| Edited by Toshihiko Shiroishi. Qiong Wu: Corresponding author. E-mail: kigo-hit@163.com |
Imprinted genes are preferentially expressed from either the maternally inherited or the paternally inherited alleles, and involved in a myriad of processes including fetal, placental, and neurological development (Lim and Maher, 2010). At present, more than 61 imprinted genes have been identified in human and 102 in mouse, but only 16 in sheep, 15 in cattle and 17 in pigs (http://igc.otago.ac.nz/home.html). In order to increase our understanding how different mammalian species are regulated by imprinting, it is important to identify and characterize more imprinted genes in pigs. We have previously described the maternally expressed gene DLX5 and paternally expressed genes PLAGL1, PEG10, NNAT and DIRAS3 in pigs (Cheng et al., 2007, 2008; Zhang et al., 2007). As part of an effort to study the conservation of imprinted genes among mammalian species, the aim of the present work was to investigate the imprinting status of porcine PEG3 (paternally expressed gene 3), NAP1L5 (nucleosome assembly protein 1-like 5) and PPP1R9A (protein phosphatase 1, regulatory subunit 9A) genes.
The Nap1l5 and Ppp1r9a are located on a large imprinted gene cluster on mouse proximal chromosome 6 (http://www.mousebook.org/imprinting/chr6.html). The function of NAP1L5 is not known, but its protein shows homology to nucleosome assembly proteins (NAPs) which are involved in cell cycle regulation (Loyola and Almouzni, 2004). The NAP1L5 is paternally expressed in many fetal tissues in human, mouse and cattle (Smith et al., 2003; Zaitoun and Khatib, 2006; Wood et al., 2007). The PPP1R9A encodes neurabin I which is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization (Oliver et al., 2002). It is reported that PPP1R9A was preferentially maternally expressed in embryonic muscle and placenta in human and mouse (Ono et al., 2003; Nakabayashi et al., 2004). The PEG3 encodes an unusual Krüppel-type zinc finger protein implicated in the cell growth, apoptosis, and maternal nurturing behavior (Li et al., 1999; Relaix et al., 2000). The gene is paternally expressed in human (19q13), mouse (7A2-B1), sheep and cattle (Kuroiwa et al., 1996; Murphy et al., 2001; Kim et al., 2004; Thurston et al., 2008).
In this study, we determined the imprinting status of the porcine PEG3, NAP1L5 and PPP1R9A genes by sequencing directly at the genomic DNA (gDNA) and the first-strand complementary DNA (cDNA) levels in heterozygous pigs based on the SNP sites, and our results provided the direct evidence of imprinting or non-imprinting of the 3 genes.
All animals in this study were derived from the Experimental Pig Station of Huazhong Agricultural University. Reciprocal crosses were generated from natural mating of purebred Meishan (Ms) with purebred Large White (LW) pigs. Six 2-month-old piglets (4 females and 2 male) generated from the LW boars × Ms sows (LW × Ms) and 6 pigs from the Ms boars × LW sows (Ms × LW) and their 4 dams (2 Ms and 2 LW) were used for imprinting analysis of the candidate imprinted genes. The gDNA was extracted from all experimental animals according to the standard phenol-chloroform method.
Total RNA from 13 tissues including heart, liver, spleen, lung, kidney, stomach, small intestine, skeletal muscle, fat, uterus, ovary, testicle, and pituitary gland of the 12 F1 hybrid piglets and their dams were isolated with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The RNA samples were treated using Amplification Grade DNase I (TaKaRa, Tokyo, Japan) at room temperature for 60 min. First strand cDNA was synthesised from 2 μg total RNA in a 20 μL reaction volume containing 1 × M-MLV first-strand buffer, 1 mM each dNTP, 5 μM oligo (dT)18 primer, 8 U RNase inhibitor and 40 U M-MLV (Promega, Madison, WI, USA) at 42°C for 60 min.
Primers used to amplify the PEG3, NAP1L5, and PPP1R9A (Table 1) genes were designed using sequence obtained by performing BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) searches of the human PEG3 (NM_006210), NAP1L5 (NM_153757) and PPP1R9A (NM_017650) cDNA sequences against porcine expressed sequence tag (EST) libraries in GenBank. PCR were performed in a 20-μL volume containing 50 ng of porcine cDNA or gDNA, 1 × PCR buffer, 0.2 μM of each primer, 150 μM of each dNTP, 1.5 mM MgCl2 and 1 U of Taq DNA polymerase (TaKaRa). The PCR conditions were as follows: 94°C for 4 min, 35 cycles of 94°C for 45 s, annealing at optimal temperature, 72°C for 1 min and a final extension at 72°C for 7 min. Primers (forward: ACCACAGTCCATGCCATCAC and reverse: TCCACCACCCTGTTGCTGTA), which amplify a fragment spanning intron 8 of the GAPDH gene, were applied to exclude the possibility of DNA contamination during all RT-PCR reactions.
 View Details | Table 1 Primer sequences, SNP information and sequences similarity of the 6 porcine genes |
The sizes of PCR and RT-PCR products obtained from the 13 tissues were estimated on a 1% agarose gel. The products were purified from the PCR solution using the Wizard prep PCR purification system (Promega). Sequencing reactions of PCR and RT-PCR products were carried out using ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, CA, USA) with the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). Sequencing primers are listed in Table 1. Data were analyzed using version 5.0 of Sequencing Analysis (Applied Biosystems). The SNPs were identified by visually inspecting each base in sequencing traces. The site was considered as polymorphisms if double peaks appeared in the sequence chromatogram.
All the primer pairs in Table 1 were used to amplify the transcript regions of the porcine PEG3, NAP1L5 and PPP1R9A genes at the gDNA and cDNA levels in independent Ms and LW pigs. A total of 2052 bp for PEG3, 1158 bp for NAP1L5, and 1946 bp for PPP1R9A gDNA/cDNA sequences (all the sequences were identical between gDNA and cDNA) were obtained and deposited in GenBank database (EF619475, EF619474 and EF619476). Comparing the gDNA sequences between Ms and LW pigs resulted in the identification of the A/G, G/A and G/T polymorphisms at position 603 bp, 777 bp and 1217 bp (according to the accession number) of the PEG3, NAP1L5 and PPP1R9A genes, respectively (Table 1). All the SNPs were used for imprinting analysis of the 3 candidate genes. Sequencing analysis showed that sequence similarity was higher between pigs and human than between pigs and mouse for all 3 candidate genes (Table 1).
The primer pairs PE1F/PE1R, NA1F/NA1R and PP2F/PP2R were used to detect the expression of the porcine PEG3, NAP1L5 and PPP1R9A genes in 13 tissues including skeletal muscle, fat, pituitary gland, heart, lung, liver, kidney, spleen, stomach, small intestine, uterus, ovary and testis by semi-quantitative RT-PCR, respectively. The results showed that NAP1L5 was expressed in all the 13 tissues, but no signals of expression were detected in skeletal muscle, fat and testis for PPP1R9A and in fat and small intestine for PEG3 (Fig. 1).
 View Details | Fig. 1 Expression patterns of the 3 porcine candidate genes in 13 tissues analyzed by RT-PCR. The samples were obtained from the cDNA pools of the 12 hybrid piglets. M represents DNA Marker DL2,000 (2,000, 1,000, 750, 500, 250 and 100 bp) (TaKaRa). |
In this study, the sequencing- and polymorphism-based methods were used to analyze the imprinting status of the 3 porcine candidate genes. At first, the PCR products amplified from gDNA samples of the 12 F1 piglets were sequenced directly to identify the heterozygous individuals which would display two peaks at SNP sites in a sequence chromatogram. Secondly, the cDNA obtained from various tissues of the heterozygous pigs and gDNA from the pigs’ dams were sequenced directly to analyze the imprinting status of the candidate genes. Monoallelically expressed genes would display only one peak, while biallelically expressed genes would display two peaks corresponding to two alleles of the SNP. The imprinting status of each candidate gene was determined by comparison to the maternal sequence.
A (A/G) SNP was detected at PEG3 locus in each hybrid piglets generated and sequencing reactions of RT-PCR products were carried out using primer PE1R in all the 13 tissues except fat and small intestine where the gene was not expressed. The paternally inherited PEG3 allele was detected, in the absence of the maternal allele, in sequence chromatograms obtained from all the tissues detected. These results showed that the porcine PEG3 gene is exclusively paternally expressed (Fig. 2A).
 View Details | Fig. 2 Imprinting analysis of the PEG3, NAP1L5 and PPP1R9A genes by sequencing directly. The arrows point to SNP sites. Sequence chromatograms of gDNA obtained from l the hybrid piglets demonstrate the presence of the A/G, G/A and G/T SNP at the PEG3 (A), NAP1L5 (B), and PPP1R9A (C) locus, respectively. Sequence chromatograms of cDNA obtained from all the tissues tested (some of them not shown) where the genes were expressed indicate that PEG3 and NAP1L5 were exclusively paternally expressed, whereas PPP1R9A was biallelically expressed. |
A G/A SNP at NAP1L5 locus was identified between LM and Ms pigs, but only 3 LW × Ms hybrids were heterozygous at the SNP site. RT-PCR products of all the 13 tissues obtained from the 3 LW × Ms hybrids were directly sequenced with primer NA1R and preferential expression of the paternal allele was detected for all samples in each animal. These results indicate that the porcine NAP1L5 gene is exclusively expressed from the paternal allele (Fig. 2B).
An informative SNP site, G/T, was found at PPP1R9A locus and all the 12 hybrid piglets were heterozygous at the SNP sites. Sequences generated by directly sequencing RT-PCR products amplified from all the 13 tissues except skeletal muscle, fat and testis where the gene was not expressed contained both the maternal and paternal alleles (Fig. 2C). These results demonstrate that PPP1R9A was biallelically expressed in all tissues tested.
Genomic imprinting is a parent-of-origin-dependent epigenetic mechanism, and imprinted genes are preferentially expressed from one parental allele. In mammals in particular, imprinted genes have an important effect in the regulation of fetal growth, development, function of the placenta, and postnatal behavior (Isles and Holland, 2005). In pigs, many imprinted quantitative trait locus (QTL) significantly affect growth, backfat thickness, carcass composition and reproduction (de Koning et al., 2000; Sato et al., 2006; Ding et al., 2009; Uemoto et al., 2009; Ruckert and Bennewitz, 2010). The IGF2 gene, which was identified as the first imprinted gene in pigs, has important effects on porcine growth, meat quality and carcass composition, especially on fat deposition (Estellé et al., 2005). Our previous study also showed that a polymorphism of the paternally expressed DLX5 gene had significant association with porcine fat deposition (Cheng et al., 2008). Therefore, it would be of interest to identification and characterization of more imprinted genes in pigs as sources of quantitative genetic variation (Khatib, 2004). Moreover, identifying additional imprinted genes in pigs is useful for comparative analysis of genomic imprinting across species due to a small number of reported imprinted genes in pigs.
In this study, a polymorphism-based approach and reciprocal crosses model were used to analyze the imprinting status of 3 porcine genes. Imprinting analysis showed that PEG3 and NAP1L5 were exclusively paternally expressed, whereas PPP1R9A was biallelically expressed. Recently, it was reported that the expression of porcine PEG3 and NAP1L5 were increased in biparental than parthenote samples in brain, liver, fibroblasts and placenta with microarray analysis. Concomitantly, the expression of PPP1R9A from biparental and parthenote samples were similar in the 4 same tissues by the semi-quantitative RT-PCR (Bischoff et al., 2009). These results indicated that PEG3 and NAP1L5 may be candidate paternally expressed but PPP1R9A biallelically expressed genes in pigs. However, our study provided the direct evidence of monoallelic and/or biallelica expression of these genes.
The PEG3 and NAP1L5 were exclusively paternally expressed in all tissues tested in pigs in our study. The imprinting status of the genes was consistent with that in human and mouse. For PPP1R9A, it is showed that the gene to be preferentially maternally expressed in embryonic skeletal muscle but biallelic expression in other embryonic tissues in human and mouse (Ono et al., 2003; Nakabayashi et al., 2004). In contrast, the porcine PPP1R9A was not expressed in skeletal muscle and biallelically expressed in other tissues obtained from twelve 2-month-old piglets. The differences of expression pattern in skeletal muscle among human, mouse and pigs might occur due to differences in developmental stages. Furthermore, some imprinted genes may be imprinted in a limited type of ocular cells at a certain developmental stage. Therefore, the imprinting analysis of these genes in other developmental stages, especially in embryo, is potentially important.
In summary, we have shown that PEG3 and NAP1L5 are paternally expressed, whereas PPP1R9A was biallelically expressed in pigs. The study may be useful for elucidating the conservation of imprinting among mammalian species and identifying causative factors of quantitative trait loci.
This study was supported by the Natural Scientific Research Innovation Foundation in Harbin Institute of Technology (No. GFQQ18400016), Heilongjiang Postdoctoral Sustentation Foundation (No. AUGA41100158) and National Natural Science Foundation of China (No. 30971645).
|
Index