In order to investigate the neonatal infection of group B streptococci (GBS), vaginal and anal cultures, and measurement of type-specific antibodies to GBS were carried out on 461 pregnant women. Levels of antibody to GBS were measured with ELISA plates coated with type-specific antigen of GBS. These plates were furnished by Toyo Jozo Co., Ltd.
The results were as follows;
1) Antibodies to type Ia, Ib, II and III were detected in 41.9, 34.7, 31.7 and 40.1% of subjects, respectively.
2) GBS was isolated in 78 (16.9%) of subjects.
3) Antibody levels against GBS in the sera of colonized mothers and cord blood of their infants were well correlated.
4) Among the colonized mothers, 4 out of 19 (Ia), 9 out of 18 (Ib) 5 out of 8 (II) and 5 out of 17 (III) showed low levels of antibody.
5) Those who had low levels of antibody were administered antibiotic a delivery, and there was no case of crisis in both treatment (antibody levels were negative) and non-treatment (antibody levels were positive) groups.

View full abstract

Between January 1986 and December 1989, 957 fecal specimens were collected mainly from pediatric outpatients with acute gastroenteritis during the acute phase. Rotavirus (RV) and adenovirus (AV) antigens were found in 233 (24%) and 60 (6%) of these specimens, respectively. Seventyfive % of 76 RV antigen-positive specimens collected in 1989 were determined to be serotype 1.
Although both RV and AV infections occurred slightly more often in boys than in girls, there were no significant differences. About 80% of the patients infected with RV or AV were at the age of below 2 years, and the youngest case was aged 2 months. The RV antigen was most frequently detected during the winter season in low temperature and low relative humidity. The detection rate of RV antigen had negative relation with mean temperature or mean relative humidity.
Diarrhea in RV infection occurred 5.5 times/day on average, and the number of diarrhea per day was significantly higher in RV antigen-positive cases than in negative cases. The mean duration of diarrhea was 4.5 days. Diarrhea was significantly observed more in the watery or watery-whitish unformed ones than in other diarrhea. Vomiting occurred in 82% of the RV-infected cases, 4 times or less in a day. The duration of vomiting was as short as 1-2 days in about 90% of patients.
Three symptoms (DFV symptoms), including diarrhea (D), fever (F) and vomiting (V), were more frequently observed in RV-infected cases than in the cases with non rotaviral infection.

View full abstract

By electron microscopy survey of acute gastroenteritis of children in Matsuyama, rotaviruses were detected in 561 of 2479 feacal samples obtained between October, 1984 and September, 1988, in which 60 atypical and 259 typical rotaviruses, so far tested, were detected by polyacrylamide gel electrophoresis (PAGE) of viral RNA. Out of 60 atypical rotaviruses, 5 were observed in 1985, 7 in 1986, none in 1987 and 48 in 1988. These atypical rotaviruses were morphologically indistinguishable from typical ones and showed very similar RNA migration patterns of PAGE to those of group C rotavirus. Furthermore, one atypical virus (86-542) reacted with antiserum against a porcine group C rotavirus in immune electron microscopy, while it did not react with anti-group A rotavirus serum. On the other hand, hyperimmune guinea pig antiserum against 86-542 reacted with a couple of atypical rotavirus including viruses isolated in 1988, so far tested, but did not react with any of the typical viruses. These findings showed that atypical rotaviruses which were endemic in Matsuyama city in 1988 were defined as group C rotavirus.
Moreover, these group C rotaviruses showed two kind of RNA migration patterns in PAGE, which clearly discriminated the virus were isolated before and after 1987.
Epidemiological features of group C rotavirus were as follows. Children from whom group C rotavirus was isolated were older than those from of whom group A rotavirus was isolated. The epidemic season was in February through April, compared to December through March in group A virus.
Retrospective seroepidemiological study by immune adherence hemagglutination test (IAHA) using the purified 86-542 virus as antigen indicated that 15 of 78 sera of children obtained in 1971 already possessed IAHA antibody against group C rotavirus.

View full abstract

Clinical and bacteriological studies were carried out to investigate the isolation of MRSA from clinical materials, during the 4 years from 1985 to 1988 at the Hokusyou Central Hospital. The isolation frequency of MRSA from Staphylococcus aureus increased from 5.6%(3 strains) in 1985 to 50.0%(90 strains) in 1988. MRSA from sputum and pressure sore increased significantly. However MRSA from outpatient and inpatient in the ward for common people were constant, about 20%. Inpatients in the ward for aged person were increased significantly from 13.6%(3 strains) to 67.0%(67 strains). Most of the patients with positive MRSA isolation had background diseases (88.3%) and were bedridden (78.4%). Patients with cerebrovascular disease were 55.9% of all of the cases. But most of the MRSA strains were resistant to CZX, FOM, DMPPC, CMX, CEZ, CZON, CZX, most of the MRSA strains were sensitive to RFP, VCM, MINO, IPM/CS.

View full abstract

We investigated 18 anti-HIV seropositive subjects with respect to the isolation of HIV from peripheral blood mononuclear cells (PBMC) and cellular and serologic markers for progression to AIDS. The subjects included homosexuals and recipients of blood products. Three had AIDS, an asymptomatic subject developed AIDS during the study and 14 the remaining have remained asymptomatic.
HIV was isolated from all AIDS patients and 7 asymptomatic subjects. Moreover HIV was detected significantly sooner in symptomatic patients than in asymptomatic subjects. The reductions in CD4 lymphocytes number and CD4/CD8 ratio, as well as anti-HlVcore (p24, p17) antigens negativity correlated with deterioration of clinical symptoms and successful HIV isolation. The isolates from AIDS patients and from an asymptomatic subject who 9 months later developed AIDS were infective and cytotoxic to MT-4 cells, however isolates from asymptomatic subjects were not infective. These findings indicate that disease progression correlates with the appearance of variant viruses that are more infective and cytopathic.

View full abstract

The author reviewed the records of 31 patients with asporogenic anaerobic empyema mostly seen in the wards of Internal Medicine, Juntendo University Hospital during the 27 years between 1961 and 1988, and obtained the following results.
1. There were 25 males and 8 females with an average age of 57.8 and 51.0 y/o (range, 25 to 79 y/o), respectively males more than forty years old occupied 74.2 percent of all cases. 28 patients (90%) had underlying conditions.
2. The cases of mixed infections with anaerobes and aerobes were only 22.6%.
3. The isolated bacteria were microaerophilic streptococcus, Bacteroides spp., Peptostreptococcus spp., Fusobacterium spp. etc. in this order.
4. There were no relationships between anaerobic infections with or without aerobes and putrid odor of pleural effusion.
5. Bacteroides spp. were isolated most in the group with putrid pleural effusion, however, they were not isolated in the group without putrid pleural effusion at all. This fact suggests that there is an intimate relationships between putrid odor and Bacteroides spp.
6. There was no deceased case which pleural effusion had been drained sufficiently with open or closed drainage. It suggests that sufficient drainage is the most important in therapeutic procedures of asporogenic anaerobic empyema.

View full abstract

Using a novel, highly sensitive cell culture system, B95a cells, I investigated the virus shedding of measles virus (MV) of 47 cases with natural measles. MV was isolated from both peripheral blood leukocytes and respiratory secretions up to 6 days from the onset of the rash. By fractionation of blood, MV was isolated from lymphocytes and monocytes up to 6 days from the onset of the rash, however it disappeared rapidly within 48 hours from the plasma.
The duration of positive MV isolation depends on the duration of fever, i.e. infectious MV could not be recovered beyond the 24 hours after the alleviation of fever.
The data suggest that in natural measles, infectious MV is shed for a longer period than previously believed. The role of infection of monocyte in the pathogenesis of measles is also suggested.

View full abstract

The study of human papillomavirus (HPV) in the genitalia of all normal males is difficult, therefore cases of chronic prostatitis, a common disease treated in urological clinics, were chosen to identify HPV DNA by using Vira Type^TM (Life Technologies Inc.).
Smears of glans and sulcus coronalius of 177 subjects, showed a HPV positive rate of 3.4%, while 86 cases of those cases were negative for HPV in urethral smears. The lack of clinical findings suggests that HPV is an asymptomaic infection.
In a follow up examination of 5 HPV positive cases some weeks later, smears of glans, sulcus coronalius and urethra were all negative for HPV. Examination by Vira Type^TM showed that HPV disappeared spontaneously in these cases.

View full abstract

We employed a indirect immunoperoxidase assay (IPAZYMETM) in the evaluation of IgG and IgA antibody for Chlamydia trachomatis in serum samples from 218 patients such as cicatricial trachoma 55 cases, culture-positive adult inclusion conjunctivitis 48 cases and culture-negative conjunctivitis 47 cases, aged people, 68 cases as controls respectively.
Frequency of positive IgG antibody showed a significant difference between adult inclusion conjunctivitis or cicatricial trachoma and controls.
IgA antibody was positive in 25/48 (52%) in adult inclusion conjunctivitis and in 7/55 (12%) in cicatricial trachoma cases. Serum IgA antibody against Chlamydia trachomatis is of value to be an index of active ocular chlamydial inflammation. The correlation between severity of conjunctival cicatrix or corneal punnus and titers of IgG antibody was also significant.

View full abstract

A rapid and simple procedure using polymerase chain reaction (PCR) was developed for the detection of cholera enterotoxin (CT) producing character. This method is based on amplifying a 380 base pair (bp) segment of the CT gene (ctx) which controls the production of CT.
Two single-stranded oligonucleotides, synthetized to be complementary to the known nucleotide sequences of genes encoding the A-subunit of ctx, were used as extension primers. The oligonucleotide sequences are 5'TCAAACTATATTGTCTGGTC (CT-1) and 5'CGCAAGTATTACTCATCGA (CT-2). As template DNA was used 5, u1 of boiled bacterial culture broth at 95°C for 5 min without the need for DNA extraction.
The amplified target DNA were confirmed with only CT producing Vibrio cholerae o1 but not with CT non-producing organisms such as heat labile enterotoxin producing Escherichia coli by electrophoretic analysis of PCR mixture after amplification. A few isolates of CT producing V. mimicus and V. cholerae non-O1 were identified.

View full abstract

A DNA probe was developed for the genetic detection from cholera enterotoxin (CT) producing Vibrio cholerae O1 and other organisms. The structual genes of CT (ctx) were cloned from chromosomal DNA of CT producing V. cholerae 01 569B. We subcloned a 552-base-pair fragment encoding a part of CT A-subunit for use of the CT-probe, and made the recombinant plasmid called pSKM24 which has eight copies of the CT-probe. The ³²P-labeled CT-probe detected ctx in 72 isolates such as V. cholerae 01, V. cholerae non-01 and other species of bacteria, but did not react heat-labile enterotoxin genes in enterotoxigenic Escherichia coli (ETEC) by DNA hybridization. The colony hybridization test using the CT-probe is specific, rapid and useful technique for detection of ctx and identification of CT producing V. cholerae.

View full abstract

Recovery experiments of Shigella strains from fresh marine fish and shellfishes, including fresh sea urchin, which have been artificially contaminated with the strains, were performed using the improved Shigella broth-enrichment method and the culture method reported by Mehlman et al. All of the 43 Shigella stock cultures strains tested were recoverd easily by the enrichment method from sea urchin individuals inoculated with a small number of viable cells of each strain. That is, a total of 24 strains (56%) were recovered from sea urchin individuals inoculated with less than 10 viable cells per one individual, and the other 19 strains were also recovered when 10 to 1, 000 cells of each strain were inoculated. Recovery of Shigella strains from fish and shellfishes by the enrichment method was hardly affected by the number of contaminated bacteria (SPC, standard plate counts) in these materials.
In order to confirm reliability of the enrichment method, similar experiments were performed using S. flexneri strain B as the inoculum nad more fish and shellfishes as the samples (24 specimens of fresh sea urchins, 11 specimens of fresh oysters and 5 other specimens including prawns). Except for one oyster specimen which showed an especially high SPC value, the inoculum was able to be recovered from most of the materials inoculated with less than 10 viable cells, and all of the tested samples became Shigella positive when they were inoculated with up to 1, 000 viable cells.
Because injuries of contaminated Shigella cells in food caused by heating, freezing, etc. and subsequently reduced metabolic functions in the cells can be expected, recovery of such injured cells of a Shigella strain was also examined. Though obvious decrease in the catalase activity was observed in the heat-or freeze-injured cells of the strain, the Shigella broth-enrichment method was able to recover even such an injured strain from fish and shellfishes with almost the same accuracy as in the case of the intact strain with no significant difficulties.

View full abstract

The MICs of Aztreonam (AZT) against 590 clinical isolates of Gram-negative bacilli were determined. About 13.4%(79 strains) of the isolates were AZT-resistant (MIC; 12.5μg/mAl≤.).
The resistance pattern against various β-lactams and the effects on MICs of combination of Clavulanic acid (CVA) and AZT against AZT resistant strains suggested that AZT was inactivated by either type of IV (K1), Va (OXA1), or PSE2 β-lactamases.

View full abstract

A monoclonal antibody, SBY1 (IgM, K), against the Salmonella O-antigen was generated by using the myeloma cell line Sp2/O-Ag14 as a fusion partner with spleen cells from BALB/c mice immunized with S. senftenberg 963 K. SBY1 was characterized by the slide agglutination and absorption test.SBY1 was believed to show the specificity to O1-, O3-or O19-antigens of Salmonella because S. Senftenberg 963 K (O1, 3, 19) was used as the antigen for immunization. The slide agglutination test with the Salmonella serovars indicated the responsiveness of SBY1. SBY1 was reactive only with strains that possessed O19-antigen. The agglutinating ability of SBY1 was absorbed completely with bacilli possessing O19-antigen. These finding indicates that SBY1 is specific for O19-antigen.
Polyclonal factor sera for he serotyping of the O3, 10 group of Salmonella cross-reacted with Salmonella group O1, 3, 19 in the slide agglutination test. In contrast, SBY1 did not cross-react with serovars from several other Salmonella groups.
These data suggest the usefulness of SBY1 as a serodiagnostic tool for serotyping of Salmonella.

View full abstract

A 40-year-old poor nutritional Japanese male was admitted to our hospital on June 5, 1989, with a 31-day history of fever. He had been working as a crew member of a ship in South East Asia. Salmonella typhi was isolated from his blood culture. In the course of the disease, intestinal hemorrhage, drug-induced fever and liver dysfunction, DIC, ARDS, and psychiatric disorder were identified. Interstinal hemorrhage occurred after the coagulation test became normal, so it was thought that the intestinal hemorrhage did not correlate with DIC. The patient was treated with CP, ABPC and supportive therapy. He became well, and ARDS and pyschiatric disorder were disappeared. He was discharged on the 118th day of illness. Drug-induced fever was thought as one of the allergic reaction and the causative drug was not identified by LST. It was suspected that psychiatric disorder correlated with poor nutrition. Supportive therapy such as mandatory bed rest, intravenous hyperalimentation and low-volume blood transfusions, as well as an antimicrobial treatment were important for the inhibition of shock and/or intestinal perforation.

View full abstract