Genes & Genetic Systems
Online ISSN : 1880-5779
Print ISSN : 1341-7568
ISSN-L : 1341-7568
Short communications
Development of microsatellite markers for the endangered sleeper Eleotris oxycephala (Perciformes: Eleotridae)
Uchu YamakawaShingo KanekoRyosuke ImaiLeanne Kay FaulksKoetsu KonDaisuke KyogokuYuji IsagiYoshiaki Tsuda
著者情報
ジャーナル オープンアクセス HTML

2019 年 94 巻 5 号 p. 219-224

詳細
ABSTRACT

The amphidromous sleeper Eleotris oxycephala (Perciformes: Eleotridae) is mainly distributed along the Kuroshio Current in East Asia, and this current is thought to be the main driver of the species’ dispersal. Due to anthropogenic environmental changes in rivers, E. oxycephala is ranked as a threatened or near-threatened species in the red lists of 12 prefectures in Japan. Moreover, there is concern that the species’ dispersal pattern could be changed due to fluctuations in the Kuroshio Current caused by global warming. In this study, 40 microsatellite markers were developed for E. oxycephala, and their suitability was tested on 43 individuals from two populations of E. oxycephala from Kanagawa and Miyazaki Prefectures. The number of alleles, expected heterozygosity and fixation index at each locus were 2–10 (mean = 5.350), 0.034–0.860 (mean = 0.650) and −0.261–0.448 (mean = 0.065), respectively. Furthermore, there was a lack of genetic difference between the two populations (FST = 0.008, F’ST = 0.024), indicating widespread gene flow via the Kuroshio Current. These markers will be useful to evaluate the genetic structure and infer population demographic history of E. oxycephala populations, which may assist in the conservation of this species.

MAIN

Amphidromous fish species, requiring freshwater and marine environments to complete their life history, have been adversely affected by recent environmental changes. Human alterations such as dam construction and stream modification (Ministry of Land, Infrastructure, Transport and Tourism, 2018 [http://www.mlit.go.jp/river/dam/pdf/H30dam.pdf]) are the main causes of the continued decrease in suitable habitat for aquatic organisms including amphidromous fishes (Katano et al., 2006). In addition to freshwater environmental changes, seawater temperature rise due to global warming is continuing (IPCC, 2013), and could alter the distribution of various aquatic organisms including amphidromous fishes, for example, Eleotris fusca (Forster, 1801) and Ophieleotris sp. 1 of Akihito et al., 2013 (Yamakawa et al., 2018). Furthermore, ocean current fluctuations are predicted to occur in the near future (Sakamoto et al., 2005; Chang et al., 2018), potentially altering the dispersal patterns of aquatic organisms that disperse using ocean currents (e.g., Anguilla japonica Temminck and Schlegel, 1847; Chang et al., 2018). This change in dispersal patterns could alter gene flow among populations, which is related to the maintenance of genetic diversity, and this in turn could disrupt reproductive patterns and local population adaptation. Indeed, patterns of gene flow and genetic diversity of many fishes, including amphidromous species, are influenced by dispersal via ocean currents (e.g., Watanabe et al., 2006; Shaddick et al., 2011; Kuriiwa et al., 2014). Moreover, since the impact of climate change on genetic diversity and structure of sea-dispersed mangrove plants has been highlighted (Wee et al., 2019), this could also be expected in amphidromous fishes that use ocean currents.

The sleeper E. oxycephala Temminck and Schlegel, 1845 (Perciformes: Eleotridae) is an amphidromous fish (Xia et al., 2015) that lays eggs in the downstream sections of rivers. The larvae then flow down to the sea and, after drifting on ocean currents, juveniles swim upstream and mature in rivers (Suguro and Senou, 2006). This species is mainly distributed along the Kuroshio Current in East Asia, including southern Japan, Korea, Taiwan, southeastern China and Vietnam (Oshima, 1919; Akihito, 1967; Kottelat, 2001; Kim et al., 2014; Meng et al., 2016), and larvae are thought to disperse and be strongly affected by the Kuroshio Current (Yamakawa and Senou, 2015; Mashiko, 2016). The habitat of E. oxycephala has deteriorated due to human alterations such as dam construction, shore protection and water pollution in rivers (Suguro and Senou, 2006; Mashiko, 2016). Thus, this species is ranked as threatened or near-threatened in the red lists of 12 prefectures in Japan (e.g., ‘Endangered’ in the Red List of Kanagawa Prefecture (Suguro and Senou, 2006)). In addition, the Kuroshio Current is predicted to undergo increases in flow speed and frequency of great meandering due to global warming (Sakamoto et al., 2005), and there is concern about the effects this will have on the dispersal patterns and associated genetic diversity of E. oxycephala populations. To support the conservation of E. oxycephala, it is important to examine population genetic diversity and structure, as well as population demographic history in relation to the Kuroshio Current. For these examinations, we developed, for the first time, 40 microsatellite markers for E. oxycephala and tested their suitability using 43 individuals from two populations of the species.

We collected fresh caudal fin and muscle tissue samples from three individuals of E. oxycephala collected in the Sagami River in Kanagawa Prefecture. Genomic DNA was extracted from these samples using the DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA). A DNA fragment library was constructed using the Ion Xpress Plus Fragment Library Kit (Thermo Fisher Scientific, Waltham, MA, USA), amplified using the Ion PGM Template OT2 400 Kit (Thermo Fisher Scientific), and subsequently sequenced using the Ion PGM Sequencing 400 Kit (Thermo Fisher Scientific) and an Ion 318 Chip v2 (Thermo Fisher Scientific) with the next-generation sequencer Ion PGM (Thermo Fisher Scientific). The total number of reads obtained was 676,672. To identify microsatellite regions that contain more than seven di-, tri- or tetranucleotide repeats, we screened the reads using QDD (Meglécz et al., 2010, 2014) on the Galaxy (Afgan et al., 2018) virtual machine and Primer3 version 4.0.0 with default settings (Rozen and Skaletsky, 2000). A total of 127 primer pairs were designed.

Preliminary amplification tests for all 127 primer pairs were conducted using eight individuals from the following four populations of E. oxycephala in Japan: Sagami River in Kanagawa Prefecture, Shirutani River in the Miya River system in Mie Prefecture, Kuma River in the Kokubu River system in Kochi Prefecture, and Sarugase River in the Hitotsuse River system in Miyazaki Prefecture. PCR amplification with fluorescently labeled primers (Table 1) was performed following the method of Blacket et al. (2012) using the Qiagen Multiplex PCR Kit (Qiagen). Each reaction contained 10 ng of extracted DNA, 2.5 μl of Multiplex PCR Master Mix, 0.01 μM fluorescently labeled forward primer, and 0.2 μM fluorescently labeled universal primer and reverse primer in a final volume of 5.0 μl. The amplification process consisted of an initial denaturation at 95 ℃ for 15 min; 31 cycles of denaturation at 94 ℃ for 30 s, annealing at 57 ℃ for 90 s and extension at 72 ℃ for 1 min; and a final extension at 60 ℃ for 30 min. Fragment sizes were determined using an ABI PRISM 3130 Genetic Analyzer and Gene Mapper software (Applied Biosystems, Foster City, CA, USA) with GeneScan 600 LIZ dye Size Standard v2.0 (Applied Biosystems). Seven sets of multiplex PCR primer pairs (two to eight primer pairs per multiplex panel A–G) were designed for 40 selected loci (described below) (Table 1).

Table 1. Characteristics of 40 microsatellite primers developed for Eleotris oxycephala
LocusMultiplex
panel
Primer sequences (5′-3′)Repeat
motif
Ta (℃)Fluorescent
labela
Size range
(bp)
GenBank
accession no.
Eoxy002EF: GCCAGCTCCAACACGTTTAT(ATC)1257PET179–209LC462952
R: AACAGGGCAGTGTTTCATCC
Eoxy008FF: ACAGCTGCACCACACTCAAC(GT)957FAM109–113LC462953
R: ACGCAGGGCTTTACTTTACG
Eoxy009FF: TTTGCCAACTGGCTGTGTTA(AC)957NED154–160LC462954
R: GATCAAACGCTGGAGAAGGA
Eoxy010CF: GGATTGAGCCAGATGATGGT(TG)857VIC179–185LC462955
R: CATTTCCGTGTATCCAACCC
Eoxy013FF: GGCACCCAGTGGAGACTTTA(AT)857PET129–159LC462956
R: CTTGCTGAAAGATGAGCGTG
Eoxy015EF: GACAGACGCTCTGATCCCAT(AG)857VIC118–123LC462957
R: CCGGTCTTTGAGAACCTCTG
Eoxy016DF: CTCTGATTGGAGGAGACGGA(AG)857PET230–232LC462958
R: ATACCCAACATCCCAAACCA
Eoxy025BF: TGCTGACCTGCTGTTCATGT(AGG)757NED113–128LC462959
R: CCTCTCGACGTCTTCACTCC
Eoxy027BF: CAGGAAGCAGGTGGTTTGTT(AGG)757PET140–149LC462960
R: CCATTTCTCATCGCTCGTCT
Eoxy029FF: CATGAGCCGTCTTTGTTTCA(AC)757FAM180–194LC462961
R: GGGCTCTCGTAATGGGAAGT
Eoxy031FF: GAGGCAGTGAGAAATGGGTC(AT)757PET238–248LC462962
R: GACATGCCTGAACGAAACAA
Eoxy101CF: CTGTATTCCATCGGAGAGGG(CA)957VIC95–109LC462963
R: CTACTCGCACCTGTGTCGTC
Eoxy104BF: GGCGTCTGTGTACGACGTG(CCT)857VIC93–105LC462964
R: TGCAGCGGTAGTGATGAGTC
Eoxy116EF: GTGGCTCGACAGGTGAGAG(AGG)857PET98–110LC462965
R: CACAAACGTCAAATCCCTTG
Eoxy120DF: CTCTGTGGCGATAACAGCCT(AC)957FAM101–115LC462966
R: ACATCCTCAGCTCCGAAAGG
Eoxy123BF: TCAGGTCAGCAACATCATCA(GT)857FAM102–108LC462967
R: CCTGTGGAATCACTGCTGAA
Eoxy124EF: ACAAGGGAGGGTCATTTGAG(GT)957NED107–117LC462968
R: AGTTGCCATCCTTGTCCAAA
Eoxy131DF: TTCCGGTATTTATGTTTGCAC(ATT)1057VIC104–116LC462969
R: TGTGGCACAGTTGACAGGTT
Eoxy135AF: GAGTTGCGGAGACAGATTGC(TC)957NED112–122LC462970
R: GGTTGATCAGAGCTCGCAC
Eoxy136DF: TCTAACCACTGGTGCCATTT(CT)957PET120–124LC462971
R: CAGACGAGGATGAGAACATGC
Eoxy139AF: TGCGTTCAGAGCTGCATTAT(AC)1157VIC110–120LC462972
R: CTCTAAGGCTTTAGCTCTGTGG
Eoxy141FF: CTACAGACCGAAGCACTGGG(AG)957VIC116–124LC462973
R: CCAGTCCAGACTTTCCTTCCT
Eoxy145CF: GTTCACCATTTATCCATGCG(AC)1057PET122–137LC462974
R: TGTGGCTGGAGAGTCTGACA
Eoxy155GF: TTTGTCCCACGTGACTCG(GT)1057NED160–188LC462975
R: CATCCTGCTGGTAGCACTGA
Eoxy156GF: GCACAACACAATGTTACAGCG(AAG)857PET148–189LC462976
R: TTCCTGATGGCTTCCTGTCT
Eoxy157BF: ATGCTTCACCTCCACAGAGC(GT)957VIC171–193LC462977
R: AAGCCCAAATGGATTCTTCC
Eoxy158CF: CGGGAGATAGCGGTGTCTTA(GT)957NED182–198LC462978
R: CCACTGCTTGTATGTCTGCC
Eoxy165DF: AAGTCTCCGGGTCATACTGC(GT)957FAM187–195LC462979
R: CCCAACTCAGAGACGACACA
Eoxy168EF: TGAGATGACTCAGTGCCACC(AC)857FAM181–191LC462980
R: TTTCACTCTCATCATCCACCA
Eoxy169EF: TTTAGCGTAATGGTCAGCCC(AAT)957NED189–201LC462981
R: AATTGCACTTTACAGCACTTTG
Eoxy172BF: CGTCTCTGAGAACACAGGCA(AG)1057FAM182–194LC462982
R: GGGAGTATACCTGTAAACCGGG
Eoxy173DF: AGCGATGGTCAGAAGGAGC(CA)1157NED203–219LC462983
R: GGTTTGGCAAATTTGTGAGG
Eoxy179DF: GGACGATGACTTTGTGTTCG(AC)1257VIC201–211LC462984
R: GCTTCAGGATTCTCACGAGG
Eoxy180AF: GACTTCTCATTCTGCCCTGC(CA)1157NED214–230LC462985
R: GGTTGACAGGGCTCGCTAT
Eoxy182BF: CCGAGAACATCTGCTGTAGTTT(TC)957NED213–221LC462986
R: GTCCTGCCGGGAATTTGT
Eoxy186AF: CAGTTGAGGGTGAATGAGGG(AC)857VIC214–224LC462987
R: ATCCTGGCTCTCCGTCTGT
Eoxy189FF: GCCTCAGACCCAAAGCAG(AGC)1157VIC208–231LC462988
R: AGTTCACTGTCGGCAGGTTT
Eoxy192FF: AATGATTATCTAATGGTGATGATGG(GAT)857NED239–266LC462989
R: TGTGAGCCTATTCCCACAAGT
Eoxy194CF: TCATTTATCAACACGGAGCA(AC)957FAM251–264LC462990
R: TCCGCCTGATCATAGTAATCG
Eoxy196BF: AACCAGGCTCTGACATCACC(AG)1457FAM261–278LC462991
R: CTTGAGCCATGAAGGAATGG

Ta, Annealing temperature; a Sequences of fluorescent labels: FAM = 5′-GCCTCCCTCGCGCCA-3′, VIC = 5′-GCCTTGCCAGCCCGC-3′, NED = 5′-CAGGACCAGGCTACCGTG-3′, PET = 5′-CGGAGAGCCGAGAGGTG-3′.

The genetic variation of the 40 selected loci (see below) was evaluated using 43 individuals from two populations of E. oxycephala in Japan: 29 individuals collected in Sagami River (35°21′–35°22′ N/139°22′ E) in Kanagawa Prefecture and 14 individuals collected in Sarugase River in the Hitotsuse River system (32°03′ N/131°27′ E) in Miyazaki Prefecture. For each population, the number of alleles (A), expected heterozygosity (HE) and fixation index (FIS) were calculated at each locus using FSTAT version 2.9.3 (Goudet, 1995). Deviations from Hardy–Weinberg equilibrium, as evidenced by FIS deviations from zero, and genotype disequilibrium among the 40 loci based on 1,000 randomizations were tested using FSTAT version 2.9.3. In addition, genetic differentiation between the two populations was evaluated by calculating FST (Weir and Cockerham, 1984) and its standardized value, F’ST, which always ranges from 0 to 1 (Meirmans and Hedrick, 2011), using GenAlEx version 6.5 (Peakall and Smouse, 2012). The significance of the FST value was tested by 999 permutations using GenAlEx.

Of the 127 primer pairs in the preliminary test, 40 yielded clear peak patterns based on eight individuals. All 40 of these primer pairs were then successfully amplified in all 43 individuals from two populations of E. oxycephala (Table 1). The range of A was 2–10 (mean = 5.350), indicating that all loci were polymorphic in both populations (Table 2). The ranges of HE and FIS per locus were 0.034–0.860 (mean = 0.650) and −0.261–0.448 (mean = 0.065), respectively (Table 2). Significant deviation of FIS values from zero was observed for only one locus, Eoxy192, in the Sagami River population (P < 0.05 after Bonferroni correction, Table 2), probably due to a high frequency of null alleles. Significant genotype disequilibrium among the loci was not observed (P > 0.05 after Bonferroni correction). Although significant (P < 0.05), FST and F’ST values between the two populations were 0.008 and 0.024, respectively, suggesting very low genetic differentiation even though the geographic distance between the two populations was more than 800 km. This indicated that E. oxycephala experiences widespread gene flow due to long-distance dispersal via the Kuroshio Current.

Table 2. Genetic variation of the 40 microsatellite loci for two populations of Eleotris oxycephala
LocusSagami River population (N = 29)Sarugase River population (N = 14)
AHEFISAHEFIS
Eoxy00290.752−0.05580.8160.037
Eoxy00830.3620.14320.198−0.083
Eoxy00940.675−0.02240.593−0.083
Eoxy01030.518−0.13130.6150.188
Eoxy013100.8480.187100.860−0.163
Eoxy01520.0340.00040.4840.409
Eoxy01620.4090.32520.511−0.258
Eoxy02560.6030.08670.5820.264
Eoxy02740.670−0.08140.6870.376
Eoxy02980.7490.17260.7060.089
Eoxy03140.622−0.05340.6590.025
Eoxy10170.8330.13180.7910.097
Eoxy10440.493−0.05050.6020.288
Eoxy11630.5040.31630.6290.092
Eoxy12090.8080.01960.8130.209
Eoxy12320.4480.00030.4420.031
Eoxy12450.719−0.20070.788−0.178
Eoxy13160.336−0.02630.3740.235
Eoxy13550.756−0.04950.8240.220
Eoxy13630.4420.21930.5630.112
Eoxy13940.607−0.02330.5440.212
Eoxy14150.7820.33950.7610.061
Eoxy14570.7510.08250.687−0.248
Eoxy15590.8330.04870.7830.088
Eoxy15690.7970.26570.8520.245
Eoxy15770.7830.11940.736−0.261
Eoxy15890.825−0.00370.819−0.134
Eoxy16550.745−0.01850.7250.212
Eoxy16860.6950.05760.5770.133
Eoxy16950.6240.28150.5220.179
Eoxy17260.6340.12940.610−0.054
Eoxy17380.818−0.01170.838−0.023
Eoxy17960.776−0.02160.766−0.025
Eoxy18070.7720.01860.805−0.154
Eoxy18230.5550.06930.264−0.083
Eoxy18650.681−0.06330.3740.044
Eoxy18980.808−0.06770.7830.088
Eoxy19270.7500.448*60.6790.263
Eoxy19440.442−0.17050.560−0.020
Eoxy19650.7490.03460.7580.341

N, number of analyzed individuals; A, number of alleles; HE, expected heterozygosity; FIS, fixation index; * significant deviation from zero (P < 0.05).

Overall, we developed 40 polymorphic microsatellite markers that will be useful for conservation genetics studies of E. oxycephala, including evaluation of genetic diversity and structure together with population demographic inference.

REFERENCES
 
© 2019 by The Genetics Society of Japan
feedback
Top