Association between Helicobacter suis infection and the pathogenesis of gastric mucosa-associated lymphoid tissue lymphoma

Abstract

Objective: In patients with Helicobacter pylori-negative gastric mucosa-associated lymphoid tissue (MALT) lymphoma, eradication therapy is only effective in some cases, suggesting that infections with non-H. pylori Helicobacter (NHPH) species may also be involved. Therefore, we examined the prevalence of infection with Helicobacter suis, an NHPH, in gastric MALT lymphoma patients.

Methods: We examined the H. suis infection status of 15 patients with H. pylori-negative gastric MALT lymphoma. To examine the infection prevalence through species-specific PCR analysis, DNA was extracted from the lymphoma lesion and the background gastric mucosa. We compared the PCR products amplified from DNA extracted from different lesions.

Results: H. suis was detected in 3 of the 15 cases (20.0%), but only in the background gastric mucosa and not in the lymphoma lesion. H. suis was completely eradicated in all three cases and two of the three cases exhibited complete remission of the lymphoma.

Conclusion: These results indicated that H. suis infection may be involved in the pathogenesis of gastric MALT lymphoma. We conclude that it is desirable to use multiple biopsies, including the background mucosa, to evaluate NHPH infection in gastric MALT lymphoma patients.

INTRODUCTION

Gastric mucosa-associated lymphoid tissue (MALT) lymphoma is an extranodal B cell lymphoma characterized by morphologically diverse cells infiltrating into the mucosa-associated lymphoid tissues, mainly in the follicular marginal zone⁷⁾. Gastric MALT lymphoma is thought to develop due to chronic inflammation caused by Helicobacter pylori infection. Generally, in H. pylori-positive gastric MALT lymphoma cases, H. pylori eradication therapy leads to complete regression of the lymphoma^13,14,17). However, in some cases, even in patients without H. pylori infection, the eradication treatment has been reported to successfully result in complete remission (CR)^10–12).

One hypothesis for this phenomenon is that non-H. pylori Helicobacter (NHPH) infections may also be involved in the pathogenesis of gastric MALT lymphoma¹³⁾. NHPHs are also referred to as Helicobacter heilmannii-like organisms³⁾ or H. heilmannii sensu lato. Previous studies have shown that infections with NHPH lead to various gastric diseases, including gastric MALT lymphoma^5,9). The prevalence of NHPH infections ranges between 0.2–6% in the general population, which is much lower than the prevalence of H. pylori infections^15,16,18). Helicobacter suis is an NHPH that has been recognized as a new taxonomic group of Helicobacter species and it may be the NHPH that has the strongest relevance to the development of gastric MALT lymphoma^1,3,6,8,16).

Because the prevalence of H. suis infection is higher in H. pylori-negative patients than in H. pylori-positive patients⁸⁾, we randomly selected patients with H. pylori-negative MALT lymphoma. We examined the prevalence of H. suis infection in 15 H. pylori-negative gastric MALT lymphoma patients and compared the PCR results of DNA extracted from various sites (lymphoma lesion and background gastric mucosa).

MATERIALS AND METHODS

Patients

Fifteen H. pylori-negative, API2-MALT1 translocation-negative gastric MALT lymphoma patients were randomly selected for this study. They were diagnosed with gastric MALT lymphoma according to the diagnostic criteria of the World Health Organization and symptoms were consistent with grade 4 or 5 of the Wotherspoon histological scoring system. Patients were treated and monitored at the Hiroshima University Hospital between 2001 and 2017. After treatment, histopathological evaluation was performed using the Group d’Etude des Lymphomes deI’Adulte (GELA) grading system. CR of lymphoma was defined as complete histological response (ChR) or probable minimal residual disease (pMRD) in the GELA system, or grades 0 or 1 in the Wotherspoon scoring system. H. pylori infection was determined according to histological analysis, an anti-H. pylori IgG assay (E-plate, Eiken, Tokyo, Japan; cut-off level, 10 U/mL), a urea breath test (Otsuka, Tokushima, Japan; cut-off level, 2.5‰), and species-specific PCR analysis. Patients were considered H. pylori-positive if at least one of the tests yielded a positive result, and H. pylori-negative if all tests were negative. Endoscopic biopsy specimens were obtained from lymphoma lesions and the background gastric mucosa. One biopsy specimen from the lymphoma lesion was immediately frozen and stored until subsequent PCR analysis (fresh frozen [FF] tissues). Formalin-fixed paraffin-embedded (FFPE) specimens were used for histopathological diagnosis of MALT lymphoma and analysis of the background gastric mucosa. The API2-MALT1 chimeric gene was detected by RT-PCR and/or fluorescence in situ hybridization. The patients had a mean age of 60.1 years and included 5 males and 10 females (Table 1). These studies were performed in accordance with the Declaration of Helsinki and were approved by the Institutional Review Board of the Hiroshima University Hospital. Informed consent was obtained from all patients.

Table 1 Characteristics of H. pylori-negative gastric MALT lymphoma patients

Patients	Age (yr)	Sex	H. suis infection	Endoscopic Appearance	Gastric atrophy	Lesion site	Response to eradication therapy
1	61	Male	–	Superficial	C-0	Corpus	NC
2	68	Female	–	Superficial	C-1	Corpus	NC
3	56	Female	–	Superficial	C-0	Corpus	NC
4	44	Male	+	Superficial	C-0	Corpus-Fundus	CR
5	73	Female	–	Superficial	C-0	Fundus	NC
6	59	Female	–	Superficial	C-0	Corpus	CR
7	70	Female	+	Superficial	C-0	Corpus	NC
8	67	Female	–	Superficial	C-0	Corpus	NC
9	65	Female	–	Superficial	C-0	Corpus	NC
10	32	Male	+	Superficial	C-1	Corpus	CR
11	59	Female	–	Superficial	C-0	Fundus	CR
12	66	Female	–	Superficial	C-1	Fundus	CR
13	50	Male	–	Superficial	C-1	Corpus	CR
14	73	Female	–	Superficial	O-3	Angle	CR
15	60	Male	–	Superficial	C-0	Corpus	CR

CR: complete remission, NC: no change

DNA extraction and PCR

The All Prep^TM DNA/RNA Micro Kit (Qiagen, Hilden, Germany) and the Gene Read^TM DNA FFPE Kit (Qiagen) were used to extract DNA from FF and FFPE samples, respectively, according to the manufacturer’s instructions. Detection of H. suis and H. pylori was performed through species-specific PCR. DNA integrity was confirmed by the amplification of the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene. The PCR conditions, thermal cycler parameters, and gene-specific primers used for amplification are listed in Table 2.

Table 2 PCR conditions, thermal cycling parameters, and gene-specific primers used for amplification

Markers	Oligonucleotides 5'-3'	Size of amplicon	Thermal cycler condition	References
H. suis (ureA)	F: CACCACCCCGGGGAAGTGATCTTG R: CTACATCAATCAAATGCACGGTTTTTTCTTCG	253 bp	95°C for 7 min 94°C for 30 sec 61°C for 40 cycles 72°C for 30 sec 72°C for 7 min	[8]
H. pylori (ureAB)	F: AAAGAGCGTGGTTTTCATGGCG R: GGGTTTTACCGCCACCGAATTTAA	217 bp	95°C for 7 min 94°C for 30 sec 60°C for 30 cycles 72°C for 30 sec 72°C for 7 min	[8]
Human GAPDH	F: CCAGGAGTGAGTGGAAGACA R: GCAAATGAGCCTACAGCAGA	130 bp	95°C for 7 min 94°C for 30 sec 60°C for 30 cycles 72°C for 30 sec 72°C for 7 min	This study

As positive controls, we used specific DNA amplicons that had previously been validated under the same conditions. For negative controls, RNAase-free water was added instead of DNA template. PCR products were separated by electrophoresis through a 2.0% agarose gel and were then stained with ethidium bromide.

RESULTS

Detection of H. suis infection by species-specific PCR

To evaluate H. pylori and H. suis infection status, we performed H. pylori species-specific PCR using DNA extracted from FFPE and FF tissues. GAPDH-specific bands were amplified and detected in all cases. Therefore, DNA integrity was well maintained in both FFPE and FF tissues. H. pylori-specific bands were not detected in any of the patients, indicating that these were indeed H. pylori-negative lymphoma cases. We then determined the H. suis infection status of H. pylori-negative gastric MALT lymphoma patients using species-specific PCR. H. suis-specific bands were detected in 3 of the 15 patients (20.0%). Specific amplicons were only detected in FFPE specimens (non-tumorous gastric mucosa), and not in FF specimens (tumor tissues).

Figure 1

Detection of H. suis through species-specific PCR analysis. In 3 of the 15 patients, H. suis-specific bands were detected by PCR analysis of DNA extracted from formalin-fixed paraffin-embedded (FFPE) tissues (background gastric mucosa), but not DNA from fresh frozen (FF) tissues (tumor site) (A). GAPDH amplification confirmed the integrity of DNA from both FFPE and FF tissues. After eradication therapy, H. suis-specific bands were no longer detected (B). P and N are the positive and negative controls (water), respectively. Lane M, size marker.

To eradicate Helicobacter infection, these patients underwent treatment with orally administered lansoprazole (30 mg/day), amoxicillin (750 mg/day), and clarithromycin (400 mg/day) twice a day for 1 week. For all three patients, eradication of the H. suis infection was confirmed by PCR analysis. In addition, 2 of the 3 H. suis-positive lymphoma cases showed CR after the eradication treatment.

Case reports of H. suis-positive gastric MALT lymphoma patients treated with eradication therapy

The clinicopathological characteristics of H. suis-positive MALT lymphoma patients are summarized in Table 2. Immunoglobulin heavy chain (IGH) gene rearrangement was evaluated, and monoclonal IGH rearrangement was confirmed in all cases (data not shown). API2-MALT1 chimeric transcripts were not detected in any of these cases (data not shown). We show a representative case of a 32-year-old male (case number 10). Endoscopic examination revealed a superficial elevated lesion (20 mm in diameter) on the angular incisures of the lesser curvature of the stomach (Figure 2A). Indigo carmine chromoendoscopy revealed that this lesion had a granular surface (Figure 2B). Pathological characteristics consistent with gastric MALT lymphoma were detected in biopsy specimens. Atypical lymphoid cells were found to have invaded the epithelium (lymphoepithelial lesions, Figure 2E). Immunohistochemistry assays revealed that CD20 staining was slightly greater than CD3 staining in each specimen (Figure 2F). Three months after the eradication of infection, the flat elevated lesion disappeared (Figure 2C, D) and CR was confirmed histopathologically (Figure 2G). In all three cases of H. suis-positive gastric MALT lymphoma, endoscopic and pathological observations were similar, and the efficacy of eradication therapy was confirmed using H. suis species-specific PCR. However, the lymphoma cells did not disappear after eradication therapy in one case (case number 7).

Figure 2

Endoscopic and histological observations before (A, B, E, F) and after (C, D, G) eradication therapy. Irregular protruding lesions on the angular incisure were observed by white light endoscopy (A) and indigo carmine chromoendoscopy (B). After eradication therapy, the surface irregularity of the gastric lesion improved. (C, D). Histological analysis by hematoxylin-eosin staining revealed a diffuse infiltrate of centrocyte-like cells and the formation of lymphoepithelial lesions (E). Immunohistochemical analysis showed that these centrocyte-like cells were positive for CD20 (F). Three months after eradication therapy, lymphoma cells had completely regressed (G).

DISCUSSION

Numerous studies have reported the association between H. pylori infection and various gastric diseases. However, there are few reports regarding NHPH infections. In vitro cultivation of NHPH species is difficult and their urease activity is low^2,6). Therefore, species-specific PCR analysis is considered to be the most accurate method of diagnosis in these cases^2,6).

In this study, we detected H. suis infection by PCR in H. pylori-negative gastric MALT lymphoma patients. H. suis was detected in 3 out of 15 cases (20%), using DNA extracted from background mucosa FFPE specimens. However, H. suis-specific bands were only detected in DNA isolated from FFPE tissues and not from FF samples. This discrepancy is not likely to be due to the fixation method, as DNA quality was confirmed by GAPDH amplification. However, it may be due to the location of the tissue sample and the number of biopsies taken. FFPE specimens were prepared to evaluate atrophic gastritis from various regions that contain normal gastric mucosa. The FF tissues were obtained through a pinpoint biopsy at the tumor site. Therefore, we hypothesize that H. suis may not colonize the lymphoma tumor site. Flahou et al. reported that H. suis infections spread throughout the stomach and are not localized to the lymph follicles⁴⁾. Generally, H. suis tends to colonize the pyloric gland. Hence, when evaluating H. suis infection, biopsies from multiple sites, including the background gastric mucosa, should be used. The present study had several limitations that must be considered. Firstly, the number of patients was relatively small because we specifically selected H. pylori-negative patients. Secondly, the method of DNA extraction was different between biopsy specimens from tumor sites and normal mucosa. However, the PCR results reflected the effect of H. suis localization, rather than the quality of the extracted DNA.

Two of the three H. suis-positive lymphoma patients and 6 of the 12 H. suis-negative gastric MALT lymphoma patients showed CR after eradication therapy. The efficacy of eradication therapy was not significantly different between these two groups. It is possible that other NHPH species may also be involved in the pathogenesis of gastric MALT lymphoma. Therefore, additional studies using species-specific PCR analysis of a large number of patients are needed.

ACKNOWLEDGEMENTS

This research was partially supported by the PUH Research Grant Program (Advanced Research A).

REFERENCES

• 1   Baele,  M.,  Decostere,  A.,  Vandamme,  P.,  Ceelen,  L.,  Hellemans,  A.,  Mast,  J., et al. 2008. Isolation and characterization of Helicobacter suis sp. nov. from pig stomachs. International Journal of Systematic and Evolutionary Microbiology 58: 1350–1358.
• 2   De Groote,  D.,  Ducatelle,  R.,  van Doorn,  L.J.,  Tilmant,  K.,  Verschuuren,  A. and  Haesebrouck,  F. 2000. Detection of “Candidatus Helicobacter suis” in gastric samples of pigs by PCR: comparison with other invasive diagnostic techniques. Journal of Clinical Microbiology 38: 1131–1135.
• 3   De Groote,  D.,  Van Doorn,  L.J.,  Van den Bulck,  K.,  Vandamme,  P.,  Vieth,  M.,  Stolte,  M., et al. 2005. Detection of non-pylori Helicobacter species in “Helicobacter heilmannii”-infected humans. Helicobacter 10: 398–406.
• 4   Flahou,  B.,  Haesebrouck,  F.,  Pasmans,  F.,  D’Herde,  K.,  Driessen,  A.,  Van Deun,  K., et al. 2010. Helicobacter suis Causes Severe Gastric Pathology in Mouse and Mongolian Gerbil Models of Human Gastric Disease. PLoS ONE 5: 11–e14083.
• 5   Haesebrouck,  F.,  Pasmans,  F.,  Flahou,  B.,  Chiers,  K.,  Baele,  M.,  Meyns,  T., et al. 2009. Gastric helicobacters in domestic animals and nonhuman primates and their significance for human health. Clinical Microbiology Reviews 22: 202–223.
• 6   Haesebrouck,  F.,  Pasmans,  F.,  Flahou,  B.,  Smet,  A.,  Vandamme,  P. and  Ducatelle,  R. 2011. Non-Helicobacter pylori Helicobacter species in the human gastric mucosa: a proposal to introduce the terms H. heilmannii sensu lato and sensu stricto. Helicobacter 16: 339–340.
• 7   Isaacson,  P. and  Wright,  D.H. 1984. Extranodal malignant lymphoma arising from mucosa-associated lymphoid tissue. Cancer 53: 2515–2524.
• 8   Liu,  J.,  He,  L., Haesebrouck, F.  Gong ,  Y.,  Flahou,  B.,  Cao,  Q., et al. 2015. Prevalence of Coinfection with Gastric Non-Helicobacter pylori Helicobacter (NHPH) Species in Helicobacter pylori-infected Patients Suffering from Gastric Disease in Beijing, China. Helicobacter 20: 284–290.
• 9   Morgner,  A.,  Bayerdörffer,  E.,  Meining,  A.,  Stolte,  M. and  Kroher,  G. 1995. Helicobacter heilmannii and gastric cancer. Lancet 346: 511–512.
• 10   Morgner,  A.,  Lehn,  N.,  Andersen,  L.P.,  Thiede,  C.,  Bennedsen,  M.,  Trebesius,  K., et al. 2000. Helicobacter heilmannii-associated primary gastric low-grade MALT lymphoma: complete remission after curing the infection. Gastroenterology 118: 821–828.
• 11   Nakagawa,  S.,  Shimoyama,  T., Nakamura, M.  Chiba,  D.,  Kikuchi,  H.,  Sawaya,  M., et al. 2018. The Resolution of Helicobacter suis-associated Gastric Lesions after Eradication Therapy. Internal Medicine 57: 203–207.
• 12   Okamura,  T.,  Iwaya,  Y.,  Yokosawa,  S.,  Suga,  T.,  Arakura,  N.,  Matsumoto,  T., et al. 2013. A case of Helicobacter heilmannii-associated primary gastric mucosa-associated lymphoid tissue lymphoma achieving complete remission after eradication. Clinical Journal of Gastroenterology 6: 38–45.
• 13   Parsonnet,  J.,  Hansen,  S.,  Rodriguez,  L.,  Gelb,  A.B.,  Warnke,  R.A.,  Jellum,  E., et al. 1994. Helicobacter pylori infection and gastric lymphoma. The New England Journal of Medicine 330: 1267–1271.
• 14   Stolte,  M. and  Eidt,  S. 1993. Healing gastric MALT lymphomas by eradicating H pylori? Lancet 342: 568.
• 15   Stolte,  M.,  Kroher,  G.,  Meining,  A.,  Morgner,  A.,  Bayerdörffer,  E. and  Bethke,  B. 1997. A comparison of Helicobacter pylori and H. heilmannii gastritis. A matched control study involving 404 patients. Scandinavian Journal of Gastroenterology 32: 28–33.
• 16   Van den Bulck,  K.,  Decostere,  A.,  Baele,  M.,  Driessen,  A.,  Debongnie,  J.C.,  Burette,  A., et al. 2005. Identification of non-Helicobacter pylori spiral organisms in gastric samples from humans, dogs, and cats. Journal of Clinical Microbiology 43: 2256–2260.
• 17   Wotherspoon,  A.C.,  Doglioni,  C.,  Diss,  T.C.,  Pan,  L.,  Moschini,  A.,  de Boni,  M., et al. 1993. Regression of primary low-grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after eradication of Helicobacter pylori. Lancet 342: 575–577.
• 18   Wuppenhorst,  N.,  von Loewenich,  F.,  Hobmaier,  B.,  Vetter-Knoll,  M.,  Mohadjer,  S. and  Kist,  M. 2013. Culture of a gastric non-Helicobacter pylori Helicobacter from the stomach of a 14-year-old girl. Helicobacter 18: 1–5.