Fish Pathology
Online ISSN : 1881-7335
Print ISSN : 0388-788X
Search
OR
Browse
Search
Volume 39 , Issue 1
Showing 1-7 articles out of 7 articles from the selected issue
    • |<
    • <
    • 1
    • >
    • >|
  • Hung-Hung Sung, Yen-Tung Huang, Li-Ting Hsiao
    Volume 39 (2004) Issue 1 Pages 1-8
    Released: October 26, 2009
    JOURNALS FREE ACCESS
    Prawns Macrobrachium rosenbergii injected with Gram-positive Lactococcus garvieae and Gram-negative Aeromonas veronii were monitored for changes in phenoloxidase (PO) activity. Challenge-stimulated PO activity (Pos) was measured by adding trypsin inhibitor to hemocyte lysate to prevent proPO activation. Challenge with either L. garvieae at 5 &times; 105 cells/g of prawn or A. veronii at 2 &times; 102 cells/g of prawn (1/10 LD50) gave a maximum increase in POS at 18 h post-injection, and the response was higher with L. garvieae than with A. veronii. On the other hand, when prawns were separately injected with two kinds of formaldehyde-inactivated bacteria at the same dose (5 &times; 105 cells/g), the POS was similar for both. These results suggest that POS response was positively related to bacterial dosage but not to bacterial species. Furthermore, the total PO activity (POT) resulting from all intrahemocytic proPO was also examined after bacterial injection. POT increased after challenge with either viable or inactivated L. garvieae and A. veronii. However, POT expression with viable bacteria was greater and appeared more quickly than with inactivated bacteria. Regardless of dosage, inactivated bacteria enhanced a milder increase in POS or POT. These results suggest that inactivated bacteria have potential for use as a bacterin to induce a mild defense response in cultured prawns.
    View full abstract
    Download PDF (1255K)
  • Satoru Matsuoka
    Volume 39 (2004) Issue 1 Pages 9-13
    Released: October 26, 2009
    JOURNALS FREE ACCESS
    The Japanese flounder Paralichthys olivaceus weighing an average of 73 g were intraperitoneally inoculated with Edwardsiella tarda and then the discharge of the bacterial cells from the fish were examined at 12 h intervals after bacterial challenge by using Salmonella - Shigella agar. The infected fish began to shed E.. tarda cells one to six days before death. The number of cells shed from the dead fish reached to 107-108 CFU / fish·min, and the same level of bacterial shedding was kept for several days after death. When the Japanese flounder were challenged by an immersion method, the discharged cells from the dead fish exhibited higher virulence than cultured cells on Trypto-Soya agar. These results suggest that bacteria shed from diseased fish play an important role in spreading of edwardsiellosis among cultured population of the Japanese flounder.
    View full abstract
    Download PDF (640K)
  • Shih-Hu Ho, Yu-Chan Chao, Hsiao-Wei Tsao, Masahiro Sakai, Hong-Nong Ch ...
    Volume 39 (2004) Issue 1 Pages 15-23
    Released: October 26, 2009
    JOURNALS FREE ACCESS
    A penaeidin cDNA sequence of tiger shrimp Penaeus monodon was obtained. In the sequence, an open reading frame that coded for a peptide composed of 74 amino acids was found. A cleavage site of secretory signal peptide was predicted between amino acids 19 and 20. The calculated molecular mass of mature penaeidin was about 6.1 kDa and the estimated pl of this peptide was 9.1. Northern blot analysis indicated that the penaeidin was mainly synthesized in the hemocytes. Clustering analysis of penaeidin sequences from P. monodon, P. vannamei, P. setiferus, P. japonicus and P. chinensis was performed. The recombinant penaeidin was expressed using insect-baculovirus expression system. The recombinant penaeidin showed antimicrobial activity against a bacterium Aerococcus viridans, but not Vibrio alginolyticus, Vibrio harveyi or a yeast Debaryomyces hansenii. In addition, it delayed spore germination and growth of a filamentous fungus Neurospora crassa.
    View full abstract
    Download PDF (1683K)
  • Panarat Phadee, Osamu Kurata, Kishio Hatai
    Volume 39 (2004) Issue 1 Pages 25-31
    Released: October 26, 2009
    JOURNALS FREE ACCESS
    We describe a polymerase chain reaction (PCR) -based approach to the detection and identification of Aphanomyces piscicida (=Aphanomyces invadans). Three primer sets were designed based on the sequences of cloned expression genes of A. piscicida NJM 9803 (accession numbers : AB 104634, AB 104635 and AB 104636). They were used to detect the genomic DNA of 42, 18, 10 and 1 isolates of Aphanomyces spp., Saprolegnia spp., Achlya spp. and Dictyuchus sp., respectively. Out of 3 primer sets, a primer set (1APM 1F, 1APM 6R) detected only fish pathogenic A. piscicida but not the other non-fish pathogenic Aphanomyces species. In addition, the PCR revealed sensitivity sufficient for detecting A. piscicida in artificially infected goldfish. From the results, it was demonstrated that the PCR method with the primer set is effective for detection of A. piscicida from infected fishes and diagnosis of mycotic granulomatosis.
    View full abstract
    Download PDF (1648K)
  • Jesus L. Romalde, Sonia López-Romalde, Carmen Ravelo, Beatriz M ...
    Volume 39 (2004) Issue 1 Pages 33-41
    Released: October 26, 2009
    JOURNALS FREE ACCESS
    A PCR-based protocol for the detection of the emerging fish pathogen Pseudomonas anguilliseptica was developed, using the primer set Psan-F/Psan-R designed on the basis of the 16S rRNA sequence. This PCR protocol was optimized and validated by testing 50 target and 38 non-target pure cultures. The method showed a 100% specificity and the detection limit obtained was of 0.7 pgDNA/PCR tube, which equates to 20 or lower bacterial cells. A similar level of sensitivity was observed when the PCR protocol was applied to fish tissues seeded with bacteria. In addition, the developed PCR assay was also capable of direct detection of P. anguilliseptica from tissues obtained from experimentally infected fish and fish obtained from natural outbreaks in gilthead seabream (Sparus aurata) and turbot (Scophthalmus maximus) farms. This PCR protocol can be a useful tool for a rapid, specific and sensitive diagnosis of fish pseudomonadiasis caused by P. anguilliseptica.
    View full abstract
    Download PDF (2124K)
  • Sayaka Mitsui, Takaji Iida, Terutoyo Yoshida, Ikuo Hirono, Takashi Aok ...
    Volume 39 (2004) Issue 1 Pages 43-45
    Released: October 26, 2009
    JOURNALS FREE ACCESS
    A PCR method targeting 16S rDNA was used for detecting the causative agent of bacterial hemolytic jaundice in yellowtail Seriola quinqueradiata. A primer set (forward primer : AGCACTTATGTATAGGTGTA; reverse primer : GTATAAAACGCCAAACATAT) amplified a 387bp product, which was specific for this bacterium. Using yellowtail intraperitoneally injected with this bacterium, the PCR product was observed in templates from blood, liver, kidney and spleen, but not from muscle. Blood specimen was expected to be best for diagnosis of the disease by PCR.
    View full abstract
    Download PDF (574K)
  • [in Japanese]
    Volume 39 (2004) Issue 1 Pages 47-67
    Released: October 26, 2009
    JOURNALS FREE ACCESS
    Download PDF (2830K)
    • |<
    • <
    • 1
    • >
    • >|
feedback
Top