Luteolin enhances oxidative stress tolerance via the daf-16 pathway in the nematode Caenorhabditis elegans

Abstract

Luteolin, widely present in plants, has various physiological functions. Here, we aimed to investigate whether luteolin affects lifespan and oxidative stress tolerance using Caenorhabditis elegans. Luteolin had no effect on the lifespan of wild-type N2 worms under normal conditions. In contrast, luteolin prolonged the lifespan of N2 worms under oxidative stress, suggesting that luteolin enhances oxidative stress tolerance. Luteolin upregulated the expression of gst-4, sod-1, sod-2, sod-3, and ctl-3 in N2 worms under oxidative stress conditions. The expression of these genes was regulated by DAF-16. Prolongation of lifespan and induction of gene expression by luteolin under oxidative stress conditions were not seen in daf-16 (mu86) mutants. These results suggest that the enhancement of oxidative stress tolerance by luteolin was mediated by the daf-16 pathway in C. elegans.

Introduction

Research on the physiological functions of plant-derived compounds is attracting worldwide attention, and there is a need to explore their physiological activities and elucidate their mechanisms of action. Luteolin is a flavonoid that is widely present in plants such as fruits, vegetables, and herbs. It has pharmacological activities, including antidiabetic, anti-inflammatory, and anticancer activities (Muruganathan et al., 2022; Prasher et al., 2022). Furthermore, the antioxidant and prooxidant effects of luteolin are involved in these pharmacological activities (Prasher et al., 2022; Slika et al., 2022). However, the prooxidant effect might cause oxidative stress, which might have a negative effect on the organism, such as shortening its lifespan or decreasing its stress tolerance. Although various physiological activities have been reported with luteolin, the effects of luteolin on lifespan and stress tolerance are not fully understood.

Caenorhabditis elegans can be easily cultured in a medium and is used as a model organism in various biological studies (Liao, 2018). It shares homologous genes and various basic organs (such as muscles, nervous system, and intestines) with higher-order animals (Liao, 2018). In addition, C. elegans is a good model for aging and stress studies owing to its lifespan of approximately 1 month.

DAF-16 and SKN-1 are the major transcription factors involved in the regulation of lifespan-related and stress response-related gene expression in C. elegans (Zhu et al., 2022). DAF-16 is an ortholog of mammalian forkhead box O, which regulates the transcription of genes encoding antioxidant enzymes such as superoxide dismutase (SOD) and catalase. SKN-1 is an ortholog of mammalian nuclear factor erythroid 2-related factor, which regulates the transcription of antioxidant response element-mediated genes. Various flavonoids, such as quercetin, myricetin, and epigallocatechin gallate, prolong lifespan and enhance stress tolerance in C. elegans via DAF-16 and SKN-1 (Sugawara & Sakamoto, 2020; Büchter et al., 2013; Tian, J. et al., 2021). Luteolin also prolongs the lifespan of C. elegans under normal conditions (Lashmanova et al., 2017). However, it is unknown whether luteolin prolongs lifespan and influences the expression of stress response-related genes under oxidative stress conditions in C. elegans.

In this study, we aimed to investigate the effects of luteolin on lifespan and the DAF-16 and SKN-1 pathways under normal and oxidative stress conditions in C. elegans. We found that luteolin prolonged the lifespan of C. elegans under oxidative stress conditions, but not under normal conditions. Additionally, luteolin upregulated the expression of stress response-related genes, such as gst-4, sod-1–3, and ctl-3, in wild-type N2 under oxidative stress condition. The upregulation in the expression of these genes by luteolin in wild-type N2 was not seen in the daf-16 (mu86) mutant. These results suggested that luteolin enhanced oxidative stress tolerance via the daf-16 pathway in C. elegans. The results of this study are expected to help elucidate the physiological effects of luteolin.

Materials and Methods

Strain and cultivation of C. elegans Wild-type N2 and CF1038 [daf-16 (mu86)], a strain with a loss of function in daf-16, C. elegans worms were obtained from the Caenorhabditis Genetic Center (University of Minnesota, MN, USA). The worms were cultivated on nematode growth medium agar plates [51 mM NaCl, 0.25 % (w/v) peptone, 5 µg/mL cholesterol, 1 mM MgSO₄, 1 mM CaCl₂, 25 mM K-phosphate buffer, 1.7 % (w/v) ager] with Escherichia coli strain OP50 as the food source at 20°C. For all experiments, synchronized L1 worms were obtained by alkali treatment [0.1 % (v/v) NaClO, 0.4 M NaOH] of gravid animals.

Growth, maturation, and reproduction assay  Synchronized N2 or CF1038 L1 larvae were incubated in S medium [100 mM NaCl, 50 mM KH₂PO₄ buffer (pH 6.0), 5 Ug/mL cholesterol, 10 mM potassium citrate buffer (pH 6.0), 1 % (v/v) trace metal solution (2.5 mM FeSO₄-7H₂O, 5 mM EDTA2Na, 1 mM MnCl₂·4H₂O, 1 mM ZnSO₄·7H₂O, 0.1 mM CuSO₄·5H₂O), 3 mM CaCl₂, and 3 mM MgSO₄] with 0.12 % (w/v) OP50 suspension containing 0.1 % (v/v) dimethyl sulfoxide (DMSO) or luteolin (0.1, 1, and 10 µM in DMSO). OP50 was incubated in LB medium at 37 °C for at least 6 h. After collection, 1 mL of S-basal [100 mM NaCl, 50 mM KH₂PO₄ buffer (pH 6.0)] was added to 0.3 g wet weight to make an OP50 suspension. Growth and maturation endpoints were determined by assessing body length and percentage of gravid worms (worms in which eggs were visible inside the body) approximately 60 or 72 h after exposure to luteolin. The effects of luteolin on reproduction were evaluated by transferring adult worms to fresh medium daily until the end of spawning and counting the offspring. These results were obtained from three or four independent experiments (18–36 worms/experiment in growth and maturation assay, 3 worms/experiment in reproduction assay).

Luteolin uptake assay Luteolin uptake by C. elegans was visualized using the fluorescence enhancer 2-aminoethyl diphenyl borate (DPBA; Tokyo Chemical Industry Co., Ltd., Tokyo, Japan), by partially modifying the method reported by Grünz et al. (2012). Synchronized N2 or CF1038 L1 larvae were incubated in S medium with 0.12 % (w/v) OP50 suspension, containing 0.1 % (v/v) DMSO or luteolin (0.1, 1, and 10 µM) for 48 h. After the exposure, the worms were washed with M9 buffer (42 mM Na₂HPO₄, 22 mM KH₂PO₄, 86 mM NaCl, 1 mM MgSO₄) containing 0.01 % (v/v) Tween 20 and incubated in 0.2 % (w/v) DPBA solution for 3 h at 20 °C. After washing with M9 buffer containing 0.01 % (v/v) Tween 20, a fluorescence of luteolin in C. elegans was detected using fluorescence microscopy (Olympus BX61; Olympus Co., Tokyo, Japan).

Lifespan assay Synchronized N2 L1 larvae were incubated in S medium with 0.12 % (w/v) OP50 suspension, containing 0.1 % (v/v) DMSO or 10 µM luteolin for 48 h. After the exposure, the worms were moved to S medium with 0.12 % (w/v) OP50 suspension, containing 120 µM 5-fluoro-2′-deoxyuridine (FUdR; Tokyo Chemical Industry Co., Ltd., Tokyo, Japan) as an egg-hatching inhibitor. Movement of the worms was monitored daily using a platinum wire to assess whether they were alive or dead. The medium was changed every 1–4 days. Data analysis was performed with reference to previous studies (Ibe et al., 2012; Ogawa et al., 2016; Fischer et al., 2017).

Oxidative stress resistance assay Oxidative stress resistance assay was performed using paraquat (PQ) as an oxidative stress inducer. Synchronized N2 or CF1038 L1 larvae were incubated in S medium with 0.12 % (w/v) OP50 suspension, containing 0.1 % (v/v) DMSO or 10 µM luteolin for 48 h. After the exposure, the worms were moved to S medium with 0.12 % (w/v) OP50 suspension, containing 5 mM PQ and 120 µM FUdR. The worms were observed daily and the medium was changed daily.

Quantitative real-time PCR Synchronized N2 or CF1038 L1 larvae were incubated for 48 h in S medium with 0.12 % (w/v) OP50 suspension, containing 0.1 % (v/v) DMSO or 10 µM luteolin. Immediately or 6 h after exposure to 5 mM PQ, the worms were washed five times with M9 buffer to remove OP50. Total RNA was isolated from approximately 600 worms using Qiazol (Qiagen, Hilden Germany). The total RNA from the worms was reverse-transcribed to cDNA using a ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan). Real-time PCR was performed using an AriaMx Real-Time PCR system (Agilent Technologies, Ltd., Santa Clara, CA, USA) under the following conditions: 40 cycles at 95 °C for 10 s and 60 °C for 10 s. The primer sequences are shown in Table 1. pmp-3 or Y45F10D.4 was used as the reference gene (Hoogewijs et al., 2008). Standard curves were generated for each gene, and gene expression was quantified relative to that of the controls.

Table 1. Primer list

Gene name	Forward (5′-3′)	Reverse (5′ −3′)
daf-16	GCAAGGAGCATTTGATAACGT	GATTCGCCAACCCATGATGG
skn-1	AGTGTCGGCGTTCCAGATTTC	GTCGACGAATCTTGCGAATCA
gst-41)	CGTTTTCTATGGAAGTGACGC	TCAGCCCAAGTCAATGAGTC
sod-12)	TCTTCTCACTCAGGTCTCCAAC	TCGGACTTCTGTGTGATCCA
sod-2	GCTCTTCAGCCAGCTCTCAA	CCAGAGATCCGAAGTCGCTC
sod-3	GGCTAAGGATGGTGGAGAAC	ACAGGTGGCGATCTTCAAG
ctl-1	GTGTCGTTCATGCCAAGGGA	GATTCTCCAGCGACCGTTGA
ctl-2	ATGAATGGATACGGATCCCA	TCACGGATGGAATAGTCTGG
ctl-3	CCAATGCTTCCCCACATGGT	ATTGGATGTGGTGAGCAGGT
pmp-33)	GTTCCCGTGTTCATCACTCAT	ACACCGTCGAGAAGCTGTAGA
Y45F10D.43)	GTCGCTTCAAATCAGTTCAGC	GTTCTTGTCAAGTGATCCGACA

*Primers for the gene numbered in the upper right corner were taken from the following publications: 1) Ogawa et al., 2016, 2) Bito et al., 2017, 3) Hoogewijs et al., 2008.

Statistical analysis Results are expressed as mean ± standard deviation (SD). Statistical analyses were performed using JMP 11.0 software (SAS Institute Inc., Cary, NC, USA). The results of lifespan and stress resistance assays were analyzed using the log-rank test. The results of other experiments were evaluated using the t-test or Tukey–Kramer test. Differences were considered significant at p < 0.05.

Results and Discussion

The effects of luteolin on the growth, maturation, and reproduction of C. elegans wild-type N2 were evaluated in the concentration range of 0.1–10 µM, at which luteolin can be dissolved in S medium. At all concentrations tested, luteolin had no effect on the growth, maturation, or reproduction of the worms [Fig. 1 (a)–(c)]. These results suggest that the concentrations of luteolin used in this study were not toxic to the worms. The fluorescence intensity in the bodies of the worms was strong under 10 µM luteolin treatment [Fig. 1 (d)]. This result indicates that luteolin was taken up into the body of the worms. The subsequent assays were performed with 10 µM luteolin.

Fig. 1

Effects of luteolin on the growth, maturation, and reproduction of wild-type N2 worms and the uptake of luteolin into the body. The growth (a), maturation (b) and reproduction (c) results are shown as mean ± SD, three independent experiments. The images of luteolin uptake into the body are shown with brightfield observation on the left and fluorescence observation on the right, scale bar 100 µm (d).

The effects of luteolin under normal conditions on lifespan and expression of stress response-related genes (daf-16, skn-1, and the antioxidant-related genes regulated by them) in wild-type N2 worms were examined. The survival curves of worms under normal conditions are shown in Fig. 2 (a). The mean lifespan was 28.5 ± 8.6 days in the control group and 28.8 ± 7.5 days in the luteolin group, indicating that luteolin had no effect on lifespan (p = 0.816). Lashmanova et al. (2017) reported that luteolin extended lifespan of C. elegans, but it did not prolong lifespan in this study. Lashmanova et al. used luteolin at a concentration 10 times higher than that used in the present study and different rearing conditions, such as the addition of the antibiotic amphotericin B to the medium. Xiao et al. (2023) and Aranaz et al. (2020) reported that 10 µM luteolin affected innate immunity and fat accumulation in C. elegans, respectively. Since 10 µM luteolin was taken up by the worms in the present study, this concentration was considered sufficient to assess physiological functions. Forty-eight hours of exposure to luteolin suppressed the expression of skn-1 and gst-4, compared with that in the controls [Fig. 2 (c), (d)]. In contrast, the expression of daf-16, sod-1-3, and ctl-1-3 was not altered by luteolin exposure under normal conditions [Fig. 2 (b), (e)–(j)]. It has been reported that the promoter activity of antioxidant-related enzymes, such as gst-4 and sod-3, in C. elegans is decreased by compounds with radical-scavenging capacity, such as EGb761 and quercetin (Kampkötter et al., 2007, 2008). These compounds prolonged the lifespan of C. elegans. Luteolin can also scavenge radicals, but less strongly than quercetin (Hirano et al., 2001; Tian, C. et al., 2021). Thus, luteolin did not affect the lifespan of N2 worms under normal conditions.

Fig. 2

Effects of luteolin on the lifespan and expression of stress response-related genes in wild-type N2 worms under normal conditions. The survival curves were plotted based on pooled data from four independent experiments (a). N2-control (n = 114), N2-luteolin (n = 114). *p < 0.05 by log-rank test. Expression analysis of daf-16 (b), skn-1 (c), gst-4 (d), sod-1 (e), sod-2 (f), sod-3 (g), ctl-1 (h), ctl-2 (i), and ctl-3 (j) in N2 worms after exposure to 0.1 % (v/v) DMSO (control) or 10 µM luteolin. Mean ± SD, n = 4, *p < 0.05 by t-test.

To investigate the effect of luteolin under oxidative stress conditions, N2 worms were pretreated with 10 µM luteolin for 48 h, and then exposed to 5 mM PQ, an oxidative stress inducer. The mean lifespan of wild-type N2 worms under oxidative stress conditions was significantly prolonged in the luteolin group compared with that in the control group (the control group 7.94 ± 2.78, the luteolin group 9.00 ± 3.18, p < 0.01). Under oxidative stress conditions, the expression of gst-4, sod-1, sod-2, sod-3, and ctl-3 was significantly upregulated in the luteolin group compared with that in the control group [Fig. 3 (d)–(g), (j)]. These results suggest that luteolin enhances oxidative stress tolerance in N2 worms and that one of the mechanisms involved is the induction of stress response-related gene expression. The expression of sod-1–3 and ctl-3 has been reported to be regulated by DAF-16 (Yanase et al., 2002; Wan et al, 2020; Qi et al, 2021). To investigate whether daf-16 is involved in the enhancement of oxidative stress tolerance by luteolin, effects of luteolin in CF1038 [daf-16 (mu86)], a strain with a loss of function in daf-16, was examined under normal and stress conditions. Luteolin had no effect on the growth, maturation, or reproduction of CF1038 worms [Fig. 4 (a)–(c)]. These results suggest that 10 µM luteolin was not toxic to CF1038 worms or N2 worms. When treated with 10 µM luteolin, the bodies of CF1038 worms were highly fluorescent, indicating that luteolin was taken up into the body of these worms [Fig. 4 (d)]. In addition, the effects of luteolin on gene expression in CF1038 worms under normal conditions were investigated. Genes whose expression was changed under stress and normal conditions in N2 worms were not altered by luteolin treatment under normal conditions in CF1038 worms [Fig. 4 (e)–(j)]. The mean lifespan of CF1038 worms under oxidative stress conditions did not differ between the control and luteolin groups [Fig. 5 (a)]. In addition, the upregulation in the expression of genes by luteolin under oxidative stress conditions in N2 worms was not observed in CF1038 worms [Fig. 5 (b)–(f)]. Qi et al. (2021) reported that the longevity-enhancing and gst-4 and sod-3 expression-inducing effects in N2 worms by sulforaphane, which is present in broccoli, etc., were not seen in CF1038 worms. Furthermore, Xiao et al. (2023) reported that luteolin promotes pathogen resistance in C. elegans via DAF-16. Based on these reports, luteolin may induce the expression of antioxidant genes via daf-16 under oxidative stress conditions, thereby enhancing oxidative stress tolerance in C. elegans. In the present study, luteolin did not affect daf-16 expression level [Fig. 3 (b)]. Qi et al., (2021) reported that, like luteolin, sulforaphane, which is involved in stress tolerance, promotes nuclear translocation of DAF-16, thereby prolonging the lifespan of C. elegans and increasing the expression of stress response-related genes. Therefore, luteolin may contribute to the regulation of DAF-16 nuclear translocation in C. elegans under oxidative stress conditions.

Fig. 3

Effects of luteolin on the lifespan and expression of stress response-related genes in wild-type N2 worms under oxidative stress conditions. The survival curves were plotted based on pooled data from three independent experiments (a). N2-control + PQ (n = 120, N2-luteolin + PQ (n = 120). *p < 0.05 by log-rank test. Expression analysis of daf-16 (b), skn-1 (c), gst-4 (d), sod-1 (e), sod-2 (f), sod-3 (g), ctl-1 (h), ctl-2 (i), and ctl-3 (j) in N2 worms after exposure to 0.1 % (v/v) DMSO (control) or 10 µM luteolin followed by 5 mM PQ exposure. Mean ± SD, n = 3, *p < 0.05 by t-test.

Fig. 4

Effects of luteolin on the growth, maturation, reproduction, expression of stress response-related genes and the uptake of luteolin into the body of CF1038 under normal conditions. The growth (a), maturation (b) and reproduction (c) results are shown as mean ± SD, three or four independent experiments. The images of luteolin uptake into the body are shown with brightfield observation on the left and fluorescence observation on the right, scale bar 100 µm (d). Expression analysis of gst-4 (e), sod-1 (f), sod-2 (g), sod-3 (h), ctl-3 (i), and skn-1 (j), in CF1038 worms after exposure to 0.1 % (v/v) DMSO (control) or 10 µM luteolin. Mean ± SD, n = 3

Fig. 5

Effects of luteolin on the lifespan and expression of stress response-related genes in CF1038, under oxidative stress conditions. The survival curves were plotted based on pooled data from three independent experiments (a). CF1038-control + PQ (n = 238), CF1038-luteolin + PQ (n = 240). Expression analysis of gst-4 (b), sod-1 (c), sod-2 (d), sod-3 (e), and ctl-3 (f) in CF1038 after exposure to 0.1 % (v/v) DMSO (control) or 10 uM luteolin followed by 5 mM PQ exposure. Mean ± SD, n = 3.

In conclusion, luteolin prolonged the lifespan of C. elegans under oxidative stress conditions, but had no effect on lifespan under normal conditions. Under stress conditions, luteolin induced the expression of antioxidant-related genes regulated by daf-16. These results suggest that luteolin enhances oxidative stress tolerance in C. elegans by regulating the expression of antioxidant-related genes via daf-16. Further studies on whether luteolin increases the nuclear translocation of DAF-16 are necessary to clearly understand the physiological effects of luteolin.

Acknowledgements This work was supported by Diverse Research Environment Hirosaki University Joint Research Support. We are grateful to Dr. C. Ushida (Hirosaki University) for useful discussion.

Conflict of interest There are no conflicts of interest to declare.

Abbreviations

DPBA

2-aminoethyl diphenyl borate

DMSO

dimethyl sulfoxide

FUdR

5-fluoro-2′-deoxyuridine

PQ

paraquat

SOD

superoxide dismutase

References

•  Aranaz,  P.,  Navarro-Herrera,  D.  Zabala,  M.,  Romo-Hualde,  A.,  López-Yoldi,  M.,  Vizmanos,  J.,  Milagro,  F., and  González-Navarro,  C., (2020). Phenolic compounds reduce the fat content in Caenorhabditis elegans by affecting lipogenesis, lipolysis, and different stress responses. Pharmaceutical, 13, 355. doi: 10.3390/ph13110355
•  Bito,  T.,  Misaki,  T.,  Yabuta,  Y.,  Ishikawa,  T.,  Kawano,  T., and  Watanabe,  F. (2017). Vitamin B12 deficiency results in severe oxidative stress, leading to memory retention impairment in Caenorhabditis elegans. Redox Biol., 11, 21–29. doi: 10.1016/j.redox.2016.10.013
•  Büchter,  C.,  Ackermann,  D.,  Havermann,  S.,  Honnen,  S.,  Chovolou,  Y.,  Fritz,  G.,  Kampkötter,  A., and  Wätjen,  W. (2013). Myricetin-mediated lifespan extension in Caenorhabditis elegans is modulated by DAF-16. Int. J. Mol. Sci., 14, 11895–11914. doi: 10.3390/ijms140611895
•  Fischer,  N.,  Büchter,  C.,  Koch,  K.,  Albert,  S.,  Csuk,  R., and  Wätjen,  W. (2017). The resveratrol derivatives trans-3,5-trihydroxystilbene decrease oxidative stress and prolong lifespan in Caenorhabditis elegans. J. Pharm. Pharmacol., 69, 73–81. doi: 10.1111/jphp.12657.
•  Grünz,  G.,  Haas,  K.,  Soukup,  S.,  Klingenspor,  M.,  Kulling,  S. E.,  Daniel,  H., and  Spanier,  B. (2012). Structural features and bioavailability of four flavonoids and their implications for lifespan extending and antioxidant actions in C. elegans. Mech. Ageing Dev., 133, 1–10. doi: 10.1016/j.mad.2011.11.005
•  Hirano,  R.,  Sasamoto,  W.,  Matsumoto,  A.,  Itakura,  H.,  Igarashi,  O., and  Kondo,  K. (2001). Antioxidant ability of various flavonoids against DPPH radicals and LDL oxidation. J. Nutr. Sci. Vitaminol., 47, 357–362. doi: 10.3177/jnsv.47.357
•  Ibe,  S.,  Fujii,  Y., and  Otobe,  K. (2012). Evaluation of the in vivo antioxidant activity of Mucuna pruriens DC. var. utilis by using Caenorhabditis elegans. Food Sci. Technol. Res., 18, 227–233. doi: 10.3136/fstr.18.227
•  Hoogewijs,  D.,  Houthoofd,  K.,  Matthijssens,  F.,  Vandesompele,  J., and  Vanfleteren,  J. R. (2008). Selection and validation of a set of reliable reference genes for quantitative sod gene expression analysis in C. elegans. BMC Mol. Biol., 9, 9. doi: 10.1186/1471-2199-9-9
•  Kampkötter,  A.,  Pielarski,  T.,  Rohrig,  R.,  Timpel,  C.,  Chovolou,  Y.,  Wätjen,  W., and  Kahl,  R. (2007). The Ginkgo biloba extract EGb761 reduced stress sensitivity, ROS accumulation and expression of catalase and glutathione S-transferase 4 in Caenorhabditis elegans. Pharmacol. Res., 55, 139–147. doi: 10.1016/j.phrs.2006.11.006
•  Kampkötter,  A.,  Timpel,  C.,  Zurawski,  R. F.,  Ruhl,  S.,  Chovolou,  Y.,  Proksch,  P., and  Wätjen,  W. (2008). Increase of stress resistance and lifespan of Caenorhabditis elegans by quercetin. Comp. Biochem. Physiol. B Biochem. Mol. Biol., 149, 314–323. doi: 10.1016/j.cbpb.2007.10.004
•  Lashmanova,  E.,  Zemskaya,  N.,  Proshkina,  E.,  Kudryavtseva,  A.,  Volosnikava,  M.,  Marusich,  E.,  Leonov,  S.,  Zhavoronkov,  A., and  Moskalev,  A. (2017). The evaluation of geroprotective effects of selected flavonoids in Drosophila melanogaster and Caenorhabditis elegans. Front. Pharmacol., 8, 884. doi: 10.3389/fphar.2017.00884
•  Liao,  V. HC. (2018). Use of Caenorhabditis elegans to study the potential bioactivity of Natural compounds. J. Agric. Food Chem., 28, 1737–1742. doi: 10.1021/acs.jafc.7b05700
•  Muruganathan,  M.,  Dhanapal,  A. R.,  Baskar,  V.,  Muthurmalingam,  P.,  Selvaraj,  D.,  Ara,  H.,  Abdullah,  M. Z. S., and  Sivanesan,  I. (2022). Recent updates on source, biosynthesis and therapeutic potential of natural flavonoid luteolin: a review. Metabolites, 12, 1145. doi: 10.3390/metabo12111145
•  Ogawa,  T.,  Kodera,  Y.,  Hirata,  D.,  Blackwell,  T. K., and  Mizunuma,  M. (2016). Natural thioallyl compounds increase oxidative stress resistance and lifespan in Caenorhabditis elegans by modulating SKN-1/Nrf. Sci. Rep., 22, 21611, doi: 10.1038/srep21611
•  Prasher,  P.,  Sharma,  M.,  Singh,  S. K.,  Gulati,  M.,  Chellappan,  D. K.,  Zacconi,  F.,  Rubis,  G. D.,  Gupta,  G.,  Sharifi-Rad,  J.,  Cho,  W. C. and  Dua,  K. (2022). Luteolin: a flavonoid with a multifaceted anticancer potential. Cancer cell Int., 22, 386. doi: 10.1186/s12935-022-02808-3
•  Qi,  Z.,  Ji,  H.,  Le,  M.,  Li,  H.,  Wieland,  A.,  Bauer,  S.,  Liu,  L.,  Wink,  M., and  Herr,  I. (2021). Sulforaphane promotes C. elegans longevity and healthspan via DAF-16/DAF-2 insulin/IGF-1 signaling. Aging, 13, 1649–1670. doi: 10.18632/aging.202512
•  Slika,  H.,  Mansour,  H.,  Wehbe,  N.,  Nasser,  S. A.,  Iratni,  R.,  Nasrallah,  G.,  Shaito,  A.,  Ghaddar,  T.,  Kobeissy,  F., and  Eid,  A. H., (2022). Therapeutic potential of flavonoids in cancer: ROS-mediated mechanisms. Biomed. Pharmacother., 146, 112442. doi: 10.1016/j.biopha.2021.112442
•  Sugawara,  T., and  Sakamoto,  K. (2020). Quercetin enhances motility in aged and heat-stressed Caenorhabditis elegans nematodes by modulating both HSF-1 activity, and insulin-like and p38-MAPK signaling. PLOS ONE, 15, e0238528. doi: 10.1371/journal.pone.0238528
•  Tian,  C.,  Liu,  X.,  Change,  Y.,  Wang,  R.,  Lv,  T., and  Cui,  C. (2021). Investigation of the anti-inflammatory and antioxidant activities of luteolin, kaempferol, apigenin and quercetin. Afr. J. Bot., 137, 257–264. doi: 10.1016/j.sajb.2020.10.022
•  Tian,  J.,  Geiss,  C.,  Zarse,  K.,  Madreiter-Sokolowski,  C. T., and  Ristow,  M. (2021). Green tea catechins EGCG and ECG enhance the fitness and lifespan of Caenorhabditis elegans by complex I inhibition. Aging, 13, 22629–22648. doi: 10.18632/aging.203597
•  Wan,  Q. Q-L.,  Fu,  X.,  Meng,  X.,  Luo,  Z.,  Dai,  W.,  Yang,  J.,  Wang,  C.,  Wang,  H., and  Zhou,  Q. (2020). Hypotaurine promotes longevity and stress tolerance via the stress response factors DAF-16/FOXO and SKN-1/NRF2 in Caenorhabditis elegans. Food & function, 11, 347–357. doi: 10.1039/c9fo02000d
•  Xiao,  Y.,  Zhang,  L.,  Zhu,  X.,  Qin,  Y.,  Yu,  C.,  Jiang,  N.,  Li,  S.,  Liu,  F., and  Liu,  Y. (2023). Luteolin promotes pathogen resistance in Caenorhabditis elegans via DAF-2/DAF-16 insulin-like signaling pathway. Int. Immunopharmacol., 115, 109679. doi: 10.1016/j.intimp.2023.109679
•  Yanase,  S.,  Yasuda,  K., and  Ishii,  N. (2002). Adaptive response to oxidative damage in three mutants of Caenorhabditis elegans (age-1, mev-1 and daf-16) that affect life span. Mech. Ageing Dev., 128, 1579–1587. doi: 10.1016/s0047-6374(02)00093-3
•  Zhu,  A.,  Zheng,  F.,  Zhang,  W.,  Li,  L.,  Li,  Y.,  Hu,  H.,  Wu,  Y.,  Bao,  W.,  Li,  G.,  Wang,  Q., and  Li,  H. (2022). Oxidation and antioxidation of natural products in the model organism Caenorhabditis elegans. Antioxidants, 11, 705. doi: 10.3390/antiox11040705