All issues
Volume 108 (1990)
- Issue 6 Pages 893-
- Issue 5 Pages 695-
- Issue 4 Pages 505-
- Issue 3 Pages 341-
- Issue 2 Pages 145-
- Issue 1 Pages 1-
Volume 108, Issue 6
Displaying 1-31 of 31 articles from this issue
- |<
- <
- 1
- >
- >|
-
Dongchon Kang, Koichiro Takeshige, Shigeki Minakami1990 Volume 108 Issue 6 Pages 893-895
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSWe analyzed lipids extracted from human hepatoma HepG2 cells using a high performance liquid chromatograph equipped with a reversed phase column and found a compound with a mass spectrum showing certain diagnostic ion framgents of 1-methoxy-5-polyprenylphenol, a known intermediate of ubiquinone biosynthesis. Universally radiolabeled [14C]-p-hydroxybenzoate, a precursor of ubiquinone, was incorporated into the compound on incubation with the cells, suggesting that the compound is a precursor of ubiquinone. The presence of the compound in the microsomal fraction of HepG2 cells was not due to contamination by the mitochondrial fraction because the activity of succinate-cytochrome c reductase in the microsomal fraction was below 1% of that in the mitochondrial fraction, whereas the contents of ubiquinone and the compound in the former were 4.6 and 7.8% of those in the latter, respectively. These results support the hypothesis that ubiquinone biosynthesis might occur in microsomes as well as mitochondria.View full abstractDownload PDF (319K) -
Katsuhiro Yamamoto1990 Volume 108 Issue 6 Pages 896-898
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe morphological changes of myosin molecules occurring on thermal treatment at 40°C in 0.5 M KCl at pH 6.0 were observed under an electron microscope. Most myosin molecules were in the monomeric state in the unheated control, although some were associated through their head regions, forming oligomers. Myosin monomers decreased upon heating, while myosin molecules aggregated to form an oligomer, in which the myosin heads were tightly associated, forming a clump, the tails of the myosin molecules extending radially from the clump. Such an oligomer was shaped a daisy wheel. The tails of myosin molecules slightly shortened upon heating.View full abstractDownload PDF (2613K) -
Satoru Ishihara, Ken-ichirou Morohashi, Hiroyuki Sadano, Shun-ichiro K ...1990 Volume 108 Issue 6 Pages 899-902
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESScDNA clones coding for hemoprotein H-450 were isolated from a rat liver cDNA library using anti-H-450 antibody. The molecular weight calculated from the deduced amino acid sequence comprising 547 amino acid residues was 60, 085. The N-terminal sequence and a partial internal amino acid sequence of purified H-450, which were determined chemically, were both found in the amino acid sequence of H-450 deduced from the nucleotide sequence. H-450 mRNA is expressed in liver, kidney, and brain. A homology search of amino acid sequences indicated that H-450 shows no homology with cytochrome P-450, but shows significant homology with bacterial O-acetylserine (thiol)-lyases. However, H-450 has no O-acetylserine (thiol)-lyase activity.View full abstractDownload PDF (467K) -
Dae Kyong Kim, Ichiro Kudo, Yumi Fujimori, Hiroshi Mizushima, Mitsuhar ...1990 Volume 108 Issue 6 Pages 903-906
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSLike rat platelets, rabbit platelets contain a secretory 14-kDa group II phospholipase A2 [Mizushima, H., Kudo, I., Horigome, K., Murakami, M., Hayakawa, M., Kim, D.K., Kondo, E., Tomita, M., & Inoue, K. (1989) J. Biochem. 105, 520-525]. The present study was undertaken to determine whether or not, in addition to that of the 14-kDa group II enzyme, rabbit platelets exhibit another phospholipase A2 activity. A rabbit platelet soluble fraction was prepared by sonication and centrifugation. When this soluble fraction was subjected to heparin-Sepharose column chromatography, phospholipase A2 activity was detected in both heparin-binding and heparin-non-binding fractions. The activity detected in the heparin-binding fraction appeared to belong to the secretory 14-kDa phospholipase A2, because it bound to anti-human 14-kDa group II phospholipase A2 monoclonal antibody. The activity found in the heparin-non-binding fraction did not appreciably react with the same antibody. When platelets were gently disrupted by the nitrogen cavitation method, the heparin-non-binding activity was mainly recovered in the platelet cytosolic fraction. The heparin-non-binding phospholipase A2 hydrolyzed a phospholipid bearing an arachidonoyl residue at the sn-2 position more effectively than one with a linoleoyl residue. The biochemical features of the activity observed in the heparin-non-binding fraction generally resembled those of human platelet soluble phospholipase A2 [Kim, D.K., Kudo, I., & Inoue, K. (1988) J. Biochem. 104, 492-494]. It can be concluded that rabbit platelets contain two kinds of phospholipase A2; one is the secretory 14-kDa group II phospholipase A2 in the granule fraction and the other is a cytosolic phospholipase A2 with a preference for arachidonoyl residues.View full abstractDownload PDF (422K) -
Bunzo Mikami, Masaaki Hirose1990 Volume 108 Issue 6 Pages 907-908
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe N-terminal half molecule of ovotransferrin has been crystalliied from a polyethylene glycol 6000 solution by means of the vapor diffusion method. The crystals belong to the orthorhombic system, space group P212121, with cell dimension of a=47.0, b=90.2, and c=76.2 Å. The crystals diffract X-rays to a resolution limit of at least 2.0 Å and are resistant to X-ray radiation damage. They appear to be suitable for X-ray structure analysis.View full abstractDownload PDF (1185K) -
Yasushi Hasegawa, Kazuhiro Tanahashi, Fumi Morita1990 Volume 108 Issue 6 Pages 909-913
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSPorcine aorta smooth muscle myosin was subjected to limited proteolysis by Staphylococcus aureus protease (V8-protease) at 30 mM KCl, under which condition the myosin is in the filamentous form. The heavy chain of the myosin molecule was mainly digested at the 68-160 kDa junction, which corresponds to the 50-20-kDa junction in the heavy chain of skeletal muscle myosin subfragment-1 (S-1). When the filamentous myosin formed a rigor complex in the presence of F-actin, this site was blocked, and the junction between S-1 and subfragment-2 (S-2) was in turn digested specifically. Both phosphorylated and unphosphorylated 20-kDa light chain (LC20) in the aorta myosin remained intact under these conditions. The actinactivated ATPase activity of phosphorylated myosin was not in-fluenced by the cleavage of the S-1-S-2 junction. With unphosphorylated myosin, however, the actin-activated ATPase activity increased with the cleavage of the S-1-S-2 junction and reached the level of ATPase activity of phosphorylated myosin at the stage of complete cleavage. The increase of ATPase activity was found to be proportional to the loss of double-headed myosin. The overall data indicate that LC20 works to suppress the actin-activated ATPase activity, and the suppression is released by the phosphorylation of LC20. The presence of two heads in myosin is required to reveal such regulation by LC20.View full abstractDownload PDF (4593K) -
Mitsufumi Wada, Keiichi Ozaki, Nobuyuki Itoh, Ikuo Yamashina, Toshisuk ...1990 Volume 108 Issue 6 Pages 914-917
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSRat liver mannan-binding protein (R-L-MBP) is a lectin specific for mannose and N-acetylglucosamine. Northern blot hybridization analysis with a R-L-MBP cDNA (0.9 kb), which we isolated previously [Oka, S., Itoh, N., Kawasaki, T., & Yamashina, I. (1987) J. Biochem. 101, 135-144], revealed that R-L-MBP was encoded by two species of mRNA of 1.4 and 3.5 kb long, respectively. Analysis of a newly isolated cDNA clone of 3.3 kb long showed that the sequence of the open reading frame of the 3.5 kb mRNA was completely identical to that of the 1.4 kb mRNA. The 3'-untranslated region of the 3.5 kb mRNA contained two inverted copies of the previously described identifier (ID) sequence, which is a repetitive element of the rat genome [Milner, R. J., Bloom, F. E., Lai, C., Lerner, R. A., & Sutcliffe, J. G. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 713-717]. Southern blot analysis of rat genomic DNA digested with restriction enzymes suggested that each mRNA species arises from one gene, with the differences in size most easily being accounted for by differential utilization of the polyadenylation sites of one transcript.View full abstractDownload PDF (3412K) -
Kazuo Yamasaki, Naoto Sano, Masato Ohe, Taibo Yamamoto1990 Volume 108 Issue 6 Pages 918-925
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSTo determine the intermolecular cross-linking site on the primary structure of sarcoplas-mic reticulum (SR) Ca-ATPase, the conditions for the specific binding of 14C-labeled 1, 4-phenylene bis maleimide (PBM) or 14C-labeled N-ethylmaleimide (NEM) to the ATPase were explored. SR vesicles were preincubated with nonradioactive PBM in the presence of 1 mM vanadate for 1 h, then washed by centrifugation to remove free PBM and vanadate. When the pretreated SR vesicles were allowed to react with 1 mM [14C]PBM in the presence of 1 mM AMPPNP, the amount of [14C]PBM incorporated into the ATPase increased with time in parallel with the formation of dimeric ATPase and reached the maximum labeling density of 1 mol of [14C] PBM per mol of dimeric ATPase at 40 min after the start of the reaction. When the pretreated SR vesicles were allowed to react with 2 mM PCJNEM in the absence of AMPPNP, a maximum of about 2 mol of NEM was bound per mol of the ATPase monomer. The labeling density of [14C]isTEM decreased from 2 to 1 mol per mol of the ATPase when the SR vesicles were allowed to react with [14C]NEM in the presence of AMPPNP. From the analysis of the amino acid composition of the two major [14C]NEM-labeled peptides isolated from the thermolytic digest of the enzyme after the reaction of SR with [14C]NEM in the absence of AMPPNP, we deduced that [14C] NEM was incorporated into Cys377 and Cys614. On the other hand, the labeling of SR in the presence of AMPPNP resulted in inhibition of the [14C]NEM binding to Cys614, leaving Cys377, unaltered. Based on these findings, we propose that at least two distinct SH groups of Cys377 and Cys614 on the primary structure of the ATPase are involved in the intermolecular cross-linking with PBM; that of Cys377 is involved in the formation of dimeric ATPase, while that of Cys614, which is sensitive to AMPPNP, is involved in further oligomerization of the dimeric ATPase.View full abstractDownload PDF (3404K) -
Kazufumi Kuroda, Ritsuko Kagiyama-Takahashi, Tomoyuki Shinomiya1990 Volume 108 Issue 6 Pages 926-933
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSTwo hybrid cell lines (DM88-5E12 and DM88-4C9) secreting monoclonal antibodies against DNA polymerase α-primase complex from Drosophila melanogaster Kc cells were estab-lished by immunizing mice with the complex partially purified by a conventional method. The IgG subclasses of both antibodies were IgG1. Both antibodies immunoprecipitated the DNA polymerase α-primase complex from D. melanogaster Kc cells. The DNA-polymerizing activity was neutralized by 4C9 antibody, but not by 5E12 antibody. The DNA priming activity was not neutralized by either antibody. These antibodies did not cross-react to HeLa DNA polymerase α-primase complex. A rapid, two-step purification of DNA polymerase α-primase complex from D. melanogaster Kc cell was carried out by 5E12 antibody column chromatography followed by single-stranded DNA cellulose column chromatography. The immunoaffinity-purified enzyme had both DNA-polymerizing and DNA-priming activities with the specific activities of 50, 000 and 2, 000 units/mg, respec-tively. The effects of aphidicolin, NEM, ddTTP, BuPdGTP, and DMS0 on the enzyme activity showed that the purified enzyme was DNA polymerase α, but not DNA polymerase β, γ, or δ. The purified enzyme consisted of polypeptides with apparent molecular weights of 180 (and 145, 140, 130 kDa), 72, 63, 51, and 49 kDa. The 5E12 antibody was shown to bind to all the high-molecular-weight polypeptides, 180, 145, 140, and 130 kDa, by immuno-Western blotting analysis.View full abstractDownload PDF (1978K) -
Yôichi Iida1990 Volume 108 Issue 6 Pages 934-937
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe nucleotide sequence at the intron-exon junction in the human β-globin gene- was analyzed by the quantification method (categorical discriminant analysis) proposed previously. Using the sample score of a 16-nucleotide sequence at a 3'-splice junction, we studied to what extent such a sequence contains the 3'-splice signal. To examine the applicability of our method, we further studied several mutants of β-thalassemia, where nucleotide changes exist at 3' -splice junction sequences of the first and second introns. Other mutants involve point mutations which generate new 3'-splice signals within the first intron. Experimental results on the abnormal splicing in those mutants could be explained in terms of the sample scores of 16-nucleotide sequences and their locations relative to the branch point.View full abstractDownload PDF (598K) -
Tomoya Uruga, Toshiaki Hamanaka, Katsuzo Wakabayashi, Yoshiyuki Amemiy ...1990 Volume 108 Issue 6 Pages 938-946
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe effects of cross-linking and lattice contraction of purple membrane (PM) on the photodynamics of bacteriorhodopsin (bR) and on the tertiary structure were studied by flash photolysis and X-ray diffraction. To get a contracted lattice form of PM, native PM, and/or PM cross-linked by glutaraldehyde were treated with deoxycholate or Triton X-100. Part of the Triton-treated cross-linked PM was further incubated with Bio-Beads SM-2 to remove Triton X-100. In the modified PM, several long-lived components of the M intermediate appeared, the features of which were related to the environment of bR. Also, X-ray diffraction studies using synchrotron radiation were performed on the modified PM under intense light irradiation (λ> 500 nm) in which 40-80% of bR was photoconverted to the M state. In the Triton-treated cross-linked PM dispersed in 0.25% Triton X-100, the unit cell of membrane crystalline lattice was enlarged from 58.8 to 59.8 Å and the crystalline order decreased with irradiation. The analysis of X-ray diffraction patterns suggests that light-induced conformational changes of bR correlated with the Triton content of the environment and an increase of substitution disorder was caused by these changes, but the average location of bR was unchanged. However, the other modified PM showed no significant changes of diffraction, upon light irradiation.View full abstractDownload PDF (1100K) -
Hitoshi Aoshima1990 Volume 108 Issue 6 Pages 947-953
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSNicotinic acetylcholine receptor was synthesized in Xenopus oocytes after injection of the mRNA purified from Electrophorus electricus electroplax. Nicotine, succinylcholine, and decamethonium (agonist)-elicited membrane currents in the injected oocytes were measured electrophysiologically by the voltage-clamping method. The following four different measurements were made to establish the relationship between the agonist concentration and the membrane current: 1) the agonist-induced membrane current before desensitization, 2) the agonist-induced membrane current after desensitization equilibrium, 3) the fraction of the active form of the receptors after desensitization equilibrium, 4) the rate of recovery of desensitized receptors upon removal of the agonist. These results were analyzed on the basis of the minimal model proposed from receptor-mediated ion translocation measurements. The equilibrium and rate constants of the model were evaluated for nicotine, succinylcholine, and decamethonium, and could explain the observed electrical responses in the injected oocyte, i.e. the characteristics of the receptor response caused by these agonists.View full abstractDownload PDF (763K) -
Yoshiki Itoh, Masahiro Sumi, Kouji Nakamura, Kunio Yamane1990 Volume 108 Issue 6 Pages 954-959
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSTo analyze the processing of extracellular enzymes of Bacillus subtilis, an NH2-terminally extended hybrid a-amylase [pTUBE638-α-amylase (E24)] was purified from the periplasm of E. coli (pTUBE638) as the substrate for the in vitro processing reaction, in which a 21-amino-acid extra-peptide was added at the NH2-terminus of the mature thermostable α-amylase. The extended peptide in pTUBE638-α-amylase (E24) was completely processed by the extracellular alkaline protease of B. subtilis alone at pH 7.5 to 10.0. The processing was inhibited by 2 mM PMSF. In contrast, the neutral protease did not process the extended peptide. The processing activity of the purified alkaline protease was fully active in 100 mM phosphate and glycine-NaCl-NaOH buffer while it was partially active in 100 mM Tris-HC1 or MOPS buffer. The optimum pH of the activity ranged from 8.0 to 9.0, although the optimum pH of the alkaline protease activity toward casein and Azocoll was 10.5. The NH2-terminal amino acid sequences of the enzymes processed in vitro coincided with those of the mature extracellular thermostable α-amylases in the culture medium of B. subtilis (pTUBE638). The appearance of the processing activity of alkaline protease was correlated with the changes of the pH in the culture medium.View full abstractDownload PDF (2890K) -
Seiichi Hashida, Eiji Ishikawa1990 Volume 108 Issue 6 Pages 960-964
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSA novel and ultrasensitive enzyme immunoassay (immune complex transfer two-site enzyme immunoassay) for ferritin is described. Ferritin was reacted simultaneously with affinity-purified dinitrophenyl biotinyl anti-ferritin IgG and affinity-purified anti-ferritin Fab'-β-D-galactosidase conjugate. The complex formed of the three components was trapped onto affinity-purified (anti-dinitrophenyl group) IgG-coated polystyrene balls. After eliminating excess conjugate by washing, the complex was eluted from the poly-styrene balls with an excess of εN-dinitrophenyl-L-lysine and transferred to streptavidin-coated polystyrene balls. The β-D-galactosidase activity bound to streptavidin-coated polystyrene balls was assayed by fluorometry. Nonspecifically bound β-D-galactosidase activity was remarkably lowered but there was much less decrease in specifically bound β-D-galactosidase activity. As a result, the detection limit of ferritin was lowered to 1 milliattomole (1×10-21 mol, 600 molecules as calculated from Avogadro's number). This technique will be useful for measuring, for example, antigens in single cells.View full abstractDownload PDF (605K) -
Takuro Niidome, Norio Yoshida, Fusahiro Ogata, Akio Ito, Kosaku Noda1990 Volume 108 Issue 6 Pages 965-970
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSAn acidic amino acid-specific endopeptidase was purified from Protease Type XVI (Sigma), a commercial product from culture filtrate of Bacillus subtilis, by a series of column chromatographies on CM-Toyopearl (Fractogel) and Mono-S, guided by activity assay using Boc-Ala-Ala-Pro-Glu-pNA as a substrate. The final preparation was homogeneous on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and reversedphase HPLC. The molecular weight of the protease was estimated to be 18, 000 by gel filtration on TSK gel G3000SWXL column using 6M guanidine hydrochloride as an eluent, and 17, 000 by SDS-PAGE in the presence of 2-mercaptoethanol. The isoelectric point of the protease was 7.7. Studies on the substrate specificity with peptide p-nitroanilides and natural peptides revealed that the protease hydrolyzes the peptide bonds on the carboxylterminal side of acidic amino acids, especially of glutamic acid. The protease was completely inactivated by DFP, indicating the serine protease nature of the protease. The activity of the protease was also inhibited by EDTA and GEDTA, and reactivated by Ca2+. The protease contained 1.3±0.2 mol/mol protein of Ca2+. These results suggest that Ca2+ plays a vital role in the protease activity.View full abstractDownload PDF (625K) -
Akira Kitagawa, Kazuyuki Kizuki, Hiroshi Moriya, Motoshige Kudo, Tetsu ...1990 Volume 108 Issue 6 Pages 971-975
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSKallikrein-positive cells in the anterior pituitary of female rats were identified to be the same as prolactin-producing cells by using an immunoelectron microscopic method. The kallikrein immunoreactivity was localized at the Golgi apparatus, the rough endoplasmic reticulum, and secretory granules, suggesting that kallikrein is synthesized in the prolactin-producing cells and also may be secreted into the blood vessels.View full abstractDownload PDF (4539K) -
Hironobu Koga, Hidenori Yamada, Yukio Nishimura, Keitaro Kato, Taiji I ...1990 Volume 108 Issue 6 Pages 976-982
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSSixty-nine rat cathepsin L-susceptible peptide bonds were analyzed employing various peptide substrates. The proteolytic specificities of rat cathepsin L and papain were compared and the results are discussed in relation to differences in amino acid residues around their binding sites. The specificity of cathepsin L, which is characterized by a remarkable preference for hydrophobic amino acids at the P2 site of the scissile peptide bonds, was analogous to that of papain as a whole. This analogous specificity suggests that the binding sites of the two proteases are analogous, as expected from their homologous amino acid sequences. However, there is a slight difference in the preference for S3 site between them. That is, cathepsin L showed a greater preference for bulky and hydrophobic amino acids at the S3 site than did papain. Based on the computer-graphically deduced structure of the binding sites of cathepsin L, the preferences for hydrophobic amino acids at the S2 site and for bulky and hydrophobic amino acids at the S3 site of the protease are supposed to be related to the compensating amino acid substitutions at the S2 site (V133A and V157L) and the reduction in size at the S3 site (Y61Q and Y67L), respectively. The discussion of the effect of the amino acid substitutions on the proteolytic activities of cathepsin L and papain in this paper provides a basis for more advanced studies of the relationship between structure and function of proteases belonging to the papain super-family by means of protein engineering.View full abstractDownload PDF (1725K) -
Hirotada Fujii, Katsuko Kakinuma1990 Volume 108 Issue 6 Pages 983-987
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSFor direct measurement of the ESR signal of superoxide anion (O2-) produced in biological samples, O2- generated at a physiological pH was trapped in alkaline media instead of by a rapid freezing method, and then its signal was measured by ESR spectroscopy at 77K. A reaction mixture for O2- generation, such as xanthine oxidase-xanthine and neutrophils, was incubated at a physiological pH (pH 7.0-7.5) for a suitable reaction period (30s), then an aliquot (300 μl) was pipetted out and squirted into 600 μl of 0.5 M NaOH to stabilize O2- (pH-jump). The alkaline mixture was promptly introduced into an ESR tube and frozen by dipping the tube directly into a cooling liquid. A typical signal of O2- was detected by ESR spectroscopy and the amount of trapped O2- was measured quantitatively at 77K. The back reaction of O2- generation from H2O2 was negligible in 0.5 M NaOH. To avoid any artificial spectrum due to autoxidation of biological samples by the pH-jump procedure, the background spectrum should be subtracted from the obtained spectrum. This pH-jump method should be widely available for direct demonstration of O2- production in biological systems at physiological pH, because an advantage of this method is the simple operation for trapping O2- without the use of any rapid-mixing apparatus as compared with the rapid freezing method.View full abstractDownload PDF (646K) -
Tomiko Asano, Haruo Shinohara, Rika Morishita, Kanefusa Kato1990 Volume 108 Issue 6 Pages 988-994
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSAntisera were raised in rabbits against purified α subunit of G protein Gi1 (Gi1α) and also against a synthetic decapeptide corresponding to a sequence of Gi1α. Antibodies in both antisera were purified with a Gi1-coupled Sepharose column, but purified anti-Gi1α protein antibodies still reacted equally with both Gi1α and Gi3α, while anti-Gi1α peptide antibodies reacted principally with Gi1α. Using these antibodies, an enzyme immunoassay method for the quantification of Gi1α was developed. The assay system consisted of polystyrene balls with immobilized anti-Gi1α protein antibody F(ab')2 fragments and the anti-Gi1α peptide antibody Fab' fragments labeled with β-D-galactosidase from Escherichia coli. The minimum detection limit of the assay was 25 fmol of Gi1α, and it did not cross-react with Gi2, Go2α, or βγ. Samples from various regions of the rat central nervous system were homogenized in a 2% sodium cholate solution, and the concentration of Gi1α in each extract was determined. Gi1α was detected in all the regions, and the highest concentration was found in the olfactory bulb. Immunohistochemical study showed that Gi1 was mainly localized in the neuropil.View full abstractDownload PDF (5894K) -
Shingo Fujisaki, Hiroshi Hara, Yukinobu Nishimura, Kensuke Horiuchi, T ...1990 Volume 108 Issue 6 Pages 995-1000
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe molecular cloning and the determination of the nucleotide sequence of the ispA gene responsible for farnesyl diphosphate (FPP) synthase [EC 2.5.1.1] activity in Escherichia coli are described. E. coli ispA strains have temperature-sensitive FPP synthase, and the defective gene is located at about min 10 on the chromosome. The wild-type ispA gene was subcloned from a λ phage clone containing the chromosomal fragment around min 10, picked up from the aligned genomic library of Kohara et al. [Kohara, Y., Akiyama, K., & Isono, K. (1987) Cell 50, 495-508]. The cloned gene was identified as the ispA gene by the recovery and amplification of FPP synthase activity in an ispA strain. A 1, 452-nucleotide sequence of the cloned fragment was determined. This sequence specifies two open reading frames, ORF-1 and ORF-2, encoding proteins with the expected molecular weights of 8, 951 and 32, 158, respectively. A part of the deduced amino acid sequence of ORF-2 showed similarity to the sequences of eucaryotic FPP synthases and of crtE product of a photosynthetic bacterium. The plasmid carrying ORF-2 downstream of the lac promoter complemented the defect of FPP synthase activity of the ispA mutant, showing that the product encoded by ORF-2 is the ispA product. The maxicell analysis indicated that a protein of molecular weight 36, 000, approximately consistent with the molecular weight of the deduced ORF-2-encoded protein, is the gene product.View full abstractDownload PDF (1858K) -
Masazumi Miyazaki, Hideto Kagiyama1990 Volume 108 Issue 6 Pages 1001-1008
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSPeptide elongation factor 3 (EF-3), which is widely present in yeasts and fungi (Eumycota), does not occur in another lower eukaryote, the unicellular protozoan Tetrahymena pyriformis, as was shown by the following findings: (a) there is no activity to satisfy the EF-3 requirement of yeast ribosomes in the post-ribosomal supernatant fraction from Tetrahymena, and (b) the Tetrahymena ribosomes displayed their full capacity for polyphenylalanine synthesis with purified EF-1α and EF-2 alone from either Tetrahymena or yeast, and their activity on the Tetrahymena ribosomes was not further enhanced by the addition of yeast EF-3, in contrast to the case of the yeast ribosomes. However, as a substitute for the ribosome-activated nucleotidase activity of EF-3, Tetrahymena ribosomes were shown to harbor strong, firmly bound ATPase and GTPase activities, which probably involve the same active site. The ribosome-bound ATPase activity was inhibited by a polyclonal antibody raised against yeast EF-3 with the same inactivation profile as that of polyphenylalanine synthesis on Tetrahymena ribosomes, indicating that the ribosomal ATPase plays an essential role in the elongation process on Tetrahymena ribosomes as previously revealed in the yeast system. It was also shown that the ribosomal nucleotidase plays a pivotal role in the elongation cycle in other eukaryotes.View full abstractDownload PDF (973K) -
Eiji Ichimaru, Hideaki Sakai, Takashi Saku, Kazushi Kunimatsu, Yuzo Ka ...1990 Volume 108 Issue 6 Pages 1009-1015
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe nature and levels of hemoglobin (Hb)-hydrolyzing acidic proteinases including cathepsin D and cathepsin E, which were most active at pH 3.5-4.0, were enzymatically and immunochemically compared between human and rat neutrophils. By subcellular fraction-ation and immunoprecipitation with discriminative antibodies specific for each enzyme, cathepsin D was shown to be present in the granular content fraction of both human and rat neutrophils and to account for about 35% of the total Hb-hydrolyzing activity. Cathepsin E was observed mainly in the cytoplasmic fraction of rat neutrophils from peripheral blood and peritoneal exudates and accounted for about 65% of the total activity, but it was not detected in human blood neutrophils. Immunoelectron microscopy on rat neutrophils revealed that cathepsin D was exclusively confined to lysosomes, whereas cathepsin E was localized mainly in the cytoplasmic matrix and often in the perinuclear spaces and the rough endoplasmic reticulum. The non-cathepsin D activity in human neutrophils, which represented about 65% of the total activity, appeared to be due to a serine proteinase, since it was inhibited by diisopropyl fluorophosphate and phenylmethylsulfonyl fluoride and was not inhibited by agents specific for aspartic-, cysteine-, or metallo proteinases. The enzyme(s) responsible for this activity was largely associated with the granular mem-branes, and a half of it could be described as an integral membrane protein on the basis of phase separation with Triton X-114 at 35°C. The levels of these Hb-hydrolases in gingival crevicular fluid from human chronic inflammatory periodontitis patients were examined in order to clarify their participation in the periodontal tissue breakdown. The results suggested that cathepsin D and the serine proteinase found in human neutrophils were associated with periodontal tissue breakdown and that cathepsin E was not expressed in the elicited neutrophils.View full abstractDownload PDF (2029K) -
Masahiko Numata, Takashi Saito, Takeshi Yamazaki, Yoshihiro Fukumori, ...1990 Volume 108 Issue 6 Pages 1016-1021
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSCytochrome P-460 of Nitrosomonas europaea [Erickson, R.H. and Hooper, A. B. (1972) Biochim. Biophys. Acta 275, 231-244] was further purified to an electrophoretically homogeneous state. The cytochrome molecule was composed of three molecules of subunits with Mr of 17, 300-18, 500, and contained three atoms of iron, which seemed to be heme iron, and six cysteine residues, but did not contain nonheme iron or inorganic sulfide. The cytochrome showed absorption peaks at 460 and 688 nm with a broad shoulder at 635 nm in the reduced form. The ESR spectrum of ferricytochrome P-460 showed signals at g=5.91, 5.63, and 1.99, indicating that the protein was a high spin hemoprotein. The heme of the cytochrome was not cleaved by the methods which were available for cleavage of heme c. The pyridine ferrohemochrome of the hemoprotein did not show the distinct α and β peaks which are shown by the ferrohemochromes of many other cytochromes so far known. The N-terminal amino acid sequence of cytochrome P-460 differed from that of hydroxylamine oxidoreductase. Therefore, cytochrome P-460 did not seem to be the solubilized P-460 moiety of hydroxylamine oxidoreductase, in agreement with the finding by D.J. Miller et al. [J. Gen. Microbiol. 130, 3049-3054 (1984)]. However, cytochrome P-460 had several enzymatic activities which hydroxylamine oxidoreductase showed. Although most of the activities of the cytochrome were lower than the corresponding activities of the oxidore-ductase, the hydroxylamine-cytochrome c-552 reductase activity of the cytochrome was about 5-times as high as that of the oxidoreductase.View full abstractDownload PDF (1917K) -
Katsuyoshi Mihara1990 Volume 108 Issue 6 Pages 1022-1029
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe cosmid library of rat genomic DNA was screened with the coding region of microsomal stearoyl-CoA desaturase (SCD) cDNA as the probe. Two independent clones having 36 kb (SCDI) and 31 kb (SCDII) of inserts were isolated. Southern mapping analyses revealed that SCDI codes for SCD and SCDII for an SCD-homologue, and that the genes differ markedly in the upstream regulatory regions. Nucleotide sequence analysis of SCDI revealed that the SCD gene is organized with 6 exons and 5 introns spanning about 15 kb, thus coding an mRNA with an open reading frame of 1, 074 by of the desaturase. Transcription starts at 114 by upstream of the translation initiation codon, and 32 by upstream of the transcription initiation site there is a TATA box. A sequence similar to Fat Specific Element 2 (FSE2), the negative regulatory element of adipocyte differentiation, was present at 45 by upstream of the TATA box. The tissue distribution and induction due to dietary manipulation of SCDI and SCDII mRNAs as revealed by Northern hybridization were markedly different from each other.View full abstractDownload PDF (3632K) -
Shirou Kirita, Toshihide Hashimoto, Masato Kitajima, Shin-ichiro Honda ...1990 Volume 108 Issue 6 Pages 1030-1041
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSA bovine genomic library was constructed using a cosmid vector, pHC79, and bovine DNA partially digested by EcoRI. Bovine P-450(11β) cDNA, pcP-450(11β)-2 [Morohashi et al. (1987) J. Biochem. 102, 559-568], was used as a probe for screening the genomic library. Ten clones carrying P-450(11β) genomic DNA were isolated from 8×104 colonies and classified into five groups (CB11, β-1, CB11, β-3, CB11β-7, CB11β-20, and CB11β-21) according to differences in the restriction endonuclease sites. Nucleotide sequences of amino acid coding regions of the five clones were determined by the dideoxy sequencing method using synthetic nucleotides corresponding to various parts of the cDNA as primers. The nu-cleotide sequences revealed that three clones, CB11β-1, CB11β-3, and CB11β-21, were pseudogenes. Amino acid sequences coded by the other two clones, CB11β-7 and CB11β-20, were identical with that coded by a previously described cDNA, pcP-450(11β)-3 [Kirita et al. (1988) J. Biochem. 104, 683-686]. The promoter regions of the five clones were introduced in front of chloramphenicol acetyltransferase (CAT) gene of pSVOOCAT and used to examine P-450(11β) gene regulation in cultured cells. The five recombinant plasmids showed cAMP-responsive CAT activities in Y-1 cells, a cell strain derived from adrenal tumor. The induction rates of the recombinant plasmids carrying the promoters of normal genes, CB11, β-7 and -20, were larger than those of pseudogenes, CB11β-1, -3, and -21. CAT activities expressed by the promoter regions of the normal genes in the presence or absence of cAMP in Y-1 cells were almost equal to that by the promoter region of human P-450(SCC) gene. Though the promoter of the P-450(SCC) gene also showed cAMP-responsive CAT activity in 1-10 cells, a cell strain derived from Leyding cell tumor, P-450(11β) gene promoter did not express the activity in I-10 cells.View full abstractDownload PDF (2798K) -
Shin-ichiro Honda, Ken-ichirou Morohashi, Tsuneo Omura1990 Volume 108 Issue 6 Pages 1042-1049
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSIn order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11β) genes, we analyzed the promoter region using chloramphenicol acetyltransfer-ase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB 11β-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at 331 bp to -324 bp in the promoter region of the P-450(11 β) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11β) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11β) gene, and named them Ad5 and Ad6. However, these two sequences do not seem to contribute to the cAMP induction of the gene.View full abstractDownload PDF (2394K) -
Ken-ichirou Morohashi, Tsuneo Omura1990 Volume 108 Issue 6 Pages 1050-1056
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe transcriptional activity of P-450(11β) gene was studied with an in vitro transcription system using nuclear extracts prepared from bovine adrenal cortex. Template plasmids were constructed with the promoter region of the bovine P-450(11β) gene and a G-less cassette as a reporter gene. Deletion analysis of the promoter region revealed two neighboring sites, Adl and Ad2, which are necessary for efficient transcription of the templates. These sites are highly conserved among bovine, mouse, and human genes. Though the Adl site, TGACGTGA, showed high homology to the consensus sequence of the cAMP-responsive element, TGACGTCA, with one base substitution, the Ad2 site showed no similarity to any regulatory element reported so far. Gel shift assay using synthetic nucleotides containing Adl and/or Ad2 indicated that three factors bound to these regions in adrenal cortex nuclear extract, two factors to Ad2 and one factor to Ad1. DNase I footprint analysis also showed the binding of factors to the Ad1 and Ad2 regions. Catenated synthetic nucleotides containing Adl and/or Ad2 inhibited the transcriptional activity of P-450(11β) gene. The P-450(11β) promoter expressed a stronger transcriptional activity in the nuclear extract of adrenal cortex than in that of liver. On the other hand, the promoter of αl-antitrypsin gene, which is expressed only in liver, showed an opposite tissue specificity of transcription. Addition of aderenal cortex nuclear extract to liver nuclear extract activated specifically the P-450(11β) promoter in proportion to the quantity of adrenal cortex nuclear extract added. The enhancing effect of the adrenal cortex nuclear extract suggested that the factors detected in the nuclear extract of adrenal cortex are necessary for the transcription of P-450(11β) genes.View full abstractDownload PDF (3510K) -
Hiroaki Kitajima, Takeo Yamaguchi, Eiji Kimoto1990 Volume 108 Issue 6 Pages 1057-1062
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe effects of cross-linking of membrane proteins on hemolysis of human erythrocytes under high pressure (2.0 kbar) were examined. The membrane proteins were cross-linked by oxidation of their SH-groups with diamide (0.05-0.5 mM) under different pressures (1-1, 000 bar) at which no hemolysis occurs. As the pressure during diamide treatment was raised, the degree of hemolysis under 2.0 kbar and the quantity of cytoskeletal proteins extracted in a low ionic strength medium were gradually decreased. However, both values were increased by reduction with dithiothreitol. From the determination of membrane SH-groups, it was found that cross-linking of membrane proteins by diamide was acceler-ated under pressure. Only in erythrocytes treated with diamide under pressure were parts of spectrin and ankyrin, in addition to band 3 and band 4.2 proteins, extracted by using Triton X-100. One- and two-dimensional SDS-PAGE of membrane proteins showed that cross-linking of the membrane with cytoskeletal meshwork through linking proteins, in addition to that of membrane proteins themselves, was formed only in the diamide treatment under pressure. These results indicate that pressure-induced hemolysis is greatly suppressed by the supramolecular-weight polymers formed among membrane proteins, and that the high pressure technique is useful for cross-linking membrane proteins with diamide.View full abstractDownload PDF (1820K) -
Takao Isogai, Hiroki Ono, Yohsuke Ishitani, Hitoshi Kojo, Yoshio Ueda, ...1990 Volume 108 Issue 6 Pages 1063-1069
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSD-Amino acid oxidase (DAO) was extracted and purified from cultured mycelia of Fusarium solani M-0718 (FERM P-2688).The enzyme was able to oxidatively deaminate cephalosporin C to 7-β-(5-carboxy-5-oxopentanamido) cephalosporanic acid. Ninety-eight amino acid residues of the F. solani DAO were determined by sequence analysis of 9 peptides derived from Acromobacter protease I digests of the protein. Complementary DNAs encoding F. solani DAO were isolated from the F. solani cDNA library by hybrid-ization with synthetic oligonucleotide probes corresponding to the partial amino acid sequences. Analysis of the nucleotide sequences of the clones revealed a 1, 186-nucleotide sequence with a 5' -terminal untranslated region of 41 nucleotides, an open reading frame of 1, 083 nucleotides that encoded 361 amino acids, and a 3'-terminal untranslated region of 62 nucleotides. The amino acid sequence of F. solani DAO had 25% homology to that of porcine kidney DAO [EC 1.4.3.3] and 37% homology to that of Trigonopsis variabilis DAO. The constructed plasmid overproduced F. solani DAO in Escherichia colt. The recombinant DAO had almost the same molecular activity as the native DAO against cephalosporin C.View full abstractDownload PDF (1875K) -
1990 Volume 108 Issue 6 Pages 1070b
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSDownload PDF (18K) -
1990 Volume 108 Issue 6 Pages 1070a
Published: 1990
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSDownload PDF (18K)
- |<
- <
- 1
- >
- >|