-depleted cells. Indeed, YqeH overexpression did not compensate for growth defects occurring due to Era depletion and vice versa. The in vitro GTPase activities of these proteins were different, in which YqeH possessed an unexpectedly high intrinsic GTPase activity. Our findings strongly suggest that both YqeH and Era are involved in 30S subunit biogenesis, but play separate roles at distinct checkpoints during 30S assembly.
Diethyl pyrocarbonate (DEPC)-treated water was used to avoid potential RNA degradation throughout the experiment. DEPC and proteinase inhibitors, PMSF, aprotinin, leupeptin and pepstatin A, were purchased from Sigma-Aldrich, and the RNase inhibitor was from Takara Bio Inc. Proteinase and RNase inhibitors were added to the buffers for cell lysis, sucrose gradient density centrifugation and rRNA analyses at concentrations specified by the manufacturers. Association (20 mM Tris, pH 7.6, 8 mM MgCl2, 30 mM NH4Cl and 2 mM β-mercaptoethanol) and dissociation (20 mM Tris, pH 7.6, 1.5 mM MgCl2, 120 mM NH4Cl and 2 mM β-mercaptoethanol) buffers were used for ribosome profile analyses.
E. coli DH5α was used as the cloning host. B. subtilis CRK6000 (purA16 metB5 hisA3 guaB) was employed as the wild-type strain, and its derivatives (Morimoto et al., 2002), TMO309 (purA16 metB5 hisA3 guaB yqeH::tet aprE::Pspac-yqeH spec) and TMO101 (purA16 metB5 hisA3 guaB era::pTM101 [Pspac-era erm]) were depleted of YqeH and Era, respectively, when these strains were grown in the absence of inducer, isopropyl-beta-D-thiogalactopyranoside (IPTG).
Glycerol stocks of TMO309 and TMO101 were streaked on Penassay Antibiotic medium 3 (PAB) agar supplemented with 50 μM and 100 μM IPTG, respectively, displayed a similar doubling time to the wild-type strain. Colonies cultured overnight of TMO309 were inoculated into two 300 ml aliquots of fresh PAB medium supplemented with 0 and 20 μM IPTG at OD600 of 0.01. Cells were grown at 37°C with agitation until OD600 of 0.3 (Fig. 1) or 0.5 (Fig. 2). Wild-type B. subtilis was used as the control. The cells were harvested by centrifugation at 11,900 × g for 5 min. at 4°C. Cell pellets were washed with chilled 10 ml association buffer, resuspended in 4 ml of the same buffer, and subjected to three passages through a French pressure cell (8000 psi). After the removal of cell debris, an aliquot of supernatant equivalent to 18 A260 units was layered over 12 ml of 10–50% sucrose gradient. The gradient was centrifuged at 192,100 × g at 4°C for 4.5 h. Ribosome profiles in the gradients were examined by monitoring absorbance at 254 nm (BioComp Gradient Station with ATTO UV monitor AC-5200). The relative ratio of free 30S to 50S under dissociation condition was calculated from areas under the absorbance tracing of the respective ribosomal subunit peaks.
 View Details | Fig. 1. The ribosome profile is perturbed in YqeH-depleted cells. (A) The ribosome profiles of Pspac-yqeH cells (TMO309) in the presence and absence of IPTG were compared to those of wild-type cells. Cells were grown at 37°C, and harvested at OD600 of 0.3. An equal amount of 18 A260 units of crude cell extract was layered over the 10–50% sucrose gradient under association conditions, and centrifuged at 66,800 × g for 14 h. Ribosome profiles in the gradients were examined by monitoring absorbance at 254 nm. (B) Western blotting of the whole cell protein in cells. Equal amount (20 μg each) of proteins were loaded for SDS-PAGE, transferred to nitrocellulose membranes, and probed with anti-YqeH antibody to detect the protein expression. |
Proteins were separated by SDS-PAGE, and transferred to a polyvinylidene fluoride (PVDF) membrane (Amersham Bioscience). The following antibody dilutions were used: anti-YqeH, 1:7000 (Morimoto et al. 2002), and anti-rabbit IgG-HRP conjugated secondary antibody, 1:7000 (BioRad 170-6515). Chemiluminescent signals (ECL kit, Amersham) were detected using X-ray film (Fuji Film, Japan).
B. subtilis CRK6000 and TMO309 cells were grown in PAB liquid medium at 37°C, in the absence of IPTG. Cells were lysed as described in ribosome profile analyses. Total rRNA was extracted using Isogen reagent (Nippon Gene), following the manufacturer’s instructions. The RNA concentration was quantified with a UV spectrometer at an absorbance of 260 nm. Total rRNA (1 μg) from wild-type and TMO309 cells was resolved on a 1.0% agarose gel in 1x MOPS buffer with 2.5 M formaldehyde at 120 V for 3 h. Separated RNA was transferred to a Hybond-N membrane (Amersham Biosciences) by capillary transfer in 10x SSC buffer for 12–18 h. RNA was fixed to the membrane by UV cross-linking (UV Stratalink, 1200 μ Joule), and the transfer efficiency confirmed by methylene blue staining.
RNA probes for Northern hybridization were transcribed in vitro with T7 RNA polymerase and a digoxigenin-labeled mix kit (Roche), according to the manufacturer’s instructions. Residual genomic DNA and oligonucleotides used to generate RNA were removed by incubation with DNase I (Amersham Biosciences). The oligonucleotides are listed in Table 1. The rRNA hybridization reactions were performed in high SDS hybridization buffer [0.75 M NaCl, 0.075 M sodium citrate; 50% formamide, 0.5 M sodium phosphate buffer, pH 7.2, 0.1% N-lauroylsarcosine, 7% SDS, and 2% blocking reagent (Roche)] at 68°C for 16–18 h, followed by two 15 min washes in 2x SSC at room temperature. The membrane was washed twice at 68°C with 0.1x SSC for 15 min, and rinsed for 5 min in wash buffer (100 mM maleic acid, 150 mM NaCl and 0.3% Tween 20). After incubation in 1% blocking reagent for 30 min, membranes were probed with a sheep anti-DIG alkaline phosphatase conjugate (1:10,000 dilution) for 1 h. Unbound antibody was removed by two 15 min washes with wash buffer. The membrane was equilibrated in detection buffer (100 mM Tris-HCl, pH 7.5, 100 mM NaCl, and 50 mM MgCl2) for 5 min, followed by incubation with chemiluminescent substrate CSPD ready-to-use (Roche). Hybridized bands were detected with X-ray film (Fuji Film) after 1–10 min exposure.
 View Details | Table 1. DNA oligonucleotides used to generate RNA probes for Northern blotting |
Invitrogen’s Gateway Technology was applied for the entire cloning, according to the manufacturer’s instructions. Full-length yqeH and era with the respective Shine-Dalgarno regions were individually cloned into the entry plasmid, pDONR201, generating pDONR-yqeH and pDONR-era, respectively, using the method as previously described (Ishikawa et al., 2006). The following primers were used for amplification: yqeH-F (AAAAAGCAGGCTCGTTCAGTGGGAGGAGTA- AGAA) and yqeH-R (AGAAAGCTGGGTCTTCTTAAATTAATGAACGCCG) for yqeH; and era-F (AAAAAGC- AGGCTCGGGCGCATTTTCATCGGAGGA) and era-R (AGAAAGCTGGGTCAGAGATTATATTCGTCCTC) for era. The underlined sequences depict the att sequence required for the recombination reaction. pNO41, a multicopy plasmid with a constitutively active promoter (Ogasawara et al., 1984), was converted to a Gateway destination vector, pNO41GW, by ligating a HindIII and BglII digested cassette containing attR sites flanking the ccdB gene (Invitrogen) into the vector pre-digested with HindIII and BamH1. LR recombination between the entry clones, pDONR-yqeH or pDONR-era, and the destination vector, pNO41GW, led to the generation of pNO41GW-yqeH and pNO41GW-era, respectively.
B. subtilis YqeH-His and Era-His proteins were overexpressed from E. coli BL21, and purified as previously described (Morimoto et al., 2002). Protein concentrations were determined with the Bradford method using a BSA standard curve. 30S ribosomal subunit from B. subtilis wild-type cells was prepared by differential ultracentrifugation, in which the free 30S subunit was isolated via dissociation of 70S ribosome under low Mg2+ condition, as described in a previous report (Matsuo et al., 2006). GTPase activity was measured at 30°C using the method of Welsh et al. (1994), with slight modifications. 0.7 μM purified protein (70 pmol) was incubated with 40 μM GTP (4000 pmol) mixed with 0.12 pmol (0.72 μCi equivalent) of radioactive-labeled [γ-32P]GTP (6000 Ci/mmol; Perkin Elmer), in the presence and absence of 0.2 μM 30S subunit (20 pmol). The reaction mixture (100 μl) contained 50 mM Tris, pH 8.0, 8 mM MgCl2, 160 mM KCl, 0.1 mM EDTA, 10% glycerol and 100 μg/ml BSA, and the enzymatic reaction was triggered by the addition of GTP. At the indicated times, 20 µl aliquots were removed and quenched with 100 μl of 6% active charcoal slurry in 50 mM KH2PO4, pH 7.5. Samples were mixed well, and the charcoal was pelleted by centrifugation. Free Pi released in the supernatant was measured with Cerenkov counting, whereas GTP and GDP molecules selectively bound to the charcoal. To obtain the kinetic rate constant, kcat, for each protein, the GTPase activities at five different GTP concentrations (ranging from 1–40 μM) were measured, and kcat values derived from the Lineweaver-Burk plots.
We initially examined the ribosome profiles of YqeH-depleted cells using TMO309 in which yqeH is under control of the spac promoter (Morimoto et al., 2002). Cells were grown in PAB medium alone or supplemented with IPTG, and the respective crude cell lysates were separated by sucrose density gradient centrifugation under high Mg2+ conditions to maintain the 70S ribosome (Fig. 1A). The growth doubling time of TMO309 cells in the presence of 20 μM IPTG (35 min) was comparable to that of wild-type cells (30 min). Moreover, the distribution patterns of free 30S and 50S subunits, and the 70S ribosome were similar to those in wild-type cells. However, in the absence of the inducer, IPTG, the growth rate was reduced (doubling time, 48 min), and we observed a reduction in the 70S ribosome and 50S subunits, indicating that depletion of YqeH results in perturbation of the ribosome profile, similar to other members of the Obg/Era family.
The yqeH gene has been classified as ‘essential’ due to the inability of the IPTG-dependent Pspac-yqeH mutant to grow on PAB agar in the absence of IPTG (Morimoto et al., 2002; also see Fig. 4A). However, in our experiments, the Pspac-yqeH mutant grew in PAB liquid medium with no IPTG supplementation, albeit at an impaired rate, although YqeH was not detectable by Western blotting (Fig. 1B). This difference may be attributed to variations in growth conditions, such as agitation and aeration. It is possible that in addition to 30S subunit assembly, YqeH has other essential cellular functions yet to be identified, which is required for growth on solid media.
Increased accumulation of the free 50S subunit was not accompanied by a corresponding increase in the free 30S subunit in YqeH-depleted cells. To explain this finding, we analyzed the ribosome profiles under high (association) and low (dissociation) Mg2+ conditions. The association buffer favors formation of the 70S ribosome, where the predominant 70S ribosome may reflect the actual ribosome profile in a cell. In contrast, the dissociation buffer induces the 70S ribosome to separate into free 50S and 30S, thus enabling quantification of the total subunit amounts. The IPTG-dependent Pspac-era mutant (Morimoto et al., 2002) was additionally used for comparison, since the Era ortholog in E. coli is implicated in 30S subunit assembly (Sayed et al., 1999; Inoue et al., 2003; Inoue et al., 2006).
As shown in Fig. 2A, cell growth was more severely impaired in Era-depleted cells (doubling time of 87 min), compared to YqeH-depleted cells (doubling time of 48 min). The data support a more critical role of Era, which is widely conserved in bacteria, compared to YqeH that is mainly restricted to low-GC gram-positive bacteria. The ribosome profiles of wild-type and Era- or YqeH-depleted cells were compared with equal amounts of crude cell extracts. In association buffer (Fig. 2B), YqeH-depleted cells displayed a decrease in the 70S ribosome and accumulation of the free 50S subunit, but a similar peak representing the free 30S subunit, compared to wild-type cells. In contrast, Era depletion resulted in the accumulation of both free 50S and 30S subunits, and reduction in the 70S ribosome level. Replicate results consistently revealed a slight sedimentation shift of the 30S peak in Era-depleted cells. Under dissociation conditions (Fig. 2C), the peaks representing 30S and 50S levels were similar in Era-depleted and wild-type cells. On the other hand, consistent with the low level of free 30S in YqeH-depleted cells under association condition, the 30S subunit peak was obviously lower than those of wild-type and Era-depleted cells, although the reduction, about 30%, was apparently milder than that expected from the ratio of the 50S peak (free subunits) and the 70S peak (mature subunits) under association condition. This inconsistency would be, at least partly, due to mature 30S subunits in polysome fractions not clearly visible in our centrifugation under association condition. These results indicate that the rate of 30S biogenesis is reduced, compared to that of 50S, and/or the free 30S subunit is specifically destabilized in YqeH-depleted cells.
 View Details | Fig. 2. YqeH depletion results in accumulation of free 50S, but not free 30S subunit. (A) Growth curves of B. subtilis wild-type (■), Pspac-yqeH (□) and Pspac-era (▲) cells in PAB liquid medium without IPTG supplementation. Ribosome profiles of YqeH-depleted cells (depicted in black), compared to wild-type CRK6000 (depicted in gray) and Era-depleted cells (depicted in dots) in association (B) and (C) dissociation buffers. Cells were harvested at OD600 of 0.5. An equal amount of 18 A260 units of crude cell extract was applied for comparison. |
Next, to gain an insight into the mechanism of reduction of the free 30S subunit in YqeH-depleted cells, rRNA was analyzed by Northern blotting. Following hybridization of total RNA with a probe complementary to mature 16S rRNA (Probe 1, Fig. 3A and Fig. 3B), we observed a decrease in mature 16S rRNA and accumulation of pre-16S rRNA in exponentially growing cells. As schematically presented in Fig. 3A, the pre-16S rRNA is cleaved by endoribonuclease RNase III to yield 17S rRNA. The final maturation of 16S rRNA involves the removal of 76 and 67 nucleotides from the 5’ and 3’ ends, respectively. In B. subtilis, the former process involves endoribonuclease RNase J1 (YkqC), but the corresponding RNases for the latter are currently unknown (Britton et al., 2007). Hybridization using probes 2 and 3, designed to specifically bind to the unprocessed 5’ and 3’ ends of pre-16S, respectively, confirmed the presence of unprocessed 16S rRNA in YqeH-depleted cells (Fig. 3B). Maturation of 16S rRNA is believed to occur after association of the 30S and 50S subunits (Srivastava and Schlessinger, 1990). Accumulation of 17S rRNA due to impairment of 30S or 50S subunit biogenesis has been reported in E. coli cells depleted or inactivated for Era (Inoue et al., 2003), ObgE (Sato et al., 2005; Jiang et al., 2006), and Der, a YphC ortholog in E. coli (Hwang and Inouye, 2006). Thus, 17S rRNA accumulation in YqeH-depleted cells supports the involvement of this protein in 30S subunit biogenesis. In addition, we observed bands resulting from the degradation of premature and/or mature 16S rRNA in YqeH-depleted cells, suggestive of 30S degradation. Interestingly, premature 16S rRNA and degraded products were not detected in stationary phase cells (OD600 of 1.0) in which ribosome biogenesis activity is suppressed. Taken together, our results suggest that YqeH participates in the assembly of nascent 30S particles, and plays a minor role, if any, in recycling of the 30S subunit after the completion of translation.
 View Details | Fig. 3. Accumulation of 16S rRNA precursor and degradation products in YqeH-depleted cells. (A) Schematic representation of pre-16S rRNA processing in B. subtilis. The positions of digoxigenin-labeled RNA probes used in Northern blotting are shown as solid bars. (B) Northern blotting of total rRNA (1 μg each) from wild-type and YqeH-depleted cells at the designated OD600. The positions of mature 16S rRNA, precursors of 16S (pre-16S), and degraded 16S rRNA are indicated. |
In view of the finding that both YqeH and Era are involved in 30S subunit assembly, we were prompted to investigate whether the functions of Era overlap with those of YqeH. We cloned yqeH and era into a multicopy pNO41GW vector with a constitutively expressed promoter, and the resulting plasmids were individually transformed into Pspac-yqeH or Pspac-era cells. Cells were grown in PAB agar in the absence and presence of IPTG. However, overexpression of Era could not compensate for growth inhibition due to YqeH depletion, and vice versa (Fig. 4A). Moreover, the slower growth rate in PAB liquid medium due to depletion of YqeH or Era was not recovered upon overexpression of the other (data not shown).
 View Details | Fig. 4. YqeH and Era possess non-redundant functions and distinct GTPase properties. (A) Growth properties of Pspac-yqeH (pNO41GW), Pspac-yqeH (pNO41GW-yqeH), Pspac-yqeH (pNO41GW-era), Pspac-era (pNO41GW), Pspac-era (pNO41GW-era), and Pspac-era (pNO41GW-yqeH) cells on a PAB agar plate in the presence and absence of IPTG. Photographs were taken after incubation at 30°C for 26 h. (B) The GTPase activities of YqeH (□) and Era (△) alone, or upon the addition of purified 30S ribosomal subunit, YqeH with 30S subunit (■), Era with 30S subunit (▲), and 30S subunit alone (×). The GTPase activities of B. subtilis YqeH and Era (0.7 μM each) or in the presence of 0.2 μM 30S ribosomal subunit were measured at 30°C, sampling at the indicated times. The amount of free Pi released from the hydrolysis of 40 μM [γ-32P]GTP was quantified using Cerenkov counting. Representative results of experiments performed in triplicate are shown. |
In addition, we compared the in vitro GTPase activities of YqeH and Era. Proteins were fused with the His tag at the C-terminus, overexpressed from E. coli BL21, and purified (Morimoto et al., 2002). We confirmed that the His tag had no effect on B. subtilis growth, and did not interfere with the biological function of the protein (data not shown). In vitro biochemical characterization of YqeH and Era revealed that the proteins possess different intrinsic GTPase activities (Fig. 4B). The catalytic constant, kcat, of Era derived from Lineweaver-Burk plots was 0.039 min–1, comparable to those reported for B. subtilis Obg (0.021 min–1, data not shown) and Caulobacter crescentus Obg (0.030 min–1, Lin et al., 1999). Unexpectedly, YqeH possessed high intrinsic GTPase activity (kcat = 0.934 min–1), which distinguished from other members of the Obg/Era family (data not shown). Earlier, we reported that the 50S ribosomal subunit acts as a GTPase-activating protein (GAP) that stimulates the GTPase activity of YlqF (Matsuo et al., 2006). Since the functions of YqeH and Era are implicated in assembly of the 30S ribosomal subunit, the GTPase activities of the proteins were further analyzed in the presence of 30S subunit. The 30S subunit alone had no detectable GTPase activity. We found that the GTPase activity of Era was enhanced by more than 10 fold upon addition of 30S subunit, but the GTPase activity of YqeH remained unaffected.
Initial in vitro ribosome reconstitution in E. coli is achieved by incubating mature 16S rRNA and a mixture of 30S ribosomal proteins (Traub and Nomura, 1968). However, the reaction requires high concentrations of salt and Mg2+, and a temperature of 40°C, which are non-physiological conditions. Thus, the observed self-assembly in vitro does not preclude the existence of non-ribosomal factors that play a fundamental role in ribosomal subunit assembly and maturation in vivo (Dammel and Noller, 1995; Bylund et al., 1998; Inoue et al., 2003). Several studies confirm that bacterial GTP-binding proteins of the Obg/Era family participate in the late stages of 30S or 50S subunit assembly (Sato et al., 2005; Sharma et al., 2005, Uicker et al., 2006; Jiang et al., 2006; Matsuo et al., 2006; Schaefer et al., 2006). Here we present results demonstrating that YqeH, a member of the Obg/Era family, plays an important role in 30S subunit biogenesis.
A stable precursor of 30S with slightly reduced molecular mass accumulated in Era-depleted cells in B. subtilis, consistent with the theory that this protein is involved in final maturation of the 30S subunit (Sharma et al., 2005). In contrast, no accumulation of free 30S was observed in YqeH-depleted cells, despite a reduction in 70S ribosome, accompanied by an increase in the free 50S subunit level, strongly suggesting that YqeH is involved in 30S subunit assembly, in a different way from that of Era. In addition, we detected degradation products of 16S rRNA in YqeH-depleted cells in parallel with accumulation of 17S rRNA. Thus, depletion of YqeH appears to result in both retardation of 30S assembly and destabilization of the premature 30S subunit. During biogenesis of the 30S subunit, pre-16S rRNA interacts with ribosomal proteins and non-ribosomal factors to form pre-ribosomal intermediates (Gulli et al., 1995). In YqeH-depleted cells, a proportion of the newly synthesized 30S intermediates may be impaired, thus rendering the pre-16S rRNA more susceptible to RNase degradation. YqeH may act as a RNA chaperon and restores the impaired rRNA structure to its proper conformation. The final maturation of 16S rRNA possibly occurs in the context of the 70S ribosome (Srivastava and Schlessinger, 1990), and is altered when a stable pre-ribosomal particle is unable to form (Nierhaus, 1991; Li et al., 1999; Kaczanowska and Ryden-Aulin, 2004). While we cannot rule out the possibility that accumulation of pre-16S rRNA in YqeH-depleted cells is a direct consequence of YqeH depletion, it is more conceivable that the sequential assembly of ribosomal proteins to form 30S subunit is primarily affected, and thus, pre-16S rRNA accumulation is a secondary effect.
To establish the precise role of YqeH in 30S subunit biogenesis, it is essential to determine when the protein is incorporated into the premature subunit and how it reforms the structure of the subunit. However, we have not yet succeeded in detecting direct interactions between YqeH and the premature or mature 30S subunit in vivo. In vitro GTPase analyses showed that YqeH exhibits high intrinsic GTPase activity relatively to other members of Obg/Era family, and remains unaffected by the addition of 70S ribosome (data not shown) or 30S subunit. Thus, identification of regulatory factor(s) that modulate the GTPase activity of YqeH should facilitate our understanding of the specific functions of YqeH. In contrast, the GTPase activity of Era was stimulated by the 30S ribosomal subunit. To the best of our knowledge, B. subtilis Era is the second GTPase that its activity is enhanced by the 30S subunit, after E. coli YjeQ (Himeno et al., 2004; Daigle et al., 2004).
In C. crescentus, a temperature-sensitive mutant of Obg with a defect in 50S subunit assembly or stability was isolated. The defect occurred at both the permissive and restrictive temperatures, suggesting that this is not the essential function of Obg (Datta et al., 2004). Recent studies show that Vibrio cholera Obg is dispensable in a relA deletion mutant and essentially acts as a repressor of the stringent response by regulating SpoT activity to maintain low ppGpp levels when bacteria grow in nutrient-rich conditions (Raskin et al., 2007). B. subtilis yqeH is classified as an essential gene due to the inability of the IPTG-dependent Pspac-yqeH mutant to grow on LB or PAB agar plates in the absence of IPTG. However, in our experiments, the Pspac-yqeH mutant grew in the PAB liquid medium without IPTG supplementation, albeit at an impaired rate. This finding raises the interesting possibility that YqeH functions not only in ribosomal assembly, but has other essential cellular roles to maintain effective growth on solid media.
We thank Dr. Kosei Tanaka for constructing the pNO41GW vector. This work was supported by KAKENHI (Grant-in-Aid for Scientific Research) on Priority Areas “Systems Genomics” from the Ministry of Education, Culture, Sports, Science and Technology of Japan, and a Grant-in-Aid for Scientific Research (A), 17201040, from Japan Society for Promotion of Sciences.
|
Index