All issues
Volume 124 (1998)
- Issue 6 Pages 1051-
- Issue 5 Pages 869-
- Issue 4 Pages 687-
- Issue 3 Pages 473-
- Issue 2 Pages 251-
- Issue 1 Pages 1-
Volume 124, Issue 3
Displaying 1-29 of 29 articles from this issue
- |<
- <
- 1
- >
- >|
-
Shinji Asakura, Wei Yang, Jane Sottile, Qinghong Zhang, Yong-ming Jin, ...1998 Volume 124 Issue 3 Pages 473-484
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSHigh molecular weight kininogen (HK) blocks cell spreading but not cell attachment to surfaces coated with vitronectin and other ligands of β3 integrins. We sought to learn the structural basis of this phenomenon. Monoclonal antibodies against the histidine-rich D5 domain in the light chain of 2-chain HK abolished the inhibitory effect of 2-chain HK on spreading of MG-63 osteosarcoma cells on vitronectin-coated tissue-culture plastic. The antibodies were effective only if incubated with 2-chain HK in solution and did not abolish the anti-cell-spreading effect of 2-chain HK that was pre-adsorbed to tissue-culture plastic. Exposure of an epitope in the histidine-rich domain was less when HK was adsorbed to tissue-culture plastic (oxidized polystyrene) than when it was adsorbed to ELISA plastic (untreated polystyrene). Loss of the epitope correlated with increased anti-cell-spreading activity of HK on tissue-culture plastic. The light chain of 2-chain HK containing D5 and that containing recombinant D5 both had anti-cell-spreading activity, but only when present in solution during adhesion assays. Pre-adsorption of recombinant D5 to tissue-culture plastic resulted in a surface on which adsorbed 2-chain HK had little anti-cell-spreading activity. Binding study revealed that HKa bound to immobilized vitronectin. The histidine-rich D5 domain of light chain of HK was identified as one of the binding sites of vitronectin, suggesting that the masking of the RGD cell-binding site of immobilized vitronectin is the molecular mechanism of anti-cell-spreading effect of HKa. In contrast, low molecular weight kininogen (LK), which lacks D5, augmented cell spreading on vitronectin-coated tissue-culture plastic. Thus, HK and LK have opposing effects on VN-dependent cell adhesion. The augmenting effect of LK was greater if LK was preincubated with cells or adsorbed to the surface at pH>7.0. Analysis of fragments of LK and antibody inhibition studies localized the cell-adhesion activity to the D3 domain that is common to LK and HK. These findings indicate that the D5 domain mediates the adsorption of HK or 2-chain HK to vitronectin substratum in anti-adhesive conformations, i.e., masking of the RGD cell-binding site of vitronectin. Such conformers inhibit cell spreading on vitronectin even though a cell-adhesion site is present in D3.View full abstractDownload PDF (7151K) -
Takao Ueno, Masayuki Hara, Naoki Kamo, Takaaki Fujii, Jun Miyake1998 Volume 124 Issue 3 Pages 485-490
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSControl of the unidirectional topological orientation was achieved for a cross-linked complex composed of the bacterial photosynthetic reaction center and horse heart cytochrome c (RC/cyt c) reconstituted into proteoliposomes. Using the method of Ueno et al. [Ueno et al. (1995) Mater. Sci. Eng. C3, 1-6], we prepared RC/cyt c by conjugating cyt c to the H-subunit of RC of Rhodobacter sphaeroides R-26 using a bifunctional cross-linking reagent, N-succinimidyl 3-(2-pyridyldithio)propionate (SPDP), as previously reported. The freeze-thaw method was used to incorporate RC/cyt c into liposomes that contained dipalmitoyl-L-α-phosphatidylcholine and dipalmitoyl-L-α-phosphatidylglycerol (1:9). The topological orientation of RC/cyt c in the proteoliposomes was determined using three methods: (i) release of the cyt c moiety from the proteoliposomes by cleaving the disulfide bond in the linker residue, (ii) electron transfer from free cyt c outside the proteoliposomes to the RC moiety, and (iii) photo-induced membrane potential of RC- and RC/cyt c-reconstituted proteoliposomes. The results indicated that about 90% of the RC/cyt c in proteoliposomes was oriented with the H-subunit exposed on the outside of the liposomes, whereas only about 60% of the RC in proteoliposomes had this orientation. Thus, we successfully controlled the unidirectional topological orientation of the RC moiety in liposomes using the RC/cyt c complex.View full abstractDownload PDF (1828K) -
Yutaka Furutani, Akira Kato, Hiroshi Yasue, Leeson J. Alexander, Craig ...1998 Volume 124 Issue 3 Pages 491-502
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSTrappins are a group of secretory proteins containing a WAP motif with an anchoring domain. Previous studies showed that their genes, especially those of pig, have undergone rapid evolution, which produced trappins with a broad spectrum of actions. To understand the evolution of such a rapidly evolving multigene family, we isolated trappin genes of the Artiodactyla, including pig, wart hog, collared peccary, hippopotamus, and cow, by means of polymerase chain reaction (PCR). Two genes newly isolated from wart hog are orthologs of trappin-1 (SPAI) and trappin-2 (elafin), the others are novel members of the trappin family and named trappins-6 to 11. The divergence of the sequences is greatest in the region that encodes the reactive site, and intron sequences appear to be more highly conserved than the protein-coding sequences, especially among the pig paralogs. Phylogenetic analysis showed that the trappin multigene family members of pig were generated through gene duplication after the divergence of the Suidae (pig and wart hog) and Tayassuidae (collared peccary). Similarities in the gene structure with seminal vesicle clotting proteins (REST) and WAP motif-containing proteins suggest that trappins are naturally occurring fusion proteins created through exon shuffling between ancestral REST and WAP motif-coding genes.View full abstractDownload PDF (6464K) -
Yukio Yamamoto, Mayumi Ishizuka, Ayato Takada, Shoichi Fujita1998 Volume 124 Issue 3 Pages 503-508
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSWe cloned two novel cytochrome P450 cDNAs (CYP2D23 and CYP2D24) from a rabbit liver cDNA library. The open-reading frames of these cDNAs encode proteins that are each composed of 500 amino acids. The amino acid sequence identity of CYP2D23 with CYP2D24 is 91.6%, and the homology of these two isozymes with other known mammalian CYPs in the CYP2D subfamily range from 64.9 to 79.8%. Using RT-PCR, we determined the distribution of these two isozymes in 9 major organs, including brain tissue sections. CYP2D23 mRNA was abundantly expressed in the liver and small intestine, but only slightly in the brain sections, whereas CYP2D24 mRNA was expressed in the liver, small intestine, and stomach. CYP2D23 and CYP2D24 were heterogeneously expressed in 293T cells. CYP2D24 effectively catalyzed the oxidation of bufuralol and bunitrolol, the archetypal substrates of the CYP2D subfamily, while CYP2D23 exhibited catalytic activity only toward bufuralol. The results of this first study on rabbit CYP2D isozymes indicate that CYP2D23 and CYP2D24 are functionally expressed in rabbits, and have different organ distributions and metabolic properties.View full abstractDownload PDF (1654K) -
Hiroyuki Kuma, Kaori Inoue, Guohui Fu, Setsuko Ando, Sannamu Lee, Gohs ...1998 Volume 124 Issue 3 Pages 509-518
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe conformations of synthetic peptides corresponding to the first membrane-contact portion from Tyr390 to Lys430 of band 3 (band 3-1a) and the counterpart portion of South-East Asian ovalocytosis (SAO) band 3 (band 3-1b) in lipid bilayers were examined-by means of circular dichroism (CD), Fourier transform infrared (FTIR) spectroscopy as well as a proteolytic digestion method. The CD and FTIR studies showed that band 3-1a and band 3-1b in a membrane lipid bilayer cannot assume an α-helix rich structure but instead assume a β-structure rich conformation. The proteolytic digestion experiments demonstrated that the cleavage sites of Tyr392 and Phe423 were common to both the model and erythrocyte membranes. Taken together with our previous work, which indicated that the first membrane-contact portion was the portion embedded in the erythrocyte membrane without tight lipid-peptide interactions [Hamasaki et al. (1997) J. Biochem. 122, 577-585], we imply herein that the first membrane-contact portion of band 3 by itself can not assume the ordinary α-helix conformation in the membrane lipid bilayers. A proteinase-resistant portion, from Ser402 to Phe423, was observed when liposomes containing band 3-1a were digested with proteinase K, while no proteinase-resistant core portion was found in the case of band 3-1b (ΔAla400-Ala408). This suggests the crucial role of the deleted portion, from Ala400 to Ala408, in the interaction of the first membrane-contact portion of band 3 with a membrane lipid bilayer.View full abstractDownload PDF (4447K) -
Yoshiko Yumoto, Hitoshi Shirakawa, Michiteru Yoshida, Akira Suwa, Fumi ...1998 Volume 124 Issue 3 Pages 519-527
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe DNA-dependent protein kinase (DNA-PK) holoenzyme consists of a 470-kDa catalytic subunit (DNA-PKcs), a DNA-binding regulatory component known as Ku protein, and double-stranded DNA (dsDNA) with ends. We previously reported that the activity of DNA-PK in vitro is stimulated by non-histone chromosomal high mobility group proteins (HMG) 1 and 2 comprising two similar repeats, termed domains A and B, and an acidic C-terminal. Here we demonstrate that in vitro HMG1 and 2 can completely replace Ku protein as the DNA-binding regulatory component of DNA-PK. DNA-PKcs and Ku protein were separately purified from Raji nuclear extracts, and reconstituted into the DNA-PK holoenzyme in the presence of dsDNA. DNA-PKcs alone catalyzed DNA-dependent phosphorylation at a very low but significant level, and HMG1 and 2 markedly stimulated the phosphorylation of α-casein and a specific peptide substrate in a DNA-dependent manner. The HMG2-domains (A+B) polypeptide devoid of the C-terminal acidic region was more effective for DNA-PKcs stimulation than the full-length HMG2, and HMG2-domain A and -domain B polypeptides. Anti(Ku protein) antibodies inhibited the DNA-dependent phosphorylation activity of the DNA-PKcs: Ku protein complex, but not that of DNA-PKcs alone or when it was complexed with HMG1 or 2. These results demonstrate that HMG1 and 2 can function as the DNA-binding regulatory component for DNA-PKcs in vitro, and imply that a conformational change of dsDNA, which is elicited by regulatory components, is important for the stimulation of DNA-PK activity of DNA-PKcs.View full abstractDownload PDF (4256K) -
Shinsaku Maruta, Kazuaki Homma1998 Volume 124 Issue 3 Pages 528-533
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSActin binding to skeletal muscle myosin subfragment-1 (S1) increases the dissociation rate of reaction products from the myosin ATPase site; conversely, ATP binding facilitates dissociation of complexed acto-S1. However, details of the molecular mechanism by which the ATP- and actin-binding sites communicate with each other is still obscure. We present evidence that the effect of actin is mediated by a conformational change in the loop containing amino acids from 677 to 689 [loop M (677-689)], a segment of the 20-kDa tryptic fragment that contributes to the structure of the ATP-binding cleft. Initially, a fluorescent ADP analogue, methylanthranyloyl-8-azido-ADP (Mant-8-N3-ADP), was covalently cross-linked to loop M (Mant-S1), perhaps at Lys 681. Actin-activated Mg2+-ATP hydrolysis by Mant-S1 was accelerated approximately 6 times over that by unmodified S1, suggesting that the ATPase site is not blocked by the ADP analogue crosslinked in the loop M (677-689). Nevertheless, analysis of Mant-group fluorescence polarization and acrylamide-induced quenching showed the crosslinked probe to be entrapped within the ATP-binding cleft at a location where Mant-group rotational mobility was hindered, and where it was relatively inaccessible to the solvent. Exposing Mant-S1 to Mg2+-ATP and/or actin elicited similar decreases in fluorescence polarization, indicating increased rotational mobility of the Mant-group and movement of crosslinked Mant-8-N3-ADP to a less hindered position. Stern-Volmer quench curves showed that Mant-8-N3-ADP was translocated to a site where it was more accessible to dissolved quencher, perhaps outside the ATP-binding cleft. Since actin does not bind to the ATPase site, actin-induced translocation of Mant-8-N3-ADP crosslinked to loop M (677-689) probably results from a conformational change in loop M (677-689). These results suggest that loop M acts as a signal transducer mediating communication between the ATP- and actin-binding sites.View full abstractDownload PDF (4605K) -
Takuya Imamura, Naka Hattori, Kunio Shiota, Tomoya Ogawa1998 Volume 124 Issue 3 Pages 534-539
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSWith the aim of identifying molecules that are expressed specifically in the brain during neurogenesis, we tried to generate monoclonal antibodies which recognize molecules showing unique temporal expression patterns and molecular characteristics. We used a homogenate of the rat fetal forebrain (day 12 of fetal life, E12) as an immunogen, and antibodies which reacted with this preparation were screened by immunoblotting. One of the antibodies, Mab3C8, recognized a 100-kDa antigen that is enriched in fetal brain. This 100-kDa antigen was constantly expressed during fetal life (from E12 to E20) and became scarcely detectable two days after birth. The antigen was detected in the insoluble fraction of fetal brain and its isoelectric point ranged from 6 to 7, suggesting that it was a membrane-coupled glycoprotein. Analysis by glycosidase treatment and lectin blotting suggested that it was an O-linked glycoprotein with an α2, 6 sialyl linkage. Thus, a molecule unique to the fetal brain, an O-linked sialoglycoprotein with a molecular mass of 100 kDa (FOG100), was found by generating an antibody.View full abstractDownload PDF (3161K) -
Noriaki Takabatake, Masayoshi Souri, Akitada Ichinose1998 Volume 124 Issue 3 Pages 540-546
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSVarious Kringle 4 (K4) sequences were identified in human genomic clones and genomic DNAs amplified by PCR. These K4s were homologous to those found in the apo (a) gene and thus termed apo (a)-related genes (ARGs). The same sequences were obtained when human peripheral leukocytes were analyzed by reverse transcription-PCR in order to study the expression mode of the ARGs. It was of note that multiple transcripts with three optional exons for an ARG (ARGII) were detected in leukocytes, indicating that they were generated by alternative splicing. All these transcripts possessed the first half of the second K4 sequence, which had been reported to be skipped. The variant products of ARGII are expected to contain an additional region of either 44, 66, or 100 unique amino acids at the C-terminus of a single K4 unit. When normal human tissues and cultured tumor cells were analyzed, the multiple ARGII transcripts were detected at varying levels. The presence of the cellular state-specific alternative splicing machinery may provide not only redundancy but also diversity in the structure/function of ARGII.View full abstractDownload PDF (4638K) -
Hiroki Konno, Hidekazu Matsuya, Masayuki Okamoto, Tomohiko Sato, Yasuf ...1998 Volume 124 Issue 3 Pages 547-556
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSProdigiosin, metacycloprodigiosin, and prodigiosin 25-C all inhibited the acidification activity of submitochondrial and bacterial (Escherichia coli) F-ATPases (F0F1-ATPases) strongly (IC50=20-30 and 24-30 pmol/mg protein, respectively), without affecting significantly the ATP hydrolysis activity. Their effect on the acidification activity was rapid and reversible, showing non-competitive apparent K1 values of the order of nM to sub-nM. However, unlike FCCP (an ordinary uncoupler of oxidative phosphorylation), they showed no protonophoric activity, as demonstrated by the absence of acceleration of ATP hydrolysis. Prodigiosins also inhibited the acidification of proteoliposomes reconstituted from phospholipids and purified F-ATPase of E. coli, suggesting that their acidification-inhibitory effect is not due to the inhibition of anion channels. They did not, however, inhibit the ATP-dependent formation of membrane potential of F-ATPase vesicles. Furthermore, they inhibited and quickly reversed acidification by F-ATPase only in the presence of chloride, and not in the presence of gluconate anion. Finally, they induced swelling of liposomes and submitochondrial particles in isotonic solution of ammonium chloride but not ammonium gluconate, suggesting that intravesicular entry of Cl- is promoted by prodigiosins. These results suggest that prodigiosins uncouple F-ATPases through promotion of H+/Cl- symport (or OH-/Cl- exchange) across vesicular membranes.View full abstractDownload PDF (1049K) -
Shinsaku Maruta, Shinya Mitsuhashi, Misato Yamada, Mitsuo Ikebe1998 Volume 124 Issue 3 Pages 557-564
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe vanadate (Vi)-mediated photocleavage reaction was used to study the interaction between the regulatory segment and the catalytic site of smooth muscle myosin light chain kinase (MLCK). When MLCK was irradiated with long-wave UV (366 nm) in the presence of ADP and Vi, kinase activity was substantially decreased, and the MLCK polypeptide of 130 kDa was cleaved into several smaller fragments with apparent molecular masses of 100, 70, 60, 32, and 28 kDa. Inhibition of kinase activity and photocleavage were both competitively antagonized by the addition of ATP. Inconsistency between the observed maximum levels of UV-induced inhibition of MLCK-mediated phosphorylation (80%) and photocleavage (15-20%) suggested that the photocleavage reaction proceeds as a two-step process. Monoclonal antibodies recognizing the C-terminus of MLCK labeled the 60- and 28-kDa fragments, indicating that MLCK was cleaved at two sites, at 28 and 60 kDa from the C-terminus, within what are believed to be the autoinhibitory region and the catalytic site, respectively. Moreover, Ca2+-calmodulin (Ca2+-CaM) protected against cleavage at the site at 28 kDa from the C-terminus. Analysis of the amino acid composition of the fragment revealed that the cleavage site at 28 kDa from C-terminus occur red at Lys 799±3 amino acid residues, which is in a region where the CaM-binding and pseudosubstrate regions overlap. These results suggest that the three-dimensional structure of MLCK brings the regulatory segment into direct contact with the ATP-binding site. Moreover, the binding of Ca2+-CaM displaces the regulatory segment away from the catalytic site.View full abstractDownload PDF (2730K) -
Kiyoshi Yuri, Jun'ichi Wakayama, Takenori Yamada1998 Volume 124 Issue 3 Pages 565-571
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe isometric contractile properties of single myofibrils of rabbit skeletal muscle were studied at various sarcomere lengths. Single myofibrils were suspended between the tips of one rigid and one flexible glass microneedle, and their force production was determined by detecting the bending of the flexible microneedle photo-electronically. The active force vs. sarcomere length relation had an ascending limb (0.7-2.25 μm), a plateau (2.25-2.5 μm), and a descending limb (2.5-3.8 μm), which was similar to that of frog skeletal muscle. The passive force became increasingly apparent beyond a sarcomere length of 2.4 μm. These results can reasonably be explained based on the sliding filament mechanism by assuming the sarcomere geometry of rabbit muscle. The plateau, with a produced force of about 256 kN/m2, and the linear decline of force in the descending limb of the single myofibrils were essentially the same as those for frog muscle fibers. However, the slope of the force decline in the ascending limb was far steeper than that for frog muscle. This suggests that internal elements of sarcomeres are different between rabbit and frog muscles.View full abstractDownload PDF (2794K) -
Takashi Aoki, Miyoko Satoh, Hiroyuki Watabe1998 Volume 124 Issue 3 Pages 572-577
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSHuman pepsinogen (PG) A and C were fused with protein A and expressed in Escherichia coli. Although the fusion proteins (PA-PGA and PA-PGC) were not expressed at high levels and were almost totally recovered from the insoluble fraction, the renaturation and purification procedures were easy and simple. PA-PGA and PA-PGC possessed proteolytic activity equivalent to the gastric mucosal PGA and PGC, respectively. However, the activity of PA-PGC was about 3-fold higher than that of PA-PGA. Therefore, PA-PGC was applied to the subsequent immunoblotting studies. The proteolytic activity of PA-PGC was used for digesting the blocking reagent around the target antigen (in situ digestion method) or casein-clotting in the agarose plate containing skimmed milk (caseogram print method). Although the sensitivity of these methods was lower than that of the conventional color detection, the caseogram print method was superior in that the reaction was linear over a wide range. On the other hand, the in situ digestion method possessed a unique property on Western blotting, and it was very easy to identify the relative position of the target, which could be recognized as a clear band. For PA-PGC detection, no special chemicals are required, and so the procedure is simple, rapid, and inexpensive.View full abstractDownload PDF (3755K) -
Shinsaku Maruta, Kazuaki Homma, Takashi Ohki1998 Volume 124 Issue 3 Pages 578-584
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSMyosin forms stable ternary complexes with Mg2+-ADP and phosphate analogues of aluminum fluoride (AlF4-), beryllium fluoride (BeFn), and scandium fluoride (ScFn). These complexes are distinct from each other and may mimic different transient states in the ATPase cycle [Maruta et al. (1993) J. Biol. Chem. 268, 7093-7100]. Regions of skeletal muscle myosin containing the highly reactive residues Cys 707 (SH1), Cys 697 (SH2), and lysine 83 (RLR) dramatically alter their local conformation when myosin hydrolyzes ATP, and these changes may reflect formation of a series of transient intermediates during ATP hydrolysis. We used the fluorescent probes 4-fluoro-7-sulfamoylbezofurazan, 2-(4'-maleimidylanilino) naphthalene-6-sulfonic acid, and trinitrobenzene-sulfonate, which bind to SH1, SH2, and RLR, respectively, to examine differences in local conformations within myosin•ADP•phosphate analogue (BeFn, V1, AlF4-, and ScFn) complexes. It was observed that the ternary complexes had SH1 conformations similar to those seen on S-1 in the presence of ATP. In contrast, local conformations in the SH2 and RLR regions of S-1•ADP•BeFn were different from those in corresponding regions of S-1•ADP•AlF4- or ScFn. These results suggest that SH1 and SH2 move distinctly during ATP hydrolysis and that the local conformations of the SH2 and RLR regions more sensitively reflect different transient states.View full abstractDownload PDF (1820K) -
Keiro Shirotani, Tatsuro Irimura1998 Volume 124 Issue 3 Pages 585-590
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSTranscriptional regulation of the MUC1 mucin gene in KM12C human colon carcinoma cells, which is induced by a soluble stimulatory factor derived from normal colonic connective tissues, was investigated. The minimum responsive element that was sufficient for this upregulation by the soluble factor is the upstream sequence of the MUC1 mucin gene from -531 to -488. Several factors in nuclear extracts of KM12C cells bound to this sequence in gel retardation assays. Neither the quantities nor the mobilities of the retarded bands changed on treatment with the soluble factor. Mutagenesis within the region from ACAGGGAGCGGTTAGAAGGGTGGGGCTATTCCGGGAAGTGGTGG to ACAGGGAGCGGTT-AGAATTT-TGGGGCTATTCCGGGAAGTGGTGG (underlined letters were mutated) substantially decreased the induction of the MUC1 mucin gene by the soluble factor. Two retarded bands were observed when the unmutated sequence was used as a probe; the bands disappeared when the mutated sequence was used as a probe. These results indicate that factors corresponding to each band were responsible for the upregulation of the MUC1 mucin gene, although the quantities of these proteins and their affinity to the nucleotide sequence did not change during the induction. Purification of the protein components comprising each band by a combination of column chromatographies indicated that one band contained four proteins (111, 106, 101, and 95 kDa) and the other consisted of two proteins (66 and 64 kDa).View full abstractDownload PDF (2670K) -
Takashi Ohmoto, Toshihiko Kinoshita, Kunihiko Moriyoshi, Kiyofumi Saka ...1998 Volume 124 Issue 3 Pages 591-597
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSA 2-hydroxychromene-2-carboxylate isomerase was purified from a cell-free extract of naphthalenesulfonate-assimilating Pseudomonas sp. TA-2 to an electrophoretically homogeneous state by successive column chromatography on DEAE-cellulose, DEAE-Toyopearl 650M, Sephadex G-75, Hydroxyapatite, and Mono Q. The enzyme had a molecular mass of 25 and 27 kDa as estimated by SDS-PAGE and Superdex 200, respectively. Its N-terminal 30 amino acid sequence had high homology with the deduced amino acid sequences of the 2HC2CA isomerase of nahD (a gene of naphthalene metabolism), pahD (a gene of naphtha-lene and phenanthrene metabolism), and doxJ (a gene of dibenzothiophene metabolism). The enzymatic product was a trans isomer. The isomerase activity was inhibited in the presence of monoiodoacetate or Hg2+, but not by preincubation with monoiodoacetate or N-ethylmaleimide. GSH functioned as a cofactor and activated the enzyme at above 0.15mM.View full abstractDownload PDF (1948K) -
Mamoru Yamanishi, Seiki Yamada, Atsuhiko Ishida, Jun Yamauchi, Tetsuo ...1998 Volume 124 Issue 3 Pages 598-601
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSEPR spectra were measured upon incubation of the complex of diol dehydratase with coenzyme analogs in the presence of 1, 2-propanediol, a physiological substrate. When the analog in which the D-ribose moiety of the nucleotide loop was replaced by a trimethylene group was used as coenzyme, essentially the same EPR spectrum as that with adenosyl-cobalamin was obtained. The higher-field doublet and the lower-field broad signals derived from an organic radical and low-spin Co (II) of cob (II) alamin, respectively, were observed. With the imidazolyl counterpart, base-on cob (II) alamin-like species accumulated, but signals due to an organic radical quickly disappeared. When a coenzyme analog lacking the nucleotide moiety was incubated with apoenzyme in the presence of substrate, the EPR spectrum resembling cob (II) inamide was obtained, but no signals due to an organic radical were observed. From these results, it was concluded that the extinction of organic radical intermediates results in inactivation of the enzyme by these coenzyme analogs. Upon suicide inactivation with a [15N2]imidazolyl analog, the octet signals due to Co (II) showed superhyperfine splitting into doublets, indicating axial coordination of 5, 6-dimethylben-zimidazole to the cobalamin bound to diol dehydratase.View full abstractDownload PDF (435K) -
Hiroki Sano, Sho Takahashi, Takayoshi Iio1998 Volume 124 Issue 3 Pages 602-608
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSWe studied Ca2+-dependent structural change of rabbit skeletal troponin C (TnC)-melittin (ME) complex as a model of TnC-troponin I complex. In previous study, we found that the distance between Met-25 and Cys-98 of TnC in TnC-ME complex increased upon binding of Ca2+ to TnC [H. Sano and T. Iio (1995) J. Biochem. 118, 996-1000]. In this study, we used a fluorescence energy transfer method. As a fluorescent donor, we used the tryptophan residue in four melittin derivatives, in which residue 2, 5, 8, or 13 was replaced with tryptophan. As acceptor, we used dansylaziridine (DANZ) bound to Met-25 of TnC, or N-iodoacetyl-N'-(5-sulfo-1-naphthyl)ethylenediamine (1, 5-I-AEDANS) bound to Cys-98 of TnC. For all TnCDANZ-ME complexes, the donor-acceptor distance (11.9-17.7 Å) did not remarkably depend on Mg2+ or Ca2+ binding of TnC or on the position of tryptophan in ME derivatives. The same results were obtained for TnCAEDANS-ME complexes in the absence of Ca2+ (distance 15.2-21.7 Å). But in the presence of Ca2+, tryptophan residues in the central region of ME were near to Cys-98 of TnC (distance much less than 10.4 Å). Based on these results, we conclude that ME is enfolded by the N- and C-lobes of TnC, and the ME rod is almost perpendicular to a line connecting Met-25 and Cys-98 of TnC. The position of the ME rod shifts upon binding of Ca2+ to TnC.View full abstractDownload PDF (3983K) -
Yuichi Hiratsuka, Masumi Eto, Michio Yazawa, Fumi Morita1998 Volume 124 Issue 3 Pages 609-614
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSTo detect structural changes around the reactive Cys707 (SH1) in the myosin heavy chain during the ATPase reaction, the reactivity of SH1 in rabbit skeletal myosin subfragment-1 (S-1) was measured using a fluorescent reagent, 5-(iodoacetamidoethyl)aminonaphthalene-1-sulfonic acid, in the presence of various ATP analogs: adenosine 5'-(3-thiotriphosphate) (ATPγS), ADP-vanadate (ADP-V1), ADP-BeFx, and ADP-AlF4. The SH1 reactivities in the S-1 complexes with ATPγS and ADP-BeFx, analogs of the E-ATP state, were very high, as well as that in the E-ADP state. In contrast, the SH1 reactivities in the S-1 complexes with ADP-V1 and ADP-AlF4, analogs of the E-ADP-P state, were extremely low. The structural changes around SH1 can be correlated to changes in the structure of the γ-phosphate of ATP during the ATPase reaction or to the structure of the corresponding part of ATP analogs at the active site of ATPase. This is consistent with the crystal structure of S-1 in which the heavy chain structure around SH1 of S-1-ADP-BeFx is significantly different from those of S-1-ADP-V1 and S-1-ADP-AlF4 [Fisher et al. (1995) Biochemistry 34, 8960-8972; Smith and Rayment (1996) Biochemistry 35, 5404-5417].View full abstractDownload PDF (2860K) -
Keiko Yonekura-Sakakibara, Toshihiko Ashikari, Yoshikazu Tanaka, Taka- ...1998 Volume 124 Issue 3 Pages 615-621
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSA cDNA clone, NtSiR1, that encodes the precursor of ferredoxin-dependent sulfite reductase (Fd-SiR) has been isolated from a cDNA library of tobacco (Nicotiana tabacum cv. SR1). The identity of the cDNA was established by comparison of the purified protein and the predicted structure with the nucleotide sequence. The amino terminus of the purified enzyme was Thr62 of the precursor protein, and the mature region of NtSiR1 consisted of 632 amino acids. Tobacco Fd-SiR is 82, 77, and 48% identical with Fd-SiRs from Zea mays, Arabidopsis thaliana, and a cyanobacterium, respectively. Significant similarity was also found with Escherichia coli NADPH-SiR in the region involved in ligation of siroheme and the [4Fe-4S] cluster. On Northern blot analysis, a transcript of NtSiR1 was detected in leaves, stems, roots, and petals in similar amounts. We also isolated a genomic SiR clone named gNtSiR1. It consists of 8 exons and 7 introns. Genomic Southern blot analysis indicated that at least two SiR genes are present in the tobacco genome.View full abstractDownload PDF (4680K) -
Taeho Ahn, Chul-Ho Yun1998 Volume 124 Issue 3 Pages 622-627
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe mixing properties of anionic phospholipids such as phosphatidic acid (PA), phosphatidylserine (PS), and phosphatidylglycerol (PG) with phosphatidylcholine (PC) were examined in the liquid-crystalline state of membranes using extrinsic fluorescent probes incorporated into lipid bilayers. The excimer to monomer (E/M) fluorescence ratio of 1-hexadecanoyl-2-(1-pyrenedecanoyl)-sn-glycero-3-phosphocholine (PPC) was higher for the PA and PS matrices as compared to that for the PC matrix. When PC was replaced with PA or PS, the E/M ratio of PPC also increased in a concentration-dependent manner. When the concentration of PA or PS was increased in the PC membrane, the fluorescence of 1-palmitoyl-2-[12-[7-nitro-2, 1, 3-benzodiazol-4-yl)amino] dodecanoyl]-sn-glycero-3-phosphocholine decreased, indicating the occurrence of lipid clustering. Direct evidence for the PA or PS-induced phase separation in the PC/PA or PC/PS system was provided by the resonance energy transfer between 2-(4, 4-difluoro-5-methyl-4-boro-3a, 4a-diaza-s-indacene-3-dodecanoly)-1-hexadecanoly-sn-glycero-3-phosphocholine and PPC. The fluorescence polarization of 1, 6-diphenyl-1, 3, 5-hexatriene further supported the lateral organization of membranes by PA and PS. PA and PS also reduced the polarity of lipid bilayers, as measured by the emission fluorescence of 6-lauroyl-2-dimethylaminonaphthalene. On the other hand, PG had very little effect on the PC matrix, suggesting the ideal miscibility with PC molecules. The results suggest that the mixing properties of PA and PS in the PC matrix are not random but that phase separation occurs in the liquid-crystalline phase of membranes.View full abstractDownload PDF (2087K) -
Yoshiro Masuya, Koshiro Hioki, Rikio Tokunaga, Shigeru Taketani1998 Volume 124 Issue 3 Pages 628-633
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe effect of a tyrosine kinase inhibitor, herbimycin A, on the induction of heme oxygenase-1 (HO-1) mRNA in HeLa cells upon exposure to hemin, sodium arsenite and cadmium chloride was examined. The induction of HO-1 mRNA by hemin was inhibited when the cells were pretreated with herbimycin A. Herbimycin also inhibited arsenite- and cadmium-dependent induction of HO-1 mRNA in a dose-dependent manner, but less inhibition was observed in cadmium-treated cells than in ones treated with hemin- or arsenite. Genistein (50 μM), another tyrosine kinase inhibitor, also inhibited the induction of HO-1 mRNA by hemin, arsenite, and cadmium. Nuclear runoff assays revealed that herbimycin blocked the hemin-induced transcription of the HO-1 gene. The induction of HO-1 mRNA by hemin in human peripheral blood mononuclear cells was inhibited by herbimycin. The tyrosine phosphorylation of a protein with a molecular mass of 66 kDa in the cells was increased by hemin- or arsenite-treatment, and this increase was inhibited by treatment with 5 μM herbimycin. When HeLa cells were treated with a specific inhibitor of the mitogen-activated protein kinase (MAPK)/extracellular-signal regulated kinase cascade, PD58059 (100 μM), suppression of the cadmium-dependent HO-1 induction was not observed, but the hemin- or arsenite-dependent induction was slightly inhibited. SB203580, an inhibitor of p38 MAPK, did not affect the HO-1 induction. These results indicated that signal transduction involving tyrosine kinase rather than the MAPK family regulates the induction of human HO-1 gene expression by stress inducers.View full abstractDownload PDF (4501K) -
Tetsurou Tanabe, Nobutaka Tanaka, Kouichiro Uchikawa, Tsutomu Kabashim ...1998 Volume 124 Issue 3 Pages 634-641
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe Escherichia coli 7α-hydroxysteroid dehydrogenase (7α-HSDH; EC 1. 1. 1. 159) has been the subject of our studies, including the cloning of its gene, and determination of the crystal structures of its binary and ternary complexes [J. Bacteriol. 173, 2173-2179 (1991); Biochemistry 35, 7715-7730 (1996)]. Through these studies, the Ser146, Tyr159, and Lys163 residues were found to be involved in its catalytic action. In order to clarify the roles of these residues, we constructed six single mutants of 7α-HSDH, Tyr159-Phe (Y159F), Tyr159-His (Y159H), Lys163-Arg (K163R), Lys163-Ile (K163I), Ser146-Ala (S146A), and Ser146-His (S146H), by site-directed mutagenesis. These mutants were overexpressed in E. coli WSD, which is a 7α-HSDH null strain, and the expressed enzymes were purified to homogeneity. The kinetic constants of the mutant enzymes were determined, and the structures of the Y159F, Y159H, and K163R mutants were analyzed by X-ray crystallography. The Y159F mutant showed no activity, while the Y159H mutant exhibited 13.3% of the wild-type enzyme activity. No remarkable conformational change between the Y159F (or Y159H) and wild-type proteins was detected on X-ray crystallography. On the other hand, the K163I mutant showed just 5.3% of the native enzyme activity, with a 8.5-fold higher Kd. However, the K163R mutant retained 64% activity, and no remarkable conformational change was detected on X-ray crystallography. In the cases of the S146A and S146H mutants, the activities fairly decreased, with 20.3 and 35.6% of kcat of the wild-type, respectively. The data presented in this paper confirm that Tyr159 acts as a basic catalyst, that Lys163 binds to NAD(H) and lowers the pKa value of Tyr159, and that Ser146 stabilizes the substrate, reaction intermediate and product in catalysis.View full abstractDownload PDF (2083K) -
Masahiro Shibata, Ben M. Dunn, Kohei Oda1998 Volume 124 Issue 3 Pages 642-647
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSBacillus coagulans J-4 carboxyl proteinase, designated as J-4, is characterized as alcohol-resistant and insensitive to aspartic proteinase inhibitors such as pepstatin, diazoacetyl-DL-norleucinemetylester, and 1, 2-epoxy-3-(p-nitrophenoxy)propane. Here, its substrate specificity was elucidated by using two series of chromogenic substrates, Lys-Pro-Ala-Lys-Phe*Nph (p-nitrophenylalanine:* is cleavage site)-Arg-Leu (XVI) and Lys-Pro-Ile-Glu-Phe*Nph-Arg-Leu (RS6), in which the amino acid residues at positions P5-P2, P2', and P3' were systematically substituted. Kinetic parameters were determined for both sets of peptides. J-4 was shown to hydrolyze Lys-Pro-Ala-Ala-Phe-Nph-Arg-Leu most effectively among the XVI series. The kinetic parameters of this peptide were Km=20.0±3.24 μM, kcat=15.4±0.71 s-1, and kcat/Km=0.769±0.128 μM-1•s-1. Among the RS6 series, Lys-Pro-Ile-Pro-Phe-Nph-Arg-Leu was hydrolyzed most effectively. The kinetic parameters of this peptide were Km=13.7±1.30 μM, kcat=9.65±0.38 s-1, and kcat/Km=0.704±0.072 μM-1•s-1. These systematic analyses revealed that J-4 had a unique preference for the P2 position: J-4 preferentially hydrolyzed peptides having an Ala or Pro residue in the P2 position. Other carboxyl proteinases preferred peptides having hydrophobic and bulky amino acid residue such as Leu in the P2 position. Thus, J-4 was found to differ considerably in substrate specificity from the other carboxyl proteinases reported so far.View full abstractDownload PDF (1830K) -
Azumi Hida, Yasunobu Uchijima, Yousuke Seyama1998 Volume 124 Issue 3 Pages 648-653
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe Harderian gland of golden hamster (Mesocricetus auratus) secretes copious lipids, most of which is 1-alkyl-2, 3-diacylglycerol (ADG). We previously reported that the composition of ADG shows marked sexual dimorphism [Seyama et al. (1995) J. Biochem. 117, 661-670]. Male ADG contains only straight chain alkyl and acyl groups, but female ADG contains a lot of branched chain ones too. In this study, we investigated the metabolism of branched chain amino acids (BCAAs) and analyzed the incorporation of the metabolites into lipids in the Harderian gland. Golden hamsters were injected intraperitoneally with [U-14C] BCAAs, and Harderian glands were obtained at 3, 6, 9, and 24h after injection. Lipids were then extracted from the glands and analyzed. Thin layer chromato-graphy revealed that the ADG was labeled in both sexes, but the profile depended on the sex. The cholesterol fraction was labeled only in the male gland. The alkyl and acyl groups of ADG were subjected to radio-gas liquid chromatography. As for the alkyl groups, radio-activity was detected in straight-C16 and -C18 chains in males, while branched-C17 and -C19 chains were labeled in females. As for the acyl groups, straight-C14, -C15, and -C16 chains were labeled in males, while in females, branched-C17 and -C19 chains were labeled as well as a straight-C16 chain. These results suggest that the BCAA metabolism should be regulated as to the sex at the step of branched chain acyl-CoA degradation in the Harderian gland of golden hamster, which causes the sexual dimorphism in the lipid composition in this gland.View full abstractDownload PDF (4420K) -
Nobuko Hosokawa, Christine Hohenadl, Mamoru Satoh, Klaus Kühn, Ka ...1998 Volume 124 Issue 3 Pages 654-662
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSHSP47 is a stress protein (heat shock protein) which resides in the endoplasmic reticulum, and is postulated to function as a collagen-specific molecular chaperone. To elucidate the role of HSP47 in procollagen biosynthesis, we have established human embryonic kidney 293 cell lines, which were stably transfected with α1 (III) procollagen chains with or without HSP47. 293 cells do not produce any extracellular matrix proteins including collagens, and the level of HSP47 expression is almost undetectable in this cell line. Recombinant type III procollagens in 293 cells form trypsin-resistant homotrimers, which are secreted into the medium as trimers in the presence or absence of recombinant mouse HSP47. The secretion of procollagen III was delayed in 293 cells stably transfected with proα1 (III) collagen chains [293+proα1 (III) cells] in comparison with human rhabdomyo-sarcoma cell line RD, which normally produces type III procollagens. In this study, we examined the rate of type III procollagen secretion in detail. In cells cotransfected with mouse HSP47 [293+proα1 (III)+HSP47 cells], the rate of type III procollagen secretion was slower than in 293+proα1 (III) cells. The binding of HSP47 with proα1 (III) collagen chains was confirmed by immunoprecipitation using the chemical cross-linker, DSP. The electro-phoretic mobility of proα1 (III) collagen chains in 293+proα1 (III) cells was slightly slower than that in RD cells, whereas the recombinant proα1 (III) chains of 293+proα1 (III)+HSP47 cells showed almost the same electrophoretic mobility as those of RD cells. The melting temperature (Tm) of type III procollagen in 293+proα1 (III)+HSP47 cells was almost the same as that in RD cells, and the Tm in 293+proα1 (III) cells was slightly higher than that in RD cells. These data suggest that the recombinant proα1 (III) collagen chain is overmodified in 293+proα1 (III) cells, but not in 293+proα1 (III)+HSP47 cells.View full abstractDownload PDF (6730K) -
Shiroh Iwanaga, Nobuyuki Yamasaki, Makoto Kimura1998 Volume 124 Issue 3 Pages 663-669
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe stoichiometry of the interaction between Erythrina variegata chymotrypsin inhibitor ECI and chymotrypsin was reinvestigated by analysis of their complex with ultracentri-fugation and with amino acid analysis of the components separated. The amino acid analysis clearly showed that the stoichiometry of ECI and chymotrypsin was 1:1, though the apparent molecular mass of the complex was estimated to be 60 kDa. To examine the contribution of Leu64 (the P1 residue) to the inhibitory activity of ECI, a complete set of mutated inhibitors in which the amino acid at position 64 was replaced by 19 other amino acid residues was constructed by means of site-directed mutagenesis. Potent inhibitory activities (K1, 1.3-4.6×10-8M) exceeding that of the wild-type ECI (K1, 9.8×10-8M) were present in the mutant proteins L64F, L64M, L64W, and L64Y. The inhibitory activity of the mutant L64R was practically identical to that of the wild-type ECI. All other mutants exhibited slightly decreased inhibitory activities with K1 values of 1.9-4.6×10-7M. These results indicate that ECI-chymotrypsin interaction involves not only the P1 site residue but also other residue (s) of ECI. A series of individual alanine mutations was then constructed in residues Gln62 (P3), Phe63 (P2), Ser65 (P1'), Thr66 (P2'), and Phe67 (P3') in order to evaluate the contribution of each residue in the primary binding loop to the inhibitory activity. Replacement of Gln62, Phe63, and Phe67 with Ala residues decreased the inhibitory activity, the K1 values being increased by approximately 3-4-fold; but replacement of Ser65 and Thr66 had relatively little effect. This suggests that the P2, P3, and P3' residues, together with the P1 residue, in the primary binding loop play an important role in the inhibitory activity toward chymotrypsin.View full abstractDownload PDF (2101K) -
Kenji Uchimura, Hideki Muramatsu, Tadashi Kaname, Haruko Ogawa, Taishi ...1998 Volume 124 Issue 3 Pages 670-678
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSN-Acetylglucosamine-6-O-sulfotransferase catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to position 6 of a non-reducing N-acetylglucosamine (GlcNAc) residue. We have cloned human GlcNAc-6-O-sulfotransferase cDNA, based on the sequence homology to cloned cDNA of mouse GlcNAc-6-O-sulfotransferase. The predicted protein sequence of the human enzyme was highly homologous to that of the mouse enzyme; in the 363 amino acid stretch of the catalytic region, the two proteins were nearly identical except for conservative changes in 3 amino acid residues. The expressed enzyme transferred sulfate to GlcNAcβ1-3Galβ1-4GlcNAcβ1-3Galβ1-4GlcNAc. Co-transfection of the enzyme cDNA and fucosyltransferase VII cDNA into COS-7 cells resulted in cell surface expression of 6-sulfo sialyl Lewis X. Fluorescence in situ hybridization analysis revealed that the GlcNAc-6-O-sulfotransferase gene is located on human chromosome 7q31. mRNA of the human enzyme was strongly expressed in the bone marrow, peripheral blood leukocytes, spleen, brain, spinal cord, ovary, and placenta, and moderate levels of expression were observed in many organs including lymph nodes and thymus. In situ hybridization with the mouse system showed that the transcript was localized in specific regions of the brain, i.e. pyramidal cells in the CA3 subregion of the hippocampus, cerebellar nucleus and Purkinje cells. Among human tumor cells, strong expression of the mRNA was found in MOLT-4 and Jarkat lymphoblastic leukemia cells, Raji lymphoma cells, K-562 chronic myelogeneous leukemia cells, U251 glioma cells, and G361 melanoma cells. Carbohydrate structures synthesized by the sulfotransferase may be involved in various aspects of the differentiation and behavior of blood cells, their progenitor cells, and neurons in the central nervous system.View full abstractDownload PDF (5233K) -
Eisaku Oikawa, Hiroaki Iijima, Takashi Suzuki, Hironobu Sasano, Hiroyu ...1998 Volume 124 Issue 3 Pages 679-685
Published: 1998
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSWe report here the identification, characterization, and expression of a novel rat acyl-CoA synthetase (ACS) designated as ACS5. ACS5 consists of 683 amino acids and is approxi-mately 60% identical to the previously characterized ACS1 and ACS2. ACS5 was overproduced in Escherichia coli cells and then purified to near homogeneity. The purified enzyme utilized a wide range of saturated fatty acids similar to those utilized by ACS1 and ACS2, but differed in its preference for C16-C18 unsaturated fatty acids. Northern blot analysis revealed that ACS5 mRNA is present most abundantly in the small intestine, and to a much lesser extent in the lung, liver, adrenal gland, adipose tissue, and kidney. In situ hybridization of rat ileum revealed abundant accumulation of ACS5 transcripts in foveolar epithelial cells. The hepatic level of ACS5 mRNA was significantly increased by refeeding a fat-free high sucrose diet and reduced by fasting or refeeding a high cholesterol diet, whereas that in the small intestine was not significantly altered by various dietary conditions. In contrast to the absence of ACS1 mRNA in undifferentiated 3T3-L1 preadipo-cytes, ACS5 mRNA was present in proliferating 3T3-L1 preadipocytes and its level remained unaltered during differentiation, suggesting that ACS5 may provide the acyl-CoA utilized for the synthesis of cellular lipids in proliferating preadipocytes.View full abstractDownload PDF (2965K)
- |<
- <
- 1
- >
- >|