2025 Volume 50 Issue 7 Pages 343-350
Nonalcoholic fatty liver disease (NAFLD) is a lifestyle-related disease. A gut-liver axis is involved in the progression of NAFLD. Disruption of the intestinal barrier function is an exacerbating factor of NAFLD. In this study, we have investigated the interaction between colitis and NAFLD in mouse models of dextran sodium sulfate (DSS)-induced colitis and diet-induced NAFLD-like lesions. Male C57BL/6J mice were provided with a choline-deficient, L-amino acid-defined, high-fat diet (CDAHFD) and 1.25% DSS water for 3 weeks. The DSS water was administered intermittently. In the large intestine, the DSS-treated groups clearly demonstrated inflammation. Dilation of crypt and goblet cells was observed in the DSS + CDAHFD group. The expression of minor inflammation-related genes was increased in the CDAHFD group. In the liver, the CDAHFD group demonstrated non-alcoholic steatohepatitis (NASH)-like lesions. The number of C-X-C motif chemokine ligand 16 (CXCL16)-positive cells increased in the CDAHFD group and tended to increase in the DSS + CDAHFD group. Toll-like receptor 4 (TLR4)-positive cells were observed mainly in gallbladder epithelial cells in all groups and were more pronounced in the DSS-administered groups. Inflammation-related genes were upregulated in the DSS group. The expression of fibrosis-related genes increased in the DSS + CDAHFD group. DSS-induced colitis and CDAHFD-induced NASH interacted with each other. NAFLD lesions were induced by CDAHFD and exacerbated by TLR4 and CXCL16 in DSS-induced colitis. Colitis is induced by DSS and exacerbated by changes in the intestinal environment due to liver injury. This combined model was useful in analyzing early lesions of liver-gut axis for NAFLD.
Non-alcoholic fatty liver disease (NAFLD) is a lifestyle-related disease, and its prevalence increases with the number of patients with metabolic syndrome (Riazi et al., 2022). In 2023, three international liver societies proposed MASLD/metabolic dysfunction associated steatohepatitis (MASH) as a new classification of non-alcoholic fatty liver disease (NAFLD)/non-alcoholic steatohepatitis (NASH), the patients prevalence also increase. (Rinella et al., 2024; Miao et al., 2024). NAFLD is associated with the risk of progression to NASH, a more severe hepatic disease, and early treatment of the disease is important. Detailed pathophysiological analyses are required to better understand the relevance of these factors.
The gut-liver axis is involved in NAFLD progression (Kirpich et al., 2015; Luo et al., 2023). The intestines and liver are the major organs responsible for absorption and metabolism. This interaction, the gut-liver axis, has many implications for the development and progression of lifestyle-related diseases, including NAFLD and NASH. The intestine has barrier mechanisms against physical factors, such as cell-cell adhesion and mucus, and also biological factors, such as antimicrobial peptides and immune cells. Disruption of the intestinal barrier function is an exacerbating factor of liver diseases, including alcohol-related liver disease (ALD), NAFLD, and cirrhosis (Kirpich et al., 2015; Shu et al., 2024). They are caused by an imbalance of the intestinal flora and intestinal barrier abnormalities, which allow external toxins such as lipopolysaccharide (LPS) and microbes to reach the liver through the bloodstream and enhance hepatitis (Luo et al., 2023). Induced hepatitis has been shown to exacerbate intestinal diseases. Hepatic dysfunction and inflammation decrease intestinal absorption, alter intestinal flora, and increase intestinal permeability (Carpino et al., 2020; Fukui, 2021).
In this study, the pathophysiological interaction in early phase between colitis and NAFLD was investigated in mouse models of dextran sodium sulfate (DSS)-induced colitis and choline-deficient l-amino acid-defined high-fat diet (CDAHFD)-induced NAFLD-like lesions. These models are known to induce early and marked lesions. CDAHFD induce hepatic NAFLD/NASH lesions such as hepatocyte fatty changes, inflammation, and fibrosis (Matsumoto et al., 2013; Suzuki-Kemuriyama et al., 2021). Involvement of the inflammatory and immune mechanisms, including chemokine-related factors, was investigated using this model. C-X-C motif chemokine ligand 16 (CXCL16) belongs to the CXC chemokine family. Serum CXCL16 levels are markedly elevated (Jiang et al., 2018). Moreover, CXCL16/C-X-C motif chemokine receptor 6 (CXCR6) axis has been reported to be involved in NAFLD progression for fatty liver and hepatic inflammation. (Ma et al., 2018; Wehr et al., 2014).
Male C57BL/6J mice at 5 weeks of age were purchased from Japan SLC (Shizuoka, Japan) and housed at an average temperature of 23°C under air-controlled conditions in colony cages with a 12-hr light/12-hr dark cycle. The mice were allowed ad libitum access to both food and water during both acclimation and treatment periods. At six weeks of age, the mice were divided into four groups, each consisting of of 6-7 mice. The control group received a standard diet (CE-2; CLEA Japan Inc. (Tokyo, Japan)) and tap water for three weeks. The DSS group received a standard diet and water containing 1.25% DSS (MP Biomedicals LLC., California, USA). The CDAHFD group was fed the following diet (45% fat; Research Diet Inc., New Jersey, USA) and tap water: The DSS + CDAHFD group received 1.25% DSS in water containing CDAHFD. The DSS water was administered intermittently. In the first and third weeks, tap water was administered during DSS cessation. Body weights were measured every to 3-4 days.
The mice were sacrificed after three weeks of treatment following an overnight fast. The mice were euthanized by exsanguination under isoflurane anesthesia. The liver and large intestine were excised, and the liver weight and length were measured. The absolute liver weight was defined as that hepatic weight, and the relative liver weight was a ratio of the absolute liver weight to the body weight. Portions of these organs were immediately fixed in 10% neutrally buffered formalin for histopathological and immunohistochemical examinations, and the remaining samples were stored at -80°C for molecular biological assessments.
Molecular biological examinationsTotal RNA was extracted using Sepasol-RNA I Super G (Nacalai Tesque, Inc., Kyoto, Japan) and reverse-transcribed to cDNA using a Thermal Cycler Dice (Takara Bio Inc., Shiga, Japan) and ReverTra Ace qPCR Master Mix (Toyobo Co., Ltd., Osaka, Japan). Quantitative real-time PCR (qPCR) was performed on a Thermal Cycler Dice Real Time System II (Takara Bio Inc.) using the Thunderbird SYBR qPCR Mix (Toyobo Co., Ltd.). The PCR cycle condition was as follows: initial denaturation at 95°C for 60 sec, followed by 40 cycles of denaturation at 95°C for 15 sec and extension at 60°C for 30 sec. The expression levels were calculated relative to the control group. All of the procedures were performed according to manufacturer’s instructions. The primer sequences used for qPCR are listed in Table 1.
| Forward Primer | Reverse Primer | |
|---|---|---|
| IL-1 beta | TGTGAAATGCCACCTTTTGA | GGTCAAAGGTTTGGAAGCAG |
| Mcp-1 | CCCACTCACCTGCTGCTACT | ATTTGGTTCCGATCCAGGTT |
| IL-6 | CCGGAGAGGAGACTTCACAG | CAGAATTGCCATTGCACAAC |
| Mip-2 | CCAGACAGAAGTCATAGCCACTCTC | GTTCTTCCGTTGAGGGACAGC |
| Tnf-alpha | TCGTAGCAAACCACCAAGTG | AGATAGCAAATCGGCTGACG |
| Tlr4 | CTGTTCCTCCAGTCGGTCAG | CGTCGCAGGAGGGAAGTTAG |
| Cxcl16 | GGCTTTGGACCCTTGTCTCTTG | TTGCGCTCAAAGCAGTCCACT |
| Sox9 | CATCAAGACGGAGCAGCTGAG | ATGGTCAGCGTAGTCGTATTG |
| alpha-SMA | GTCCCAGACATCAGGGAGTAA | TCGGATACTTCAGCGTCAGGA |
| GAPDH | CAAGGACTGCGAGAGAAGGT | CCTGGTGTGGGTCTTCAGAT |
Fixed liver and large intestine samples were embedded in paraffin according to standard techniques and cut into 4-µm sections for Hematoxylin-Eosin (H&E) or Periodic acid-Schiff (PAS) staining.
Immunohistochemical examination was conducted using antibodies against Toll-like receptor 4 (TLR4, 1:100; Proteintech Group, Inc., Illinois, USA) and CXCL16 (1:500; R&D Systems, Inc., Minnesota, USA). Histofine Simple Stain Mouse MAX-PO (R) (Nichirei Bioscience Inc., Tokyo, Japan) and Histofine MOUSESTAIN KIT (Nichirei Bioscience Inc.) were used as secondary antibodies, and the signals were visualized using 3,3ʹ-diaminobenzidine (Wako Pure Chemical Industries, Ltd., Osaka, Japan).
Statistical analysisValues are expressed as the mean ± standard deviation. Statistical analyses were performed using the GraphPad Prism ver. 6.05 (GraphPad Software, San Diego, CA, USA). The significance of the differences between groups was examined using one-way analysis of variance (ANOVA) and Tukey’s multiple comparison test. Statistical significance was set at P < 0.05.
Ethical considerationsAll of the animal husbandry and experiments were conducted in compliance with the guiding principle of the Tokyo University of Agriculture and approved by the Animal Experiment Committee of the university. Consequently, this study complied with all related domestic and international laws, regulations, and guidelines.
The changes in body weight, large intestine length, and liver weight are shown in Fig. 1. The DSS + CDAHFD group showed a decrease in body weight over time, whereas that of the other groups were found to have remained constant. In the DSS-administered groups, the large intestine was shorter than that in the tap water group. Relative liver weight significantly increased or tended to increase in the CDAHFD groups.

Body weight, large intestine length and liver weight. Changes in body weight (A), large intestine length (B), absolute liver weight (C) and relative liver weight (D) during the experiment. Data are presented as mean ± standard deviation. *p<0.05, significant difference.
Changes in the histopathological examinations of large intestine are shown in Fig. 2.

Morphological changes in the large intestine. Representative outcomes in the large intestine of the H&E and PAS stainings. The H&E staining (A-H). The PAS staining (I-L). All stains are shown in the order of Control, DSS, CDAHFD, and DSS+CDAHFD groups. The black bar is 100 μm. The white bar is 20 μm.
In the large intestine, the DSS-treated groups showed clear infiltration of inflammatory cells, mainly lymphoid cells and macrophages. Additionally, dilation of crypt and goblet cells was observed in the DSS + CDAHFD group. On the other hand, there were no ulceration and widespread cryptitis. This group was suggested to have increased mucus secretion based on PAS staining. No lesions were observed in the CDAHFD group.
Changes in the hepatic histopathological and immunohistochemical examinations are shown in Fig. 3.

Logical changes in the liver. Representative outcomes in the large intestine and liver of the H&E and PAS stainings and CXCL16 and TLR4 immunohistochemistry. H&E staining of liver (A-D). CXCL16 immunohistochemical staining (E-H). TLR4 immunohistochemical staining of gallbladder of the liver (I-L) All stains are shown in the order of Control, DSS, CDAHFD, and DSS+CDAHFD groups. Black bar is 100 μm, white bar is 50 μm. The arrows are positive site of CXCL16 immunohistochemistry.
In the liver, the CDAHFD groups demonstrated NASH-like lesions such as macrovesicular fatty changes in hepatocytes and inflammatory cell infiltration, mainly in lymphoid cells and macrophages. CXCL16-positive cells increased in the CDAHFD group and tended to be enhanced in the DSS+CDAHFD group when compared with the CDAHFD group. No lesions were observed in the DSS group. However, TLR4-positive cells were observed mainly in gallbladder epithelial cells in all groups and were more pronounced in the DSS-administered groups. Hepatic fibrosis was not observed in any group.
Changes in the gene expression analysis are shown in Fig 4.

Gene expression of large intestine and liver. Changes in large intestine mRNA expression of the IL-1 beta, Mcp-1, and IL6 genes (A-C). Changes in hepatic mRNA expression of Mip-2, Tnf-alpha, Tlr4, Cxcl16, Sox9, and alpha-SMA genes (D-I). Data are presented as mean ± standard deviation. *p<0.05, significant difference.
In the large intestine, inflammation-related genes (IL-1beta, Mcp-1 and IL6) tended to increase in DSS group. These changes were enhanced in the DSS + CDAHFD group. In addition, the expression of these genes was low and tended to increase in the CDAHFD group.
In the liver, the expression of inflammation-related genes (Mip-2, Tnf-alpha, Tlr4 and Cxcl16) was significantly increased or tended to increase in the CDAHFD and DSS + CDAHFD groups, respectively. Especially, TLR4-expression was stronger in the DSS + CDAHFD group than in the other groups. Additionally, these genes were minor and upregulated in the DSS group. The fibrosis-related genes (Sox9 and alpha-SMA showed different expression behavior. The alpha-SMA levels were significantly increased in the DSS + CDAHFD group and tended to increase in both the DSS and CDAHFD groups. In contrast, Sox9 expression was found to have increased only in the DSS + CDAHFD group.
DSS and CDAHFD caused clear injury to their respective target organs, the large intestine and liver. However, these compounds also showed signs of organ failure to their not respective target in gene expression analysis. Furthermore, this combination exacerbated the lesions in the respective target organs. These results were considered to be caused by interactions between the large intestine and liver, and the gut-liver axis. Patients with NAFLD/NASH tend to have increased intestinal permeability (Luther et al., 2015), and the influx of LPS into the liver triggers the progression of liver disease through the activation of pathogen recognition receptors, including Toll-like receptor 4 (TLR4) (Lang and Schnabl, 2020; Hsu and Schnabl, 2023).
In this case, the intestinal barrier mechanisms were weakened by the DSS-induced colitis, allowing numerous endotoxins containing LPS to enter the bloodstream. LPS reaches the liver via the bloodstream and induces in expression of CXCL16 and TLR4 (Xiao et al., 2019). CXCL 16 has been reported to be increased in the serum and liver of NAFLD patients (Jiang et al., 2018), suggesting that it contributes to the progression of the hepatic lesions. CXCL16 is associated with reactive oxygen species (ROS) generation, macrophage infiltration, and the accumulation of natural killer T (NKT) cells (Ma et al., 2018; Jiang et al., 2018). These functions influence the deterioration of hepatic lesions, not only inflammation, but also an increase in fibrosis-related gene expression. NKT cells express CXCR6, a receptor for CXCL16 that is abundant in the liver and contributes to inflammation and fibrosis (Wehr et al., 2013). The enhanced expression of CXCL16 in this case may be related to the exacerbation of hepatic lesions by NKT cells. Sox9 expression is also reportedly increased by LPS via TLR4 (Shao et al., 2022). It is also associated with hepatic fibrosis (Athwal et al., 2018). In this study, Sox9 and alpha-SMA were upregulated, indicating the possibility of the long-term induction of liver fibrosis. Both organs express inflammatory cytokines, which are considered to interact with and also exacerbate each other via the bloodstream. In the DSS+CDAHFD group, dilation of the crypt and goblet cells was observed. This was thought to be caused by the stimulation of inflammatory cytokines and variation in intestinal flora due to hepatic lesions, in addition to DSS stimulation. The increased bile acid content is also considered to have affected liver lesions and the intestinal environment. It has been reported that the levels of both primary and secondary bile acids increase in patients with NAFLD (Ferslew et al., 2015). Enhancement of TLR4 in the gallbladder can be stimulated by an increase in bile acids, hepatic injury, and LPS influx. Furthermore, a high-fat diet increases the influx of bile acids into the intestine. Indeed, the CDAHFD contained a high proportion of fat. Studies using NAFLD/NASH models (methionine-choline-deficient diet, choline-deficient amino acid-defined diet, and high-fat diet) have reported an increase in the concentration of bile acids in the intestine, an increase in the Firmicutes/Bacteroidetes ratio of the intestinal flora, and exacerbation of hepatitis or colitis due to an increase in Helicobacter hepaticus, which has resistance to bile acids (Ishioka et al., 2017; Segura-López et al., 2015; Wang et al., 2025). Also an increase in the amount of bile acid was demonstrated in the faces and portal blood due to high-fat diet feeding (Yoshitsugu et al., 2019; Hori et al., 2020). Therefore, intestinal bile acid concentration was considered to be increasing in this examination, and intestinal disorders tended to be aggravated.
DSS-induced colitis and CDAHFD-induced NAFLD-like lesions interact with each other. NAFLD lesions were induced by CDAHFD and exacerbated in concurrence DSS-induced colitis though increased expression of TLR4 and CXCL16 by liver-gut axis. Colitis is induced by DSS and exacerbated by changes in the intestinal environment due to liver injury. These pathological changes suggest a liver-gut axis of disease in the model mice. Activation of CXCL16 signaling in inflammatory cells infiltration, an early lesion of NAFLD/NASH, may contribute to the progression to more severe lesions such as fibrosis (Wang et al., 2024). Moreover, more severe colitis demonstrated widespread cryptitis and ulceration (Gupta et al., 2007). In this study, there was a lack of analysis of later lesions such as fibrosis in NAFLD/NASH and ulceration in colitis. Therefore, we consider it necessary to carry out more long-term and overtime examination in consideration of the disease progression and severity of both models.
This study was supported in part by the research budget of the Tokyo University of Agriculture. The authors thank the members of these laboratories for their support and helpful comments. We would like to thank Editage (www.editage.com) for great language supporting.
Conflict of interestThe authors declare that there is no conflict of interest.