It has been reported that impairment of glycogen synthase, the key enzyme in glycogen synthesis, could be a genomic marker of NIDDM. Groop et al. identified a polymorphism by Xbal digestion of the glycogen synthase gene. We studied 55 unrelated patients with NIDDM and 40 unrelated nondiabetic subjects with no family history of NIDDM. Using PCR on genomic DNA from the leukocytes of these subjects, we amplified a region of the genomic DNA encompassing the Xbal new cleavage site (an intron 302 base pairs upstream from position 1970 of cDNA) with sense and anti-sense primers;5'CTCTCCGACCTTCTGGACTG3'(1935-1954) and 5'GCTCGTAGGTGAAGTGCTCT3'(2014-2033), respectively.
The Xbal new cleavage site in the PCR fragment was found in one of 40 non-diabetic subjects and none of the 55 patients with NIDDM. Therefore, Xbal polymorphism of the glycogen synthase gene is rare in Japanese and can not be used as a genomic marker for Japanese NIDDM.
