Association of Antipsychotic Drugs with Venous Thromboembolism: Data Mining of Food and Drug Administration Adverse Event Reporting System and Mendelian Randomization Analysis

Abstract

Aims: Past observational studies have reported on the association between antipsychotic drugs and venous thromboembolism (VTE); however, the conclusions remain controversial, and its mechanisms are yet to be fully understood. Thus, in this study, we aim to determine the associations of antipsychotic drugs with VTE, including deep vein thrombosis (DVT) and pulmonary embolism (PE), and their potential mechanisms.

Methods: We first mined the adverse event signals of VTE, DVT, and PE caused by antipsychotic drugs in Food and Drug Administration Adverse Event Reporting System (FAERS). Next, we used two-sample Mendelian randomization (MR) method to investigate the association of antipsychotic drug target gene expression with VTE, DVT, and PE, using single-nucleotide polymorphisms as genetic instruments. We not only used the expression of all antipsychotic drug target genes as exposure to perform MR analyses but also analyzed the effect of single target gene expression on the outcomes.

Results: In the FAERS, 1694 cases of VTE events were reported by 16 drugs. However, using the MR approach, no significant association was determined between the expression of all antipsychotic target genes and VTE, DVT, or PE, either in blood or brain tissue. Although the analysis of single gene expression data showed that the expression of nine genes was associated with VTE events, these targets lacked significant pharmacological action.

Conclusions: Adverse event mining results have supported the claim that antipsychotic drugs can increase the risk of VTE. However, we failed to find any genetic evidence for this causal association and potential mechanisms. Thus, vigilance is still needed for antipsychotic drug-related VTE despite the limited supporting evidence.

See editorial vol. 31: 351-352

Introduction

Antipsychotic drugs are commonly used to alleviate psychotic symptoms and are widely used in patients with schizophrenia, bipolar disorder, and other related conditions. Their adverse effects have also been of concern¹⁾. Venous thromboembolism (VTE), which is a complex, multifactorial disease that includes deep vein thrombosis (DVT) and pulmonary embolism (PE)²⁾, is one such potential adverse effect. The association between antipsychotics and VTE risk was reported as early as the 1950s^{3, 4)}. And majority of past observational studies have demonstrated a positive association between antipsychotic drugs and risks for VTE events^5-7), but this risk is noted to range widely (odds ratios from 1.17 to 20.8)^{8, 9)}. Notably, several studies have also reported negative findings^{10, 11)}. These conflicting results suggest that how antipsychotic drugs affect or trigger VTE events remains uncertain. Furthermore, despite proposed hypotheses such as sedation, obesity, hyperhomocysteinemia, hyperprolactinemia, and enhanced platelet aggregation¹²⁾, the mechanisms by which antipsychotic drugs increase the risk of VTE are yet to be determined. For these reasons, further study is needed to evaluate the effect of antipsychotic drugs on VTE events and determine its potential mechanisms, which could provide new scientific evidence and basis for clinical management of the drug’s adverse effects.

The United States Food and Drug Administration Adverse Event Reporting System (FAERS), which is a publicly accessible database, is used to collect information on spontaneously reported adverse drug events¹³⁾. It is frequently employed in adverse drug event signal mining studies.

Meanwhile, Mendelian randomization (MR) is described as a genetic epidemiological approach that can infer causal relationships between exposure and outcome by using genetic variants that are strongly correlated with exposure as instrumental variables (IVs)¹⁴⁾. Genetic variations associated with drug target gene expression, also known as expression quantitative trait loci (eQTL), can be used as genetic instruments for MR to evaluate the associations between drugs and outcomes of interest. This approach has been previously used to assess the efficacy and mechanism of metformin targets on reducing Alzheimer’s disease risk¹⁵⁾, the association of antihypertensive drug target genes with psychiatric disorders¹⁶⁾, etc.

Aim

In this study, we first analyzed the association between antipsychotic drugs and VTE events by mining the FAERS database. Then, we performed two-sample MR analyses to evaluate the causal relationship and potential mechanisms between the two. In this section, we not only performed overall analyses with the expression of all drug target genes as exposure but also analyzed the effect of single target gene expression on the outcomes separately. Through the MR approach, we aimed to investigate whether antipsychotic target gene expression affects or triggers the risk of VTE. This study could enrich the evidence and mechanisms of the association between antipsychotic drugs and VTE from both real-world big data and genetics perspectives.

Methods

1. Identification of Antipsychotic Drugs and Target Genes

We first identified the different classes of antipsychotic drugs according to the Anatomical Therapeutic Chemical (ATC) classification system and obtained the active ingredients of each drug. The target genes of these active ingredients were identified using the DrugBank database¹⁷⁾ (https://go.drugbank.com/).

2. Venous Thromboembolism Adverse Event Data Source and Signal Mining

The adverse event data were collected from the FAERS database, and these data were extracted, mined, and analyzed using the online tool OpenVigil 2.1 ¹⁸⁾ (https://openvigil.sourceforge.net/). In the “Search Window,” the “Adverse event” column was set to venous thrombosis, DVT, and PE, respectively. Then, the above active ingredients were inputted one by one into the “Drug” column to search for adverse event signal. In this study, ADE signals were identified using disproportionality analyses (DPA), and the statistical index was proportional reporting ratio (PRR). A PRR ≥ 2, Chi-square value ≥ 4, and the number of reports ≥ 3 indicated an association between the drug and the adverse event^{19, 20)}. The data used in this study covered the period from 2004 Q1 to 2022 Q2 (completed 2022.09.27).

3. MR study design

In this study, we performed two-sample MR analyses to evaluate the associations between antipsychotic drug target genes and VTE (including DVT and PE) using single-nucleotide polymorphisms (SNPs) as genetic instruments. The MR study design is demonstrated in Fig.1. In the first part of the MR analyses, we took the expression of all antipsychotic drug target genes in blood or brain tissue as exposure and analyzed its relationship with VTE (including DVT and PE) outcomes. In the second part, we analyzed the effect of each target gene expression (in blood or brain tissue) on the outcomes separately. In this study, we used only publicly available, published summary-level genetic data involving European individuals.

Fig.1. Mendelian randomization study design

Our MR study aimed to evaluate the association between antipsychotic drug target gene expression and VTE (including DVT and PE). We first used the expression of all antipsychotic drug target genes in blood or brain tissue as exposure. In the second part, we analyzed the effect of each target gene expression (in blood or brain tissue) on the outcomes separately. DVT, deep vein thrombosis; eQTL, expression quantitative trait loci; IVs, instrumental variables; PE, pulmonary embolism; SNP, single-nucleotide polymorphism; VTE, venous thromboembolism.

4. Selection of Genetic Instruments for Antipsychotic Drug Target Gene Expression

We used publicly available data from the eQTLGen consortium²¹⁾ (https://www.eqtlgen.org/cis-eqtls.html) to identify SNPs associated with antipsychotic drug target gene expression in blood and GTEx project²²⁾ (https://www.gtexportal.org/home/) data to identify SNPs associated with drug target gene expression in brain tissue.

In this study, the exposures of the two parts of MR analysis were different; therefore, the genetic instruments were selected in two ways. Taking blood expression data as an example, the most significant cis-eQTL SNP for each gene (Top eQTL SNP) was selected to form genetic instruments for the blood expression of all antipsychotic drug target genes. In addition, for each target gene, a series of statistically significant SNPs with P＜1×10⁻⁵ and linkage disequilibrium (LD) R²＜0.3 (clumping window＜10,000 kb)²³⁾ were selected as genetic instruments for the blood expression of each drug target gene. The same approach was followed for selecting genetic instruments for brain tissue gene expression. The strength of the SNP instruments was evaluated using the F-statistic (F-statistic=(β/SE)²), and only SNPs with an F-statistic greater than 10 were included in this analysis.

5. Outcome Data

Outcome data were derived from publicly available case-control genome-wide association study (GWAS) summary data in Integrative Epidemiology Unit (IEU) OpenGWAS^{24, 25)} (https://gwas.mrcieu.ac.uk/). The three outcome data are all from FinnGen Biobank²⁶⁾: VTE (finn-b-I9_VTE: 9,176 cases and 209,616 controls), DVT (finn-b-I9_PHLETHROMBDVTLOW: 4,576 cases and 190,028 controls), and PE (finn-b-I9_PULMEMB: 4,185 cases and 214,228 controls). FinnGen is a large biobank that combines genotype data with phenotype data generated from the digital health record data from Finnish health registries. An overview of the GWAS used for these outcomes is shown in Supplementary Table 1.

Supplementary Table 1.Genome-wide association studies used in Mendelian randomisation analysis

Variables	Sample size	Case	Control	No. SNPs	Participates	Year of release	Source	GWAS ID
VTE	218,792	9,176	209,616	16,380,466	European	2021	FinnGen	finn-b-I9_VTE
DVT	194,604	4,576	190,028	16,380,409	European	2021	FinnGen	finn-b-I9_PHLETHROMBDVTLOW
PE	218,413	4,185	214,228	16,380,466	European	2021	FinnGen	finn-b-I9_PULMEMB

6. Statistical Analysis for MR

Fig.1 shows the two main MR analyses conducted in this study. We used the random-effect inverse variance weighted (IVW) model as the main analysis model. When only one genetic instrument was available, the Wald method was applied to estimate the causal relationship between the exposure and outcome²⁷⁾. In order to prevent overlooking any potential important associations, we consider the conventional p-value less than 0.05 to be statistically significant. We ultimately assessed associations based on p-values, odds ratio (OR), and 95% confidence intervals (CI). Analyses were performed in R (version 4.1.2) using the TwoSampleMR package. Analysis scripts are found at https://github.com/lit233/SMR-Antipsychotics-VTE.git.

Results

1. Venous Thromboembolism Adverse Event Signals for Antipsychotic Drugs

The ATC code of antipsychotic drugs is N05A, which involves a total of 63 drug active ingredients (Supplementary Table 2). Among them, 1694 cases of VTE events were reported by 16 drugs (Table 1), including 138 cases of venous thrombosis reported by 7 drugs, 185 cases of DVT reported by 4 drugs, and 1371 cases of PE reported by 11 drugs. The most reported cases were PE caused by olanzapine (N=720), and the highest PRR value was for venous thrombosis caused by cyamemazine (PRR=17.702, N=9).

Supplementary Table 2.Antipsychotic drugs and target genes identified using the DrugBank database

ATC code	Drug subclass	ATC code	Medication subclass	ATC code	Drug name	Target gene (s)
N05A	ANTIPSYCHOTICS	N05AA	Phenothiazines with aliphatic side-chain	N05AA01	chlorpromazine	DRD2, DRD1, HTR1, AHTR2A, ADRA1A, ADRA1B, HRH1, KCNH2, DRD3, DRD4, DRD5, HTR2C, CHRM1, CHRM3, SMPD1, CALM1, HTR6, HTR7, HRH4
				N05AA02	levomepromazine	DRD2, DRD1, DRD5, DRD3, DRD4, HTR2A, HTR2C, HRH1C, HRM1, CHRM2, CHRM3, CHRM4, CHRM5, ADRA1A, ADRA1B, ADRA1D, ADRA2A, ADRA2B, ADRA2C
				N05AA03	promazine	DRD2, HTR2A, HTR2C, ADRA1, ACHRM1, HRH1
				N05AA04	acepromazine	DRD2, DRD1, HTR2A, HTR1A, ADRA1A, ADRA1B
				N05AA05	triflupromazine	DRD2, DRD1, HTR2B, CHRM1, CHRM2
				N05AA06	cyamemazine	NA
				N05AA07	chlorproethazine	NA
		N05AB	Phenothiazines with piperazine structure	N05AB01	dixyrazine	NA
				N05AB02	fluphenazine	DRD2, DRD1, CALM1, AR, HTR2A
				N05AB03	perphenazine	DRD2, DRD1, CALM1
				N05AB04	prochlorperazine	DRD2, HRH1
				N05AB05	thiopropazate	NA
				N05AB06	trifluoperazine	DRD2, CALY, ADRAA, CALM1, TNNC1, S100A4
				N05AB07	acetophenazine	DRD2AR
				N05AB08	thioproperazine	DRD2A, DRA1A, ADRA1B, DRD1
		N05AC	Phenothiazines with piperidine structure	N05AC01	periciazine	DRD1, ADRA2A, ADRA1B, AR
				N05AC02	thioridazine	DRD2, DRD1, ADRA1A, ADRA1B, HTR2A, KCNH2
				N05AC03	mesoridazine	DRD2, HTR2A
				N05AC04	pipotiazine	DRD2, DRD1, HTR2A, HTR1A
		N05AD	Butyrophenone derivatives	N05AD01	haloperidol	, HTR2C, DRD2, HTR2A, DRD3, MCHR1, SLC18A2, SIGMAR1, HRH1, CHRM3, ADRA1A, ADRA2A, ADRA2B, ADRA2C, HTR1A, HTR6, HTR7, GRIN2B, DRD1
				N05AD02	trifluperidol	NA
				N05AD03	melperone	DRD2
				N05AD04	moperone	NA
				N05AD05	pipamperone	DRD2, HTR2A, DRD4, DRD1, DRD3, HTR2B, ADRA2A
				N05AD06	bromperidol	NA
				N05AD07	benperidol	NA
				N05AD08	droperidol	ADRA1A, DRD2
				N05AD09	fluanisone	NA
		N05AE	Indole derivatives	N05AE01	oxypertine	NA
				N05AE02	molindone	DRD2, HTR1A, HTR2A, CHRM1
				N05AE03	sertindole	DRD2, HTR2A, HTR2C, HTR6, KCNH2, ADRA1A, ADRA1B, ADRA1D
				N05AE04	ziprasidone	DRD2, HTR2A, HTR1A, HTR1D, HTR2C, DRD1, DRD5, DRD3, DRD4, HTR1B, HTR1E, HTR6, HTR7, HRH1, ADRA1A, ADRA1B, ADRA2A, ADRA2B, ADRA2C, CHRM1, CHRM2, CHRM3, CHRM4, CHRM5, HTR5A
				N05AE05	align="left"	DRD2, HTR2A, HTR7, HTR1A, ADRA2C, ADRA2A
		N05AF	Thioxanthene derivatives	N05AF01	flupentixol	DRD2, DRD1, HTR2A, ADRA1A, DRD3, DRD4, HTR2C, CHRM1
				N05AF02	clopenthixol	NA
				N05AF03	chlorprothixene	DRD2, DRD1, DRD3, HTR2A, HRH1, CHRM1, CHRM2, CHRM3, CHRM4, CHRM5
				N05AF04	tiotixene	DRD2, DRD1, HTR2A
				N05AF05	zuclopenthixol	DRD1, DRD5, DRD2, ADRA1A, ADRA2A, HTR2A, HRH1
N05A	ANTIPSYCHOTICS	N05AG	Diphenylbutylpiperidine derivatives	N05AG01	fluspirilene	DRD2, HTR2A, CACNG1
				N05AG02	pimozide	DRD2, DRD3, KCNH2, CALM1
				N05AG03	penfluridol	NA
		N05AH	Diazepines, oxazepines, thiazepines and oxepines	N05AH01	loxapine	HTR2A, DRD2, HTR2C, HTR1A, HTR1B, HTR1D, HTR1E, HTR3A, HTR5A, HTR6, HTR7, ADRA1A, ADRA1B, ADRA2A, ADRA2B, ADRA2C, ADRB1, CHRM1, CHRM2, CHRM3, CHRM4, CHRM5, DRD3, DRD4, DRD5, HRH1, HRH2, HRH4, SLC6A4, SLC6A2, SLC6A3, DRD1
				N05AH02	clozapine	DRD2, HTR2A, DRD1, DRD3, DRD4, HTR1A, HTR1B, HTR1D, HTR1E, HTR3A, HTR2C, HTR6, HTR7, HRH1, HRH4, ADRA1A, ADRA1B, ADRA2A, ADRA2B, ADRA2C, CHRM1, CHRM2, CHRM3, CHRM4, CHRM5, CALY, GSTP1
				N05AH03	olanzapine	HTR2A, DRD2, DRD1, DRD5, DRD3, DRD4, HTR2C, HTR3A, HTR6, HRH1, ADRA1A, ADRA1B, CHRM1, CHRM2, CHRM3, CHRM4
				N05AH04	quetiapine	HTR2A, DRD2, HTR1A, HTR1B, HTR1D, HTR1E, HTR2C, HTR3A, HTR6, HTR7, DRD1, DRD5, DRD3, DRD4, HRH1, ADRA2A, ADRA2B, ADRA2C, CHRM1, CHRM2, CHRM3, CHRM4, CHRM5
				N05AH05	asenapine	HTR2A, DRD2, HTR1A, HTR1B, HTR2B, HTR2C, HTR5A, HTR6, HTR7, DRD3, DRD4, DRD1, ADRA1A, ADRA2A, ADRA2B, ADRA2C, HRH1, HRH2, ADRB1, ADRB2
				N05AH06	clotiapine	NA
		N05AL	Benzamides	N05AL01	levosulpiride	DRD2, DRD3, CA2, CA3, CA4
				N05AL02	sultopride	NA
				N05AL03	tiapride	DRD2, DRD3
				N05AL04	remoxipride	DRD2, DRD4, DRD3, HTR2A, SIGMAR1
				N05AL05	amisulpride	HTR7, HTR2A, DRD2, DRD3, OPRM1, OPRD1, OPRK1
				N05AL06	veralipride	NA
				N05AL07	levosulpiride	NA
		N05AN	Lithium	N05AN01	lithium	IMPA2, IMPA1, GSK3B
		N05AX	Other antipsychotics	N05AX07	prothipendyl	NA
				N05AX08	risperidone	HTR2A, DRD2, ADRA1B, ADRA2B, ADRA1A, ADRA2C, HRH1, HTR2C, HTR1D, HTR1A, HTR7, DRD1
				N05AX10	mosapramine	NA
				N05AX11	zotepine	DRD2, HTR2A, HTR7, SLC6A2, SLC6A4, HTR6
				N05AX12	aripiprazole	DRD2, HTR2A, HTR1A, ADRA1A, ADRA1B, DRD3, HTR1D, HTR7, ADRA2A, ADRA2C, HRH1, HTR1B, HTR2C, HTR3A, HTR6, DRD1, DRD4, ADRA2B, HTR1E, DRD5, HTR2B, HTR5A, ADRB1, ADRB2, HRH2, HRH3, HRH4, CHRM1, CHRM2, CHRM3, CHRM4, CHRM5
				N05AX13	paliperidone	HTR2A, DRD2, DRD4, DRD3, HTR2C, HRH1, ADRA1A, ADRA1B, HTR1D, ADRA2A, ADRA2B, ADRA2C, HTR1A, DRD1, HTR7
				N05AX14	iloperidone	HTR2A, DRD2, DRD1, DRD3, DRD4, HTR1A, HTR6, HTR7, ADRA1A, HRH1, ADRA2C
				N05AX15	cariprazine	DRD3, DRD2, HTR1A, HTR2B, HTR2A, HRH1, HTR2C, ADRA1A

Table 1.Venous thromboembolism adverse event signals associated with antipsychotic drugs

	Venous thrombosis				Deep vein thrombosis				Pulmonary embolism
	Drug	PRR	χ2	N	Drug	PRR	χ2	N	Drug	PRR	χ2	N
	Periciazine	8.614	236.300	37	Cyamemazine	2.978	192.339	148	Olanzapine	2.735	782.466	720
	Quetiapine	2.075	18.041	35	Prochlorperazine	2.067	10.553	21	Haloperidol	2.355	177.896	230
	Risperidone	2.504	27.770	33	Pipamperone	3.045	14.541	12	Prochlorperazine	2.632	185.766	185
	Cyamemazine	17.702	124.981	9	Prothipendyl	4.534	7.792	4	Cyamemazine	3.622	96.452	52
	Lithium	2.479	6.4930	9					Chlorpromazine	2.165	30.935	51
	Chlorpromazine	9.585	52.989	8					Loxapine	3.665	92.669	49
	Prochlorperazine	2.801	6.380	7					Zuclopenthixol	3.11	41.033	30
									Flupentixol	2.725	14.762	15
									Chlorprothixene	4.778	41.292	15
									Pipamperone	2.153	6.334	12
									Iloperidone	2.431	8.765	12
Total	7			138	4			185	11			1371

Venous thromboembolism adverse event reporting by antipsychotic drugs from the United States Food and Drug Administration (FDA) Adverse Event Reporting System (FAERS) database from 2004 Q1 to 2022 Q2. N, number of the adverse event signals; PRR, proportional reporting ratio; χ², chi-squared.

2. Identification of Genetic Instruments

In total, we were able to identify 58 antipsychotic drug target genes according to the DrugBank database (Supplementary Table 2). However, 34 of these 58 genes were absent in the eQTLGen summary data, and we were only able to query the blood expression data for 24 drug target genes (Supplementary Table 3). In the GTEx database, there are 12 genes whose brain tissue expression information is absent, while 46 genes can be queried for brain tissue expression data (Supplementary Table 4). Subsequent analyses focused on these searchable genes. Details of the genetic instrument SNPs for blood and brain tissue expression of all target genes selected according to Method 4 can be found in Supplementary Tables 3 and 4. Genetic instruments for the expression of each drug target gene were not shown because of the excessive number. The F-statistics of the genetic instruments were determined to be all greater than 10, which indicates a low potential for weak instrumental bias in this study.

Supplementary Table 3.Drug target gene expression in blood

Gene	ID	Chromosome	Base pair	top eQTL SNP	SNP Chromosome	SNP base pair	other allele	effect allele	effect allele frequency	beta	se	p-value	F-statistic
ADRA2A	ENSG00000150594	10	112891591	rs11195432	10	112838724	A	T	0.296056	-0.0548	0.0087	2.93E-10	39.7
ADRB1	ENSG00000043591	10	115799477	rs4917675	10	115805236	C	T	0.242343	0.2492	0.0100	4.82002E-137	620.9
ADRB2	ENSG00000169252	5	148200600	rs2082395	5	148207176	A	G	0.421061	0.1263	0.0080	6.31E-56	248.2
CA2	ENSG00000104267	8	86849171	rs2930553	8	86384901	G	T	0.485173	-0.3471	0.0077	＜3.3e-310	2026.6
CA3	ENSG00000164879	8	86195671	rs1908762	8	86323467	T	C	0.347414	-0.0458	0.0086	9.46E-08	28.5
CA4	ENSG00000167434	17	58244021	rs34820870	17	58237778	G	T	0.042287	-0.4617	0.0207	6.12E-110	496.3
CALM1	ENSG00000198668	14	90858484	rs7150626	14	90868725	C	T	0.225014	0.2355	0.0095	3.03E-136	617.2
CALY	ENSG00000130643	10	135164484	rs28445771	10	135144701	C	A	0.055592	0.1528	0.0245	4.8526E-10	38.7
DRD4	ENSG00000069696	11	606770	rs72844713	11	638999	T	C	0.0625523	-0.3015	0.0188	4.02226E-58	258.3
GSK3B	ENSG00000082701	3	119927508	rs6765483	3	119676717	T	A	0.259986	0.3028	0.0089	6.30801E-253	1153.9
GSTP1	ENSG00000084207	11	66846507	rs147391285	11	67352598	A	T	0.0577167	-0.2979	0.0350	1.6374E-17	72.5
HRH1	ENSG00000196639	3	11293342	rs75932968	3	11242011	G	T	0.022892	0.3457	0.0304	4.84E-30	129.7
HRH4	ENSG00000134489	18	22065905	rs673819	18	22050257	T	C	0.106092	-0.0759	0.0130	6.03E-09	33.8
HTR3A	ENSG00000166736	11	113805352	rs45438696	11	113853319	A	G	0.117918	0.1385	0.0124	3.78E-29	125.6
HTR6	ENSG00000158748	1	20014827	rs57612959	1	19998917	T	C	0.358472	-0.3069	0.0089	7.59E-263	1199.5
IMPA1	ENSG00000133731	8	82514264	rs11986054	8	82584562	C	T	0.14293	-0.5001	0.0110	＜3.3e-310	2060.6
IMPA2	ENSG00000141401	18	11917346	rs8088271	18	12005950	C	A	0.20479	-0.4539	0.0096	＜3.3e-310	2231.8
KCNH2	ENSG00000055118	7	150647969	rs41258144	7	150658726	T	C	0.251769	0.1850	0.0101	1.7843E-75	337.9
MCHR1	ENSG00000128285	22	41098206	rs13058356	22	41076786	T	G	0.41146	0.2702	0.0082	3.13365E-240	1095.5
S100A4	ENSG00000196154	1	153525417	rs74115476	1	153519350	G	A	0.045297	-0.1013	0.0215	2.52E-06	22.1
SIGMAR1	ENSG00000147955	9	34638080	rs117171045	9	34636262	A	C	0.036988	-0.8159	0.0208	＜3.3e-310	1540.0
SLC18A2	ENSG00000165646	10	119052773	rs10886054	10	119019772	C	G	0.515156	-0.1891	0.0079	4.36E-126	570.5
SMPD1	ENSG00000166311	11	6411319	rs7103750	11	6413941	G	C	0.102019	-0.1336	0.0135	3.43E-23	98.4
TNNC1	ENSG00000114854	3	52353119	rs34332947	3	52486602	T	G	0.047407	0.2554	0.0187	1.3592E-42	187.1

Supplementary Table 4.Drug target gene expression in brain tissue

Gene	Chromosome	top eQTL SNP	other allele	effect allele	beta	se	p-value	F-statistic
ADRA1A	8	rs116443141	G	A	-1.2	0.2463	1.10E-06	23.7
ADRA1D	20	rs835874	G	A	-0.33	0.0498	3.4E-11	43.9
ADRA2A	10	rs10885113	A	G	0.48	0.0689	3.2E-12	48.6
ADRA2B	2	rs2579551	G	C	-1	0.1044	9.8E-22	91.8
ADRA2C	4	rs34314663	T	C	-0.49	0.0850	8.30E-09	33.2
ADRB1	10	rs4917675	T	C	-0.32	0.0637	5.10E-07	25.2
AR	X	rs2361629	A	G	0.43	0.0640	1.9E-11	45.1
CA3	8	rs59112428	AAG	A	0.71	0.0968	2.2E-13	53.8
CA4	17	rs237957	G	A	-0.27	0.0600	6.90E-06	20.2
CALY	10	rs150421375	T	C	1.4	0.2993	2.90E-06	21.9
M1	11	rs11822922	C	T	2.3	0.5019	4.60E-06	21.0
M2	7	rs563915590	C	T	1.8	0.3957	5.40E-06	20.7
M3	1	rs17614812	G	A	0.39	0.0868	7.10E-06	20.2
M5	15	rs1302013020	G	GAAGGAACACTGAGCTGAGTGTTCCTTTGTTACCAGA	1.2	0.1029	1.9E-31	136.1
DRD1	5	rs74410835	C	T	1.1	0.2112	1.90E-07	27.1
DRD2	11	rs4936279	C	A	-0.52	0.1025	3.90E-07	25.7
DRD4	11	rs702965	C	T	-0.45	0.0671	2.0E-11	45.0
DRD5	4	rs938556	A	T	-0.68	0.1070	2.1E-10	40.4
GRIN2B	12	rs187019357	C	A	0.7	0.1543	5.70E-06	20.6
GSK3B	3	rs3107669	C	A	-0.15	0.0328	4.80E-06	20.9
GSTP1	11	rs762803	C	A	-0.3	0.0304	6.5E-23	97.1
HRH1	3	rs26801	C	T	0.32	0.0702	5.10E-06	20.8
HRH3	20	rs6062156	C	G	0.49	0.0847	7.20E-09	33.5
HTR1A	5	rs7728799	T	G	-0.22	0.0445	7.50E-07	24.5
HTR1D	1	rs2746557	T	C	-0.51	0.0744	7.3E-12	46.9
HTR2A	13	rs76311763	A	T	-0.78	0.1495	1.80E-07	27.2
HTR2B	2	rs139877459	G	GCATCATGGAGAATGGGACATCTC	-0.6	0.1297	3.70E-06	21.4
HTR2C	X	rs147082082	G	C	0.58	0.1266	4.60E-06	21.0
HTR5A	7	rs12719652	T	A	0.39	0.0775	4.80E-07	25.3
HTR6	1	rs200380142	TTCC	T	-0.28	0.0348	9.0E-16	64.6
HTR7	10	rs7097189	G	C	-0.55	0.0940	4.80E-09	34.3
IMPA1	8	rs2975935	A	G	-0.28	0.0418	2.1E-11	44.9
IMPA2	18	rs8099150	A	G	0.18	0.0393	4.70E-06	21.0
KCNH2	7	rs11771808	A	G	-0.41	0.0439	9.6E-21	87.2
M1	22	rs8135390	G	C	-0.73	0.0975	7.2E-14	56.0
OPRD1	1	rs188485465	G	A	-2	0.4132	1.30E-06	23.4
OPRK1	8	rs6473797	T	C	0.62	0.0989	3.7E-10	39.3
OPRM1	6	rs494328	T	C	0.47	0.0878	8.70E-08	28.6
S100A4	1	rs1094362	A	C	-0.42	0.0946	9.00E-06	19.7
SIGMAR1	9	rs11791806	C	T	0.29	0.0534	5.50E-08	29.5
SMPD1	11	rs1800606	C	T	0.45	0.0595	3.8E-14	57.3

3. MR Analysis of All Target Gene Expression and VTE Outcomes

We first performed MR analysis to estimate the association of all antipsychotic drug target gene expression with VTE, DVT, and PE.

3.1 MR Analysis of All Target Gene Blood Expression and VTE

In total, 21 genetic instruments for antipsychotic drug target gene blood expression were retained after the removal of SNPs with linkage disequilibrium. The associations of the 21 drug target gene blood expression with VTE, DVT, and PE, as assessed via MR analysis, are shown in Fig.2, Table 2, and Supplementary Tables 5, 6, 7. As per our results, no significant association was noted between the overall expression of antipsychotic drug target genes and the risk of VTE (including DVT and PE) according to the IVW method (p-values were all greater than 0.05). However, our results suggested an increased risk for MCHR1 gene expression and VTE (OR: 1.14, 95% CI: 1.01–1.28, P=0.031) as well as DVT (OR: 1.21, 95% CI: 1.02–1.43, P=0.025).

Fig.2. Associations between drug target gene expression in blood and venous thromboembolism outcomes

Forest plot of the association between 21 target gene blood expression and the risk of VTE, DVT, and PE. Bars represent ORs with 95% CI. Orange squares indicate the association is statistically significant (P＜0.05). All (IVW) refers to the general effect of the 21 target genes on outcomes based on the IVW model. CI, confidence interval; DVT, deep vein thrombosis; IVW, inverse variance weighted; OR, odd’s ratio; PE, pulmonary embolism; VTE, venous thromboembolism.

Table 2.MR analysis of the expression of all antipsychotic drug target genes and venous thromboembolism outcomes

Expose-Outcome	nSNPs	OR (95% CI)	P value
Blood-VTE	21	1.03 (0.99-1.07)	0.143
Blood-DVT	21	1.02 (0.96-1.09)	0.454
Blood-PE	21	1.02 (0.97-1.07)	0.438
Brain-VTE	22	1.01 (0.99-1.03)	0.317
Brain-DVT	22	0.99 (0.96-1.02)	0.604
Brain-PE	22	1.02 (0.99-1.04)	0.289

Results of MR analysis for associations between the expression of all antipsychotic drug target genes in blood or brain tissue and each venous thromboembolism outcome based on inverse variance weighted (IVW) model. CI, confidence interval; DVT, deep vein thrombosis; MR, Mendelian randomization; nSNPs, number of single-nucleotide polymorphisms; OR, odds ratio; PE, pulmonary embolism; VTE, venous thromboembolism.

Supplementary Table 5.MR association between all drug target gene expression in blood and venous thromboembolism

SNP	Gene	Outcome	beta	se	p-value	lo_ci	up_ci	or	or_lci95	or_uci95
rs11195432	ADRA2A	Venous thromboembolism || id:finn-b-I9_VTE	0.17	0.3174	0.601	-0.46	0.79	1.18	0.63	2.20
rs117171045	SIGMAR1	Venous thromboembolism || id:finn-b-I9_VTE	-0.02	0.0498	0.692	-0.12	0.08	0.98	0.89	1.08
rs11986054	IMPA1	Venous thromboembolism || id:finn-b-I9_VTE	0.04	0.0402	0.352	-0.04	0.12	1.04	0.96	1.12
rs13058356	MCHR1	Venous thromboembolism || id:finn-b-I9_VTE	0.13	0.0607	0.031	0.01	0.25	1.14	1.01	1.28
rs147391285	GSTP1	Venous thromboembolism || id:finn-b-I9_VTE	0.09	0.1262	0.496	-0.16	0.33	1.09	0.85	1.40
rs1908762	CA3	Venous thromboembolism || id:finn-b-I9_VTE	0.06	0.3952	0.886	-0.72	0.83	1.06	0.49	2.30
rs2082395	ADRB2	Venous thromboembolism || id:finn-b-I9_VTE	-0.12	0.1291	0.348	-0.37	0.13	0.89	0.69	1.14
rs28445771	CALY	Venous thromboembolism || id:finn-b-I9_VTE	-0.28	0.2415	0.241	-0.76	0.19	0.75	0.47	1.21
rs2930553	CA2	Venous thromboembolism || id:finn-b-I9_VTE	0.08	0.0458	0.064	-0.00	0.17	1.09	1.00	1.19
rs34332947	TNNC1	Venous thromboembolism || id:finn-b-I9_VTE	0.01	0.1648	0.966	-0.32	0.33	1.01	0.73	1.39
rs34820870	CA4	Venous thromboembolism || id:finn-b-I9_VTE	-0.07	0.0903	0.419	-0.25	0.10	0.93	0.78	1.11
rs45438696	HTR3A	Venous thromboembolism || id:finn-b-I9_VTE	0.27	0.1726	0.124	-0.07	0.60	1.30	0.93	1.83
rs4917675	ADRB1	Venous thromboembolism || id:finn-b-I9_VTE	0.12	0.0710	0.105	-0.02	0.25	1.12	0.98	1.29
rs673819	HRH4	Venous thromboembolism || id:finn-b-I9_VTE	-0.87	0.3664	0.017	-1.59	-0.15	0.42	0.20	0.86
rs6765483	GSK3B	Venous thromboembolism || id:finn-b-I9_VTE	0.07	0.0614	0.275	-0.05	0.19	1.07	0.95	1.21
rs7103750	SMPD1	Venous thromboembolism || id:finn-b-I9_VTE	-0.28	0.2216	0.206	-0.71	0.15	0.76	0.49	1.17
rs7150626	CALM1	Venous thromboembolism || id:finn-b-I9_VTE	-0.02	0.0807	0.825	-0.18	0.14	0.98	0.84	1.15
rs72844713	DRD4	Venous thromboembolism || id:finn-b-I9_VTE	-0.25	0.1403	0.079	-0.52	0.03	0.78	0.59	1.03
rs74115476	S100A4	Venous thromboembolism || id:finn-b-I9_VTE	-0.18	0.3929	0.647	-0.95	0.59	0.84	0.39	1.80
rs75932968	HRH1	Venous thromboembolism || id:finn-b-I9_VTE	-0.10	0.2971	0.742	-0.68	0.48	0.91	0.51	1.62
rs8088271	IMPA2	Venous thromboembolism || id:finn-b-I9_VTE	0.00	0.0452	0.992	-0.09	0.09	1.00	0.92	1.09
All - Inverse variance weighted		Venous thromboembolism || id:finn-b-I9_VTE	0.03	0.0201	0.143	-0.01	0.07	1.03	0.99	1.07
All - MR Egge		Venous thromboembolism || id:finn-b-I9_VTE	0.04	0.0388	0.329	-0.04	0.12	1.04	0.96	1.12

Supplementary Table 6.MR association between all drug target gene expression in blood and deep vein thrombosis

SNP	Gene	Outcome	beta	se	p-value	lo_ci	up_ci	or	or_lci95	or_uci95
rs11195432	ADRA2A	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.36	0.4396	0.418	-0.51	1.22	1.43	0.60	3.38
rs117171045	SIGMAR1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.11	0.0693	0.098	-0.25	0.02	0.89	0.78	1.02
rs11986054	IMPA1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.07	0.0558	0.197	-0.04	0.18	1.07	0.96	1.20
rs13058356	MCHR1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.19	0.0844	0.025	0.02	0.35	1.21	1.02	1.43
rs147391285	GSTP1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.13	0.1762	0.470	-0.22	0.47	1.14	0.80	1.60
rs1908762	CA3	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.14	0.5524	0.794	-1.23	0.94	0.87	0.29	2.56
rs2082395	ADRB2	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.07	0.1798	0.679	-0.43	0.28	0.93	0.65	1.32
rs28445771	CALY	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.91	0.3351	0.007	-1.57	-0.25	0.40	0.21	0.78
rs2930553	CA2	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.08	0.0637	0.224	-0.05	0.20	1.08	0.95	1.22
rs34332947	TNNC1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.41	0.2294	0.071	-0.04	0.86	1.51	0.97	2.37
rs34820870	CA4	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.02	0.1256	0.870	-0.23	0.27	1.02	0.80	1.31
rs45438696	HTR3A	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.42	0.2405	0.079	-0.05	0.89	1.53	0.95	2.44
rs4917675	ADRB1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.06	0.0991	0.541	-0.13	0.25	1.06	0.87	1.29
rs673819	HRH4	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-1.02	0.5087	0.044	-2.02	-0.03	0.36	0.13	0.97
rs6765483	GSK3B	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.07	0.0855	0.398	-0.10	0.24	1.08	0.91	1.27
rs7103750	SMPD1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.37	0.3084	0.233	-0.97	0.24	0.69	0.38	1.27
rs7150626	CALM1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.08	0.1125	0.499	-0.30	0.14	0.93	0.74	1.16
rs72844713	DRD4	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.25	0.1950	0.209	-0.63	0.14	0.78	0.53	1.15
rs74115476	S100A4	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.31	0.5450	0.574	-0.76	1.37	1.36	0.47	3.95
rs75932968	HRH1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.27	0.4154	0.508	-0.54	1.09	1.32	0.58	2.97
rs8088271	IMPA2	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.05	0.0628	0.390	-0.18	0.07	0.95	0.84	1.07
All - Inverse variance weighted		DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.02	0.0320	0.454	-0.04	0.09	1.02	0.96	1.09
All - MR Egger		DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.02	0.0619	0.796	-0.11	0.14	1.02	0.90	1.15

Supplementary Table 7. MR association between all drug target gene expression in brain tissue and pulmonary embolism

SNP	Gene	Outcome	beta	se	p-value	lo_ci	up_ci	or	or_lci95	or_uci95
rs11195432	ADRA2A	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.21	0.4542	0.644	-1.10	0.68	0.81	0.33	1.97
rs117171045	SIGMAR1	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.05	0.0712	0.443	-0.08	0.19	1.06	0.92	1.21
rs11986054	IMPA1	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.02	0.0578	0.668	-0.09	0.14	1.03	0.92	1.15
rs13058356	MCHR1	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.08	0.0870	0.332	-0.09	0.25	1.09	0.92	1.29
rs147391285	GSTP1	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.02	0.1799	0.911	-0.37	0.33	0.98	0.69	1.39
rs1908762	CA3	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.12	0.5677	0.832	-1.23	0.99	0.89	0.29	2.70
rs2082395	ADRB2	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.35	0.1853	0.059	-0.71	0.01	0.70	0.49	1.01
rs28445771	CALY	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.04	0.3469	0.916	-0.64	0.72	1.04	0.53	2.05
rs2930553	CA2	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.07	0.0657	0.267	-0.06	0.20	1.08	0.95	1.22
rs34332947	TNNC1	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.67	0.2345	0.004	-1.13	-0.21	0.51	0.32	0.81
rs34820870	CA4	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.02	0.1293	0.847	-0.28	0.23	0.98	0.76	1.26
rs45438696	HTR3A	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.29	0.2470	0.242	-0.20	0.77	1.33	0.82	2.17
rs4917675	ADRB1	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.04	0.1019	0.694	-0.16	0.24	1.04	0.85	1.27
rs673819	HRH4	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.38	0.5258	0.474	-1.41	0.65	0.69	0.24	1.92
rs6765483	GSK3B	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.05	0.0879	0.570	-0.12	0.22	1.05	0.88	1.25
rs7103750	SMPD1	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.26	0.3166	0.405	-0.88	0.36	0.77	0.41	1.43
rs7150626	CALM1	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.03	0.1159	0.767	-0.19	0.26	1.03	0.82	1.30
rs72844713	DRD4	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.03	0.2003	0.889	-0.42	0.36	0.97	0.66	1.44
rs74115476	S100A4	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.77	0.5647	0.173	-1.88	0.34	0.46	0.15	1.40
rs75932968	HRH1	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.08	0.4229	0.856	-0.91	0.75	0.93	0.40	2.12
rs8088271	IMPA2	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.00	0.0648	0.984	-0.13	0.13	1.00	0.88	1.14
All - Inverse variance weighted		Pulmonary embolism || id:finn-b-I9_PULMEMB	0.02	0.0249	0.438	-0.03	0.07	1.02	0.97	1.07
All - MR Egger		Pulmonary embolism || id:finn-b-I9_PULMEMB	0.08	0.0470	0.101	-0.01	0.17	1.08	0.99	1.19

3.2 MR Analysis of All Target Gene Expression in Brain Tissue and VTE

After removing SNPs with LD, 22 genetic instruments were retained. As per the IVW method, there were no significant effects of antipsychotic drug target gene expression in brain tissue on VTE (OR: 1.010, 95% CI: 0.990–1.031, P=0.32), DVT (OR: 0.992, 95% CI: 0.964–1.021, P=0.60), and PE (OR: 1.015, 95% CI: 0.987–1.045, P=0.29), respectively (Fig.3 and Table 2). However, our results showed that the ADRA2C gene was associated with a higher risk of VTE (OR: 1.08, 95% CI: 1.01–1.15, P=0.018) and PE (OR: 1.13, 95% CI: 1.03–1.23, P=0.012) (Fig.3 and Supplementary Tables 8, 9, 10).

Fig.3. Associations between drug target gene expression in brain tissue and venous thromboembolism outcomes

Forest plot of the association between 21 target gene brain expression and the risk of VTE, DVT, and PE. Bars represent ORs with 95% CI. Orange squares indicate the association is statistically significant (P＜0.05). All (IVW) refers to the general effect of the 21 target genes on outcomes based on the IVW model. CI, confidence interval; DVT, deep vein thrombosis; IVW, inverse variance weighted; OR, odd’s ratio; PE, pulmonary embolism; VTE, venous thromboembolism.

Supplementary Table 8. MR association between all drug target gene expression in brain tissue and venous thromboembolism

SNP	Gene	Outcome	beta	se	p-value	lo_ci	up_ci	or	or_lci95	or_uci95
rs10885113	ADRA2A	Venous thromboembolism || id:finn-b-I9_VTE	0.06	0.0333	0.093	-0.01	0.12	1.06	0.99	1.13
rs1094362	S100A4	Venous thromboembolism || id:finn-b-I9_VTE	-0.03	0.0400	0.497	-0.11	0.05	0.97	0.90	1.05
rs11771808	KCNH2	Venous thromboembolism || id:finn-b-I9_VTE	0.06	0.0412	0.150	-0.02	0.14	1.06	0.98	1.15
rs11791806	SIGMAR1	Venous thromboembolism || id:finn-b-I9_VTE	0.01	0.0807	0.942	-0.15	0.16	1.01	0.86	1.18
rs17614812	CHRM3	Venous thromboembolism || id:finn-b-I9_VTE	0.05	0.1462	0.707	-0.23	0.34	1.06	0.79	1.41
rs1800606	SMPD1	Venous thromboembolism || id:finn-b-I9_VTE	-0.06	0.0567	0.257	-0.18	0.05	0.94	0.84	1.05
rs237957	CA4	Venous thromboembolism || id:finn-b-I9_VTE	-0.10	0.0670	0.156	-0.23	0.04	0.91	0.80	1.04
rs26801	HRH1	Venous thromboembolism || id:finn-b-I9_VTE	-0.02	0.0544	0.662	-0.13	0.08	0.98	0.88	1.09
rs2746557	HTR1D	Venous thromboembolism || id:finn-b-I9_VTE	0.03	0.0322	0.326	-0.03	0.09	1.03	0.97	1.10
rs2975935	IMPA1	Venous thromboembolism || id:finn-b-I9_VTE	-0.05	0.0579	0.408	-0.16	0.07	0.95	0.85	1.07
rs3107669	GSK3B	Venous thromboembolism || id:finn-b-I9_VTE	0.03	0.1073	0.766	-0.18	0.24	1.03	0.84	1.27
rs34314663	ADRA2C	Venous thromboembolism || id:finn-b-I9_VTE	0.08	0.0329	0.018	0.01	0.14	1.08	1.01	1.15
rs4917675	ADRB1	Venous thromboembolism || id:finn-b-I9_VTE	0.09	0.0553	0.105	-0.02	0.20	1.09	0.98	1.22
rs4936279	DRD2	Venous thromboembolism || id:finn-b-I9_VTE	-0.02	0.0356	0.615	-0.09	0.05	0.98	0.92	1.05
rs494328	OPRM1	Venous thromboembolism || id:finn-b-I9_VTE	-0.01	0.0364	0.875	-0.08	0.07	0.99	0.93	1.07
rs6473797	OPRK1	Venous thromboembolism || id:finn-b-I9_VTE	0.01	0.0287	0.813	-0.05	0.06	1.01	0.95	1.07
rs702965	DRD4	Venous thromboembolism || id:finn-b-I9_VTE	0.04	0.0476	0.460	-0.06	0.13	1.04	0.94	1.14
rs74410835	DRD1	Venous thromboembolism || id:finn-b-I9_VTE	-0.03	0.1042	0.758	-0.24	0.17	0.97	0.79	1.19
rs762803	GSTP1	Venous thromboembolism || id:finn-b-I9_VTE	-0.08	0.0557	0.139	-0.19	0.03	0.92	0.83	1.03
rs7728799	HTR1A	Venous thromboembolism || id:finn-b-I9_VTE	-0.06	0.0932	0.513	-0.24	0.12	0.94	0.78	1.13
rs8099150	IMPA2	Venous thromboembolism || id:finn-b-I9_VTE	0.03	0.0894	0.770	-0.15	0.20	1.03	0.86	1.22
rs835874	ADRA1D	Venous thromboembolism || id:finn-b-I9_VTE	-0.03	0.0485	0.553	-0.12	0.07	0.97	0.88	1.07
All - Inverse variance weighted		Venous thromboembolism || id:finn-b-I9_VTE	0.01	0.0102	0.317	-0.01	0.03	1.01	0.99	1.03
All - MR Egger		Venous thromboembolism || id:finn-b-I9_VTE	0.05	0.0313	0.157	-0.02	0.11	1.05	0.98	1.11

Supplementary Table 9. MR association between all drug target gene expression in brain tissue and deep vein thrombosis

SNP	Gene	Outcome	beta	se	p-value	lo_ci	up_ci	or	or_lci95	or_uci95
rs10885113	ADRA2A	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.09	0.0462	0.062	-0.00	0.18	1.09	1.00	1.19
rs1094362	S100A4	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.02	0.0555	0.757	-0.13	0.09	0.98	0.88	1.10
rs11771808	KCNH2	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.05	0.0571	0.419	-0.07	0.16	1.05	0.94	1.17
rs11791806	SIGMAR1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.01	0.1124	0.929	-0.21	0.23	1.01	0.81	1.26
rs17614812	CHRM3	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.23	0.2033	0.255	-0.17	0.63	1.26	0.85	1.88
rs1800606	SMPD1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.07	0.0789	0.376	-0.22	0.08	0.93	0.80	1.09
rs237957	CA4	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.02	0.0933	0.837	-0.16	0.20	1.02	0.85	1.22
rs26801	HRH1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.10	0.0759	0.184	-0.25	0.05	0.90	0.78	1.05
rs2746557	HTR1D	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.01	0.0447	0.803	-0.10	0.08	0.99	0.91	1.08
rs2975935	IMPA1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.04	0.0804	0.631	-0.20	0.12	0.96	0.82	1.13
rs3107669	GSK3B	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.03	0.1493	0.823	-0.26	0.33	1.03	0.77	1.39
rs34314663	ADRA2C	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.03	0.0457	0.451	-0.06	0.12	1.04	0.95	1.13
rs4917675	ADRB1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.05	0.0772	0.541	-0.10	0.20	1.05	0.90	1.22
rs4936279	DRD2	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.08	0.0492	0.093	-0.18	0.01	0.92	0.84	1.01
rs494328	OPRM1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.06	0.0504	0.260	-0.16	0.04	0.94	0.86	1.04
rs6473797	OPRK1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.00	0.0400	0.952	-0.08	0.08	1.00	0.92	1.08
rs702965	DRD4	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.08	0.0662	0.208	-0.05	0.21	1.09	0.95	1.24
rs74410835	DRD1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.04	0.1452	0.762	-0.24	0.33	1.04	0.79	1.39
rs762803	GSTP1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.17	0.0773	0.030	-0.32	-0.02	0.85	0.73	0.98
rs7728799	HTR1A	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.16	0.1295	0.219	-0.09	0.41	1.17	0.91	1.51
rs8099150	IMPA2	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.08	0.1250	0.516	-0.33	0.16	0.92	0.72	1.18
rs835874	ADRA1D	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.10	0.0673	0.132	-0.23	0.03	0.90	0.79	1.03
All - Inverse variance weighted		DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	-0.01	0.0147	0.604	-0.04	0.02	0.99	0.96	1.02
All - MR Egger		DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	0.02	0.0466	0.717	-0.07	0.11	1.02	0.93	1.11

Supplementary Table 10. MR association between all drug target gene expression in brain tissue and pulmonary embolism

SNP	Gene	Outcome	beta	se	p-value	lo_ci	up_ci	or	or_lci95	or_uci95
rs10885113	ADRA2A	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.06	0.0477	0.230	-0.04	0.15	1.06	0.96	1.16
rs1094362	S100A4	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.02	0.0571	0.755	-0.09	0.13	1.02	0.91	1.14
rs11771808	KCNH2	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.05	0.0590	0.397	-0.07	0.17	1.05	0.94	1.18
rs11791806	SIGMAR1	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.01	0.1159	0.901	-0.24	0.21	0.99	0.79	1.24
rs17614812	CHRM3	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.12	0.2095	0.578	-0.29	0.53	1.12	0.75	1.69
rs1800606	SMPD1	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.05	0.0809	0.557	-0.21	0.11	0.95	0.81	1.12
rs237957	CA4	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.17	0.0959	0.076	-0.36	0.02	0.84	0.70	1.02
rs26801	HRH1	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.00	0.0778	0.974	-0.16	0.15	1.00	0.86	1.16
rs2746557	HTR1D	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.03	0.0461	0.510	-0.06	0.12	1.03	0.94	1.13
rs2975935	IMPA1	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.08	0.0829	0.365	-0.24	0.09	0.93	0.79	1.09
rs3107669	GSK3B	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.09	0.1540	0.571	-0.21	0.39	1.09	0.81	1.48
rs34314663	ADRA2C	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.12	0.0471	0.012	0.03	0.21	1.13	1.03	1.23
rs4917675	ADRB1	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.03	0.0794	0.694	-0.12	0.19	1.03	0.88	1.21
rs4936279	DRD2	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.01	0.0508	0.919	-0.10	0.09	0.99	0.90	1.10
rs494328	OPRM1	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.04	0.0519	0.405	-0.14	0.06	0.96	0.87	1.06
rs6473797	OPRK1	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.06	0.0411	0.165	-0.02	0.14	1.06	0.98	1.15
rs702965	DRD4	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.09	0.0680	0.186	-0.22	0.04	0.91	0.80	1.04
rs74410835	DRD1	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.06	0.1478	0.706	-0.35	0.23	0.95	0.71	1.26
rs762803	GSTP1	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.04	0.0793	0.638	-0.19	0.12	0.96	0.82	1.13
rs7728799	HTR1A	Pulmonary embolism || id:finn-b-I9_PULMEMB	-0.21	0.1332	0.120	-0.47	0.05	0.81	0.63	1.06
rs8099150	IMPA2	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.16	0.1283	0.219	-0.09	0.41	1.17	0.91	1.51
rs835874	ADRA1D	Pulmonary embolism || id:finn-b-I9_PULMEMB	0.02	0.0694	0.763	-0.12	0.16	1.02	0.89	1.17
All - Inverse variance weighted		Pulmonary embolism || id:finn-b-I9_PULMEMB	0.02	0.0145	0.289	-0.01	0.04	1.02	0.99	1.04
All - MR Egger		Pulmonary embolism || id:finn-b-I9_PULMEMB	0.06	0.0449	0.191	-0.03	0.15	1.06	0.97	1.16

4. MR Analysis of Single Target Gene Expression and VTE Outcomes

In addition, we ran an MR analysis with a series of significant SNPs as genetic instruments for each drug target gene, with individual target gene expression as exposure and three VTE events as outcome.

4.1 MR Analysis of Single Target Gene Expression in Blood and VTE

We then performed MR analysis on the blood expression data of 24 target genes and 3 VTE outcomes, respectively (for all results, see Supplementary Table 11). As per our findings, the blood expression of six genes was found to be associated with a higher risk of VTE events (P＜0.05) (Table 3). Among them, MCHR1 gene expression had a negative effect on all three venous thromboembolism outcomes: VTE (OR: 1.12, 95% CI: 1.06–1.19, P=4.06×10⁻⁰⁵), DVT (OR: 1.17, 95% CI: 1.09–1.25, P=5.11×10⁻⁰⁶), and PE (OR: 1.12, 95% CI: 1.04–1.21, P=0.004).

Supplementary Table 11. MR association of each drug target gene expression in blood with VTE, DVT and PE

Gene	Outcome	method	nsnp	beta	se	p-value	lo_ci	up_ci	or	or_ lci95	or_ uci95
MCHR1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	65	0.15	0.0336	5.109E-06	0.09	0.22	1.17	1.09	1.25
MCHR1	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	65	0.12	0.0285	4.056E-05	0.06	0.17	1.12	1.06	1.19
HRH4	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	7	-0.71	0.2053	5.458E-04	-1.11	-0.31	0.49	0.33	0.74
GSK3B	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	94	-0.10	0.0294	5.865E-04	-0.16	-0.04	0.90	0.85	0.96
CA2	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	101	0.05	0.0156	7.061E-04	0.02	0.08	1.05	1.02	1.09
KCNH2	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	34	-0.15	0.0471	0.002	-0.24	-0.06	0.86	0.79	0.94
KCNH2	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	34	-0.19	0.0598	0.002	-0.31	-0.07	0.83	0.74	0.93
CALY	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	3	-0.63	0.1982	0.002	-1.01	-0.24	0.53	0.36	0.79
MCHR1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	65	0.11	0.0382	0.004	0.03	0.18	1.12	1.04	1.20
ADRB1	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	33	0.09	0.0336	0.007	0.03	0.16	1.10	1.03	1.17
HTR6	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	39	0.10	0.0364	0.008	0.03	0.17	1.10	1.03	1.18
HTR6	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	39	0.12	0.0491	0.011	0.03	0.22	1.13	1.03	1.25
TNNC1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	9	0.47	0.1915	0.013	0.10	0.85	1.61	1.10	2.34
SLC18A2	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	18	0.19	0.0803	0.018	0.03	0.35	1.21	1.03	1.42
TNNC1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	9	-0.46	0.1970	0.019	-0.85	-0.08	0.63	0.43	0.93
IMPA2	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	60	-0.05	0.0242	0.024	-0.10	-0.01	0.95	0.90	0.99
SIGMAR1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	54	-0.08	0.0336	0.025	-0.14	-0.01	0.93	0.87	0.99
HRH4	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	7	-0.39	0.1904	0.038	-0.77	-0.02	0.67	0.46	0.98
CA2	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	101	0.04	0.0216	0.044	0.00	0.09	1.04	1.00	1.09
ADRB1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	33	0.09	0.0468	0.054	-0.00	0.18	1.09	1.00	1.20
DRD4	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	40	0.10	0.0549	0.056	-0.00	0.21	1.11	1.00	1.24
GSK3B	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	94	-0.03	0.0194	0.089	-0.07	0.01	0.97	0.93	1.01
DRD4	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	40	-0.06	0.0383	0.104	-0.14	0.01	0.94	0.87	1.01
HTR3A	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	11	0.20	0.1241	0.106	-0.04	0.44	1.22	0.96	1.56
HTR3A	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	11	0.14	0.0867	0.113	-0.03	0.31	1.15	0.97	1.36
HRH1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	3	0.43	0.2846	0.135	-0.13	0.98	1.53	0.88	2.67
SLC18A2	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	18	0.09	0.0616	0.144	-0.03	0.21	1.09	0.97	1.23
IMPA2	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	60	-0.02	0.0169	0.151	-0.06	0.01	0.98	0.94	1.01
HTR6	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	39	0.07	0.0477	0.166	-0.03	0.16	1.07	0.97	1.17
HTR3A	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	11	0.16	0.1206	0.172	-0.07	0.40	1.18	0.93	1.49
S100A4	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	-0.77	0.5647	0.173	-1.88	0.34	0.46	0.15	1.40
GSTP1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	8	0.14	0.1022	0.184	-0.06	0.34	1.15	0.94	1.40
HRH1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	3	-0.35	0.2915	0.225	-0.93	0.22	0.70	0.40	1.24
CALY	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	3	-0.17	0.1425	0.237	-0.45	0.11	0.84	0.64	1.12
ADRB2	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	17	0.10	0.0879	0.265	-0.07	0.27	1.10	0.93	1.31
ADRB2	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	17	-0.11	0.1053	0.280	-0.32	0.09	0.89	0.73	1.10
CALY	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	3	0.21	0.2042	0.305	-0.19	0.61	1.23	0.83	1.84
CALM1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	16	-0.06	0.0569	0.306	-0.17	0.05	0.94	0.84	1.05
CA2	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	101	0.02	0.0223	0.318	-0.02	0.07	1.02	0.98	1.07
TNNC1	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	9	0.13	0.1291	0.320	-0.12	0.38	1.14	0.88	1.46
DRD4	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	40	-0.05	0.0533	0.321	-0.16	0.05	0.95	0.85	1.05
CA4	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	8	-0.06	0.0632	0.334	-0.18	0.06	0.94	0.83	1.06
GSTP1	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	8	0.07	0.0756	0.347	-0.08	0.22	1.07	0.93	1.25
GSTP1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	8	0.09	0.1048	0.397	-0.12	0.29	1.09	0.89	1.34
IMPA2	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	60	-0.02	0.0235	0.414	-0.07	0.03	0.98	0.94	1.03
SIGMAR1	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	54	-0.02	0.0241	0.508	-0.06	0.03	0.98	0.94	1.03
S100A4	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	0.31	0.5450	0.574	-0.76	1.37	1.36	0.47	3.95
SLC18A2	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	18	0.04	0.0874	0.620	-0.13	0.21	1.04	0.88	1.24
ADRB1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	33	0.02	0.0482	0.629	-0.07	0.12	1.02	0.93	1.12
S100A4	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	-0.18	0.3929	0.647	-0.95	0.59	0.84	0.39	1.80
CALM1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	16	0.02	0.0586	0.707	-0.09	0.14	1.02	0.91	1.15
SMPD1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	4	-0.10	0.2651	0.707	-0.62	0.42	0.91	0.54	1.52
SIGMAR1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	54	0.01	0.0346	0.717	-0.06	0.08	1.01	0.95	1.08
IMPA1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	121	0.01	0.0191	0.750	-0.03	0.04	1.01	0.97	1.04
CA4	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	8	-0.05	0.1518	0.754	-0.35	0.25	0.95	0.71	1.28
GSK3B	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	94	0.01	0.0289	0.767	-0.05	0.07	1.01	0.95	1.07
SMPD1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	4	0.09	0.2937	0.772	-0.49	0.66	1.09	0.61	1.94
ADRA2A	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	2	-0.17	0.5861	0.773	-1.32	0.98	0.84	0.27	2.66
ADRA2A	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	2	-0.07	0.2640	0.787	-0.59	0.45	0.93	0.56	1.56
CA4	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	8	0.02	0.0889	0.788	-0.15	0.20	1.02	0.86	1.22
CA3	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	-0.14	0.5524	0.794	-1.23	0.94	0.87	0.29	2.56
CA3	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	-0.12	0.5677	0.832	-1.23	0.99	0.89	0.29	2.70
HRH4	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	7	0.04	0.2114	0.834	-0.37	0.46	1.05	0.69	1.58
IMPA1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	121	-0.00	0.0197	0.884	-0.04	0.04	1.00	0.96	1.04
CA3	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	0.06	0.3952	0.886	-0.72	0.83	1.06	0.49	2.30
SMPD1	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	4	-0.03	0.2407	0.891	-0.50	0.44	0.97	0.60	1.55
KCNH2	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	34	-0.01	0.0689	0.906	-0.14	0.13	0.99	0.87	1.14
CALM1	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	16	-0.00	0.0408	0.929	-0.08	0.08	1.00	0.92	1.08
ADRA2A	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	2	0.02	0.3375	0.950	-0.64	0.68	1.02	0.53	1.98
ADRB2	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	17	0.00	0.0632	0.961	-0.12	0.13	1.00	0.89	1.14
IMPA1	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	121	-0.00	0.0137	0.970	-0.03	0.03	1.00	0.97	1.03
HRH1	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	3	-0.00	0.2051	0.993	-0.40	0.40	1.00	0.67	1.49

Table 3. MR effects of single target gene expression in blood on venous thromboembolism outcomes

Gene	Outcome	Method	nSNPs	OR (95% CI)	P value
MCHR1	VTE	IVW	65	1.12 (1.06-1.19)	4.056×10－05
MCHR1	DVT	IVW	65	1.17 (1.09-1.25)	5.109×10－06
MCHR1	PE	IVW	65	1.12 (1.04-1.21)	0.004
CA2	VTE	IVW	101	1.05 (1.02-1.09)	7.061×10－04
CA2	DVT	IVW	101	1.04 (1.00-1.09)	0.044
HTR6	VTE	IVW	39	1.10 (1.03-1.18)	0.008
HTR6	PE	IVW	39	1.13 (1.03-1.25)	0.011
TNNC1	DVT	IVW	9	1.61 (1.10-2.34)	0.013
SLC18A2	DVT	IVW	18	1.21 (1.03-1.42)	0.018
ADRB1	VTE	IVW	33	1.10 (1.03-1.17)	0.007

Statistically significant MR results between the expression of single antipsychotic drug target gene in blood and venous thromboembolism events. CI, confidence interval; DVT, deep vein thrombosis; IVW, inverse variance weighted; MR, Mendelian randomization; nSNPs, number of single- nucleotide polymorphisms; OR, odds ratio; PE, pulmonary embolism; VTE, venous thromboembolism.

4.2 MR Analysis of Single Target Gene Expression in Brain Tissue and VTE

Of the 46 target genes for which brain tissue expression data were available, 41 genes were determined to have significantly associated SNPs (P＜1×10⁻⁵). When performing the MR analysis, genetic instrument information for only 37 genes could be extracted from the outcome data (for all results, see Supplementary Table 12). The expression of three genes in the brain tissue was found to be related to the increased risk of VTE events (P＜0.05) (Table 4), among which KCNH2 increased the risk of VTE (OR: 1.10, 95% CI: 1.05–1.15, P=7.67×10⁻⁰⁵), DVT (OR: 1.10, 95% CI: 1.02–1.19, P=0.014), and PE (OR: 1.08, 95% CI: 1.02–1.15, P=0.013).

Supplementary Table 12. MR association of each drug target gene expression in brain tissue with VTE, DVT and PE

Gene	Outcome	method	nsnp	beta	se	p-value	lo_ci	up_ci	or	or_lci95	or_uci95
KCNH2	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	7	0.09	0.0235	7.666E-05	0.05	0.14	1.10	1.05	1.15
GSTP1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	3	-0.15	0.0558	0.006	-0.26	-0.04	0.86	0.77	0.96
KCNH2	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	7	0.08	0.0320	0.013	0.02	0.14	1.08	1.02	1.15
KCNH2	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	7	0.10	0.0397	0.014	0.02	0.17	1.10	1.02	1.19
ADRA1D	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	3	-0.10	0.0415	0.017	-0.18	-0.02	0.91	0.83	0.98
HTR7	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	0.16	0.0697	0.023	0.02	0.30	1.17	1.02	1.34
DRD2	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	4	-0.06	0.0298	0.044	-0.12	-0.00	0.94	0.89	1.00
DRD4	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	6	0.04	0.0202	0.048	0.00	0.08	1.04	1.00	1.08
HTR6	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	3	0.05	0.0296	0.065	-0.00	0.11	1.06	1.00	1.12
CHRM5	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	3	-0.02	0.0136	0.075	-0.05	0.00	0.98	0.95	1.00
ADRA1A	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	-0.16	0.0905	0.075	-0.34	0.02	0.85	0.71	1.02
CA4	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	-0.17	0.0959	0.076	-0.36	0.02	0.84	0.70	1.02
OPRM1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	4	-0.05	0.0312	0.104	-0.11	0.01	0.95	0.89	1.01
GSTP1	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	3	-0.06	0.0401	0.109	-0.14	0.01	0.94	0.87	1.01
HTR6	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	3	0.07	0.0424	0.114	-0.02	0.15	1.07	0.98	1.16
CHRM5	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	3	-0.03	0.0177	0.119	-0.06	0.01	0.97	0.94	1.01
HTR1A	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	-0.21	0.1332	0.120	-0.47	0.05	0.81	0.63	1.06
HTR7	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	0.08	0.0487	0.122	-0.02	0.17	1.08	0.98	1.19
DRD4	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	6	0.04	0.0281	0.129	-0.01	0.10	1.04	0.99	1.10
CA4	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	-0.10	0.0670	0.156	-0.23	0.04	0.91	0.80	1.04
OPRK1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	2	0.05	0.0343	0.168	-0.02	0.11	1.05	0.98	1.12
HRH1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	-0.10	0.0759	0.184	-0.25	0.05	0.90	0.78	1.05
IMPA2	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	0.16	0.1283	0.219	-0.09	0.41	1.17	0.91	1.51
HTR1A	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	0.16	0.1295	0.219	-0.09	0.41	1.17	0.91	1.51
HTR6	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	3	0.05	0.0410	0.233	-0.03	0.13	1.05	0.97	1.14
MCHR1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	4	-0.06	0.0496	0.241	-0.16	0.04	0.94	0.86	1.04
OPRD1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	-0.04	0.0362	0.247	-0.11	0.03	0.96	0.89	1.03
HTR1D	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	8	0.02	0.0139	0.251	-0.01	0.04	1.02	0.99	1.04
SMPD1	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	-0.06	0.0567	0.257	-0.18	0.05	0.94	0.84	1.05
CHRM5	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	3	-0.02	0.0192	0.296	-0.06	0.02	0.98	0.94	1.02
DRD2	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	4	-0.02	0.0214	0.314	-0.06	0.02	0.98	0.94	1.02
HTR1D	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	8	0.02	0.0200	0.324	-0.02	0.06	1.02	0.98	1.06
OPRK1	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	2	0.02	0.0245	0.349	-0.03	0.07	1.02	0.98	1.07
IMPA1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	-0.08	0.0829	0.365	-0.24	0.09	0.93	0.79	1.09
HTR2B	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	0.03	0.0345	0.367	-0.04	0.10	1.03	0.96	1.10
SMPD1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	-0.07	0.0789	0.376	-0.22	0.08	0.93	0.80	1.09
HTR1D	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	8	-0.02	0.0194	0.383	-0.05	0.02	0.98	0.95	1.02
ADRA1D	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	3	-0.02	0.0298	0.407	-0.08	0.03	0.98	0.92	1.03
IMPA1	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	-0.05	0.0579	0.408	-0.16	0.07	0.95	0.85	1.07
HTR2B	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	0.04	0.0494	0.410	-0.06	0.14	1.04	0.95	1.15
HTR7	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	0.05	0.0679	0.422	-0.08	0.19	1.06	0.92	1.21
OPRM1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	4	-0.02	0.0321	0.446	-0.09	0.04	0.98	0.92	1.04
OPRD1	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	-0.02	0.0258	0.459	-0.07	0.03	0.98	0.93	1.03
ADRA1A	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	0.06	0.0879	0.495	-0.11	0.23	1.06	0.89	1.26
S100A4	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	-0.03	0.0400	0.497	-0.11	0.05	0.97	0.90	1.05
ADRA2C	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	5	0.02	0.0271	0.501	-0.03	0.07	1.02	0.97	1.07
HTR1A	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	-0.06	0.0932	0.513	-0.24	0.12	0.94	0.78	1.13
IMPA2	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	-0.08	0.1250	0.516	-0.33	0.16	0.92	0.72	1.18
DRD5	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	2	-0.03	0.0513	0.534	-0.13	0.07	0.97	0.88	1.07
HTR2C	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	-0.03	0.0457	0.538	-0.12	0.06	0.97	0.89	1.06
ADRB1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	0.05	0.0772	0.541	-0.10	0.20	1.05	0.90	1.22
OPRK1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	2	0.02	0.0384	0.550	-0.05	0.10	1.02	0.95	1.10
SMPD1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	-0.05	0.0809	0.557	-0.21	0.11	0.95	0.81	1.12
HTR2B	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	0.03	0.0479	0.569	-0.07	0.12	1.03	0.94	1.13
GSK3B	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	0.09	0.1540	0.571	-0.21	0.39	1.09	0.81	1.48
CHRM3	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	0.12	0.2095	0.578	-0.29	0.53	1.12	0.75	1.69
CHRM2	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	0.03	0.0514	0.579	-0.07	0.13	1.03	0.93	1.14
OPRM1	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	4	-0.01	0.0225	0.587	-0.06	0.03	0.99	0.95	1.03
ADRA2A	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	4	0.02	0.0422	0.591	-0.06	0.11	1.02	0.94	1.11
GRIN2B	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	2	0.05	0.0845	0.593	-0.12	0.21	1.05	0.89	1.23
CHRM2	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	0.04	0.0735	0.604	-0.11	0.18	1.04	0.90	1.20
ADRA2B	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	-0.04	0.0758	0.608	-0.19	0.11	0.96	0.83	1.12
GSTP1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	3	-0.03	0.0573	0.625	-0.14	0.08	0.97	0.87	1.09
IMPA1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	-0.04	0.0804	0.631	-0.20	0.12	0.96	0.82	1.13
HRH1	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	-0.02	0.0544	0.662	-0.13	0.08	0.98	0.88	1.09
HRH3	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	-0.02	0.0544	0.662	-0.13	0.08	0.98	0.88	1.09
ADRA2A	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	4	0.01	0.0289	0.672	-0.04	0.07	1.01	0.96	1.07
DRD5	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	2	-0.01	0.0358	0.687	-0.08	0.06	0.99	0.92	1.06
HRH3	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	0.03	0.0862	0.688	-0.13	0.20	1.04	0.87	1.23
MCHR1	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	4	-0.02	0.0434	0.703	-0.10	0.07	0.98	0.90	1.07
ADRA2C	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	5	0.01	0.0281	0.704	-0.04	0.07	1.01	0.96	1.07
CHRM3	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	0.05	0.1462	0.707	-0.23	0.34	1.06	0.79	1.41
DRD1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	-0.04	0.1163	0.715	-0.27	0.19	0.96	0.76	1.20
ADRA2A	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	4	0.01	0.0426	0.741	-0.07	0.10	1.01	0.93	1.10
S100A4	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	0.02	0.0571	0.755	-0.09	0.13	1.02	0.91	1.14
S100A4	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	-0.02	0.0555	0.757	-0.13	0.09	0.98	0.88	1.10
DRD1	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	-0.03	0.0819	0.759	-0.19	0.14	0.98	0.83	1.15
DRD2	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	4	-0.01	0.0350	0.763	-0.08	0.06	0.99	0.92	1.06
GSK3B	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	0.03	0.1073	0.766	-0.18	0.24	1.03	0.84	1.27
IMPA2	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	0.03	0.0894	0.770	-0.15	0.20	1.03	0.86	1.22
DRD5	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	2	-0.01	0.0497	0.778	-0.11	0.08	0.99	0.89	1.09
DRD1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	0.03	0.1141	0.779	-0.19	0.26	1.03	0.83	1.29
GRIN2B	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	2	-0.02	0.0825	0.784	-0.18	0.14	0.98	0.83	1.15
HTR5A	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	4	-0.01	0.0451	0.789	-0.10	0.08	0.99	0.90	1.08
ADRA1D	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	3	0.01	0.0428	0.793	-0.07	0.10	1.01	0.93	1.10
GSK3B	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	0.03	0.1493	0.823	-0.26	0.33	1.03	0.77	1.39
CA3	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	0.01	0.0356	0.828	-0.06	0.08	1.01	0.94	1.08
CA4	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	0.02	0.0933	0.837	-0.16	0.20	1.02	0.85	1.22
CA3	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	-0.01	0.0256	0.843	-0.06	0.05	0.99	0.95	1.05
MCHR1	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	4	-0.01	0.0404	0.849	-0.09	0.07	0.99	0.92	1.07
ADRA2B	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Wald ratio	1	0.02	0.1053	0.853	-0.19	0.23	1.02	0.83	1.25
CA3	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	0.01	0.0366	0.854	-0.07	0.08	1.01	0.94	1.08
ADRA2B	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	-0.02	0.1075	0.867	-0.23	0.19	0.98	0.80	1.21
HTR2C	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	0.01	0.0648	0.871	-0.12	0.14	1.01	0.89	1.15
OPRD1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	-0.01	0.0370	0.890	-0.08	0.07	0.99	0.93	1.07
HTR5A	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	4	-0.00	0.0314	0.898	-0.07	0.06	1.00	0.94	1.06
SIGMAR1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	-0.01	0.1159	0.901	-0.24	0.21	0.99	0.79	1.24
SIGMAR1	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	0.01	0.0807	0.942	-0.15	0.16	1.01	0.86	1.18
ADRA2C	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	5	0.00	0.0414	0.960	-0.08	0.08	1.00	0.92	1.09
HRH1	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	-0.00	0.0778	0.974	-0.16	0.15	1.00	0.86	1.16
HRH3	Pulmonary embolism || id:finn-b-I9_PULMEMB	Wald ratio	1	-0.00	0.0778	0.974	-0.16	0.15	1.00	0.86	1.16
HTR5A	DVT of lower extremities || id:finn-b-I9_PHLETHROMBDVTLOW	Inverse variance weighted	4	0.00	0.0786	0.975	-0.15	0.16	1.00	0.86	1.17
ADRA1A	Venous thromboembolism || id:finn-b-I9_VTE	Wald ratio	1	0.00	0.0632	0.982	-0.12	0.13	1.00	0.88	1.13
GRIN2B	Venous thromboembolism || id:finn-b-I9_VTE	Inverse variance weighted	2	0.00	0.0591	0.988	-0.12	0.12	1.00	0.89	1.12
DRD4	Pulmonary embolism || id:finn-b-I9_PULMEMB	Inverse variance weighted	6	0.00	0.0352	0.998	-0.07	0.07	1.00	0.93	1.07

Table 4. MR effects of single target gene expression in brain on venous thromboembolism outcomes

Gene	Outcome	Method	nSNPs	OR (95% CI)	P value
KCNH2	VTE	IVW	7	1.10 (1.05-1.15)	7.666×10－05
KCNH2	DVT	IVW	7	1.10 (1.02-1.19)	0.014
KCNH2	PE	IVW	7	1.08 (1.02-1.15)	0.013
HTR7	PE	Wald ratio	1	1.17 (1.02-1.34)	0.023
DRD4	VTE	IVW	6	1.04 (1.00-1.08)	0.048

Statistically significant MR results between the expression of single antipsychotic drug target gene in brain and venous thromboembolism events. CI, confidence interval; DVT, deep vein thrombosis; IVW, inverse variance weighted; MR, Mendelian randomization; nSNPs, number of single- nucleotide polymorphisms; OR, odds ratio; PE, pulmonary embolism; VTE, venous thromboembolism.

Discussion

In this study, we used publicly accessible databases to provide new perspectives for the exploration of the association between antipsychotic drugs and VTE. First, we conducted data mining on adverse event signals of VTE, DVT, and PE caused by antipsychotic drugs from the FAERS database. In total, 1694 VTE event signals were found for 16 drugs. We then performed two-sample MR analyses to estimate the association between antipsychotic drug target gene expression and VTE using eQTL data and GWAS summary data. The MR analyses were designed as shown in Fig.1. Our drug target MR analyses did not observe any effect of antipsychotic drug target gene overall expression on the risk of VTE (including DVT and PE), either in blood or brain tissue. Follow-up single gene expression MR analyses found that the expression of nine genes in blood or brain tissue was associated with the risk of VTE events, but the pharmacological actions of these targets are yet to be elucidated. Overall, our results provided real-world evidence but failed to provide strong genetic evidence for an association between antipsychotic drugs and VTE.

There have been numerous studies reporting on the associations between antipsychotic drugs and the risk of VTE, but the results of these published observational studies were deemed inconsistent. Although the results of meta-analyses showed an increased risk of VTE and PE in those exposed to antipsychotic drugs, the significant heterogeneity between these included studies suggests that the relevant conclusions still need to be treated with caution^28-31). In this study, we used the FAERS spontaneous reporting system database to mine and analyze adverse event signals for VTE, DVT, and PE caused by antipsychotic drugs. We found VTE event signals with drugs such as olanzapine, chlorpromazine, quetiapine⁶⁾, haloperidol, risperidone³²⁾, and prochlorperazine³³⁾, a finding consistent with previous observational studies.

However, both the data obtained through the drug adverse event reporting system and the information published in the literature have certain limitations (such as information bias, inconsistency in published research results), as well as potential confounding factors (such as the use of sedatives). These findings only suggest a potential association between antipsychotic drugs and VTE and thus cannot provide sufficient evidence for a causal relationship. Existing studies are also not able to elucidate the biological mechanisms of this potential adverse drug reaction. Therefore, we conducted the MR analysis to explore the causality between the two. MR analysis uses genetic variants as instrumental variables. As genotypes are innate and predate outcomes, their association with outcomes is not disturbed by common confounding factors such as postnatal behavioral factors³⁴⁾. Thus, MR method is considered to be a powerful tool for studying the causal relationship between exposures and outcomes. By definition, the MR method estimates the effect of target genes associated with drug action, rather than the direct effect of drug use on diseases. This method has been commonly used to evaluate the impact of metformin targets on Alzheimer’s disease¹⁵⁾, cardiovascular disease, and cancer risk³⁵⁾, as well as the association between antihypertensive drug target genes and psychiatric disorders¹⁶⁾, the link between statins and cognitive function³⁶⁾, etc.

Currently, pharmacogenomic (PGx) research has identified many genetic factors related to antipsychotic response and adverse effects, such as antipsychotic-induced weight gain, tardive dyskinesia, and clozapine-induced agranulocytosis (CIAG)^37-39). There has also been a study using the probabilistic MR (PMR) method to identify candidate proteins for movement-related adverse antipsychotic effects (MAAE)⁴⁰⁾. Their findings provided new insights into the biological mechanism and targets of MAAE. Thus, another purpose of our MR analysis in this study was to explain the increased risk of VTE from the perspective of antipsychotic drug target genes.

In this study, we conducted MR analysis using the blood or brain tissue expression of all target genes as exposure. We did not want to disregard any potentially important associations, so we set a conventional p-value threshold of 0.05. But we did not find any significant impact of the expression of all antipsychotic drug target genes on the risk of VTE, DVT, and PE. Nonetheless, our results should not be arbitrarily interpreted to suggest that antipsychotic drugs do not increase the risk of VTE.

Antipsychotic drugs are mostly multi-target drugs, with the dopamine receptor D2 (DRD2) and 5-hydroxytryptamine receptor 2A (HTR2A) being the main target genes⁴¹⁾. However, in our study, due to the limitations of data in the eQTLGene consortium and GTEx project, we failed to find the expression data of some important target genes such as DRD2, DRD3, and HTR2A. Moreover, a part of the eQTL SNP instruments was removed due to high linkage. Thus, some important genes were not included in the MR analysis. It is precisely these genes that were not included in the analysis that may play an important role in VTE. For example, some authors believed hyperprolactinemia is one of the reasons for the occurrence of VTE in schizophrenic patients on long-term use of antipsychotic drugs^42-44), while PGx studies have found that DRD2 gene polymorphisms are related to prolactin levels⁴⁵⁾. Also, compared with other studies^{15, 16, 36)}, due to lacking publicly available large GWAS on antipsychotic response, we cannot verify the validity of our genetic instruments through another MR analysis, which is one of our limitations.

The genetic instruments for all target gene expression were composed of the most significantly associated eQTL SNP for each gene, potentially excluding meaningful SNPs. Therefore, we subsequently analyzed the effect of each target gene expression on the outcome separately, wherein we found that the expressions of MCHR1, KCNH2, and other genes were associated with VTE, DVT, and/or PE. However, the results of this section provide limited evidential value, as the specific mechanisms of the pharmacological effects of psychotropic drugs are currently unknown. These statistically significant target genes have not been reported to have clear pharmacological activity. Taking MCHR1 as an example, it is a target gene of haloperidol in DrugBank, and it is also mentioned in the literature that haloperidol has some affinity for the MCHR1 receptor. But its effect is yet to be reported⁴⁶⁾.

Conclusions

The widespread use of antipsychotic drugs has raised concerns about their safety. By mining from the FAERS database, we analyzed the signal of VTE adverse events caused by antipsychotic drugs. The results of this study provided real-world evidence for the antipsychotic drug-induced VTE but were unable to reveal the causal relationships between the two. Therefore, we followed up with MR analyses. MR approach is known for its capability in minimizing the impact of confounding factors on the results by using genetic variants that are closely related to drug target gene expression as instrumental variables, thereby assessing causality. However, we failed to find any genetic evidence that can support the causal association and potential mechanisms between antipsychotics and VTE. The relationship between the two still needs to be interpreted with caution given the limitations of our study; thus, further investigations are needed. Despite the limited supporting evidence, vigilance is still required for the potential antipsychotic drug-related VTE adverse reactions.

Author Contributions

TL, KH, QH, and CG contributed to the study design, data analysis, result interpretation, manuscript writing and revision. LY, JM and XH contributed to data analysis and manuscript revision. LH, ChengjG, and XW contributed to result interpretation and manuscript revision. All authors read and approved the final manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (81974511), Natural Science Foundation of Hunan Province (2021JJ30424 and 2023JJ30822), Natural Science Foundation of Guangdong Province (20181015528), the Scientific and Technological Project of Changsha (kq2004147), and the Wisdom Accumulation and Talent Cultivation Project of the Third Xiangya Hospital of Central South University (YX202110).

Acknowledgements

This study was conducted using publicly available genome-wide association studies (GWAS) and expression quantitative trait loci (eQTL) summary statistics, including that from the FinnGen Biobank, the eQTLGen Consortium and the GTEx Project. We want to acknowledge the participants and investigators of the underlying studies.

Conflict of Interest

All authors declared no conflicts of interest.

References

• 1)  Shad MU. Seventy Years of Antipsychotic Development: A Critical Review. Biomedicines, 2023; 11: 130
• 2)  Khan F, Tritschler T, Kahn SR, Rodger MA. Venous thromboembolism. Lancet, 2021; 398: 64-77
• 3)  Grahmann H, Suchenwirth R. [Thrombosis hazard in chlorpromazine and reserpine therapy of endogenous psychoses]. Nervenarzt, 1959; 30: 224-225
• 4)  Haefner H, Brehm I. THROMBOEMBOLIC COMPLICATIONS IN NEUROLEPTIC TREATMENT. Compr Psychiatry, 1965; 6: 25-34
• 5)  Zornberg GL, Jick H. Antipsychotic drug use and risk of first-time idiopathic venous thromboembolism: a case-control study. Lancet, 2000; 356: 1219-1223
• 6)  Parker C, Coupland C, Hippisley-Cox J. Antipsychotic drugs and risk of venous thromboembolism: nested case-control study. BMJ, 2010; 341: c4245
• 7)  Mollard LM, Le Mao R, Tromeur C, Le Moigne E, Gouillou M, Pan-Petesch B, Delluc A, Couturaud F, Lacut K. Antipsychotic drugs and the risk of recurrent venous thromboembolism: A prospective cohort study. Eur J Intern Med, 2018; 52: 22-27
• 8)  Parkin L, Skegg DC, Herbison GP, Paul C. Psychotropic drugs and fatal pulmonary embolism. Pharmacoepidemiol Drug Saf, 2003; 12: 647-652
• 9)  Allenet B, Schmidlin S, Genty C, Bosson J-L. Antipsychotic drugs and risk of pulmonary embolism. Pharmacoepidemiol Drug Saf, 2012; 21: 42-48
• 10)  Kleijer BC, Heerdink ER, Egberts TCG, Jansen PAF, van Marum RJ. Antipsychotic drug use and the risk of venous thromboembolism in elderly patients. J Clin Psychopharmacol, 2010; 30: 526-530
• 11)  Vigod SN, Gomes T, Wilton AS, Taylor VH, Ray JG. Antipsychotic drug use in pregnancy: high dimensional, propensity matched, population based cohort study. BMJ, 2015; 350: h2298
• 12)  Jönsson AK, Schill J, Olsson H, Spigset O, Hägg S. Venous Thromboembolism During Treatment with Antipsychotics: A Review of Current Evidence. CNS Drugs, 2018; 32: 47-64
• 13)  Dhodapkar MM, Shi X, Ramachandran R, Chen EM, Wallach JD, Ross JS. Characterization and corroboration of safety signals identified from the US Food and Drug Administration Adverse Event Reporting System, 2008-19: cross sectional study. BMJ, 2022; 379: e071752
• 14)  Davies NM, Holmes MV, Davey Smith G. Reading Mendelian randomisation studies: a guide, glossary, and checklist for clinicians. BMJ, 2018; 362: k601
• 15)  Zheng J, Xu M, Walker V, Yuan J, Korologou-Linden R, Robinson J, Huang P, Burgess S, Au Yeung SL, Luo S, Holmes MV, Davey Smith G, Ning G, Wang W, Gaunt TR, Bi Y. Evaluating the efficacy and mechanism of metformin targets on reducing Alzheimer’s disease risk in the general population: a Mendelian randomisation study. Diabetologia, 2022; 65: 1664-1675
• 16)  Chauquet S, Zhu Z, O’Donovan MC, Walters JTR, Wray NR, Shah S. Association of Antihypertensive Drug Target Genes With Psychiatric Disorders: A Mendelian Randomization Study. JAMA Psychiatry, 2021; 78: 623-631
• 17)  Wishart DS, Feunang YD, Guo AC, Lo EJ, Marcu A, Grant JR, Sajed T, Johnson D, Li C, Sayeeda Z, Assempour N, Iynkkaran I, Liu Y, Maciejewski A, Gale N, Wilson A, Chin L, Cummings R, Le D, Pon A, Knox C, Wilson M. DrugBank 5.0: a major update to the DrugBank database for 2018. Nucleic Acids Res, 2018; 46: D1074-D1082
• 18)  Böhm R, Höcker J, Cascorbi I, Herdegen T. OpenVigil--free eyeballs on AERS pharmacovigilance data. Nat Biotechnol, 2012; 30: 137-138
• 19)  Evans SJ, Waller PC, Davis S. Use of proportional reporting ratios (PRRs) for signal generation from spontaneous adverse drug reaction reports. Pharmacoepidemiol Drug Saf, 2001; 10: 483-486
• 20)  Lehrer S, Rheinstein PH. Nonsteroidal anti-inflammatory drugs (NSAIDs) reduce suicidal ideation and depression. Discov Med, 2019; 28: 205-212
• 21)  Võsa U, Claringbould A, Westra H-J, Bonder MJ, Deelen P, Zeng B, Kirsten H, Saha A, Kreuzhuber R, Yazar S, Brugge H, Oelen R, de Vries DH, van der Wijst MGP, Kasela S, Pervjakova N, Alves I, Favé M-J, Agbessi M, Christiansen MW, Jansen R, Seppälä I, Tong L, Teumer A, Schramm K, Hemani G, Verlouw J, Yaghootkar H, Sönmez Flitman R, Brown A, Kukushkina V, Kalnapenkis A, Rüeger S, Porcu E, Kronberg J, Kettunen J, Lee B, Zhang F, Qi T, Hernandez JA, Arindrarto W, Beutner F, BIOS Consortium, i2QTL Consortium, Dmitrieva J, Elansary M, Fairfax BP, Georges M, Heijmans BT, Hewitt AW, Kähönen M, Kim Y, Knight JC, Kovacs P, Krohn K, Li S, Loeffler M, Marigorta UM, Mei H, Momozawa Y, Müller-Nurasyid M, Nauck M, Nivard MG, Penninx BWJH, Pritchard JK, Raitakari OT, Rotzschke O, Slagboom EP, Stehouwer CDA, Stumvoll M, Sullivan P, ’t Hoen PAC, Thiery J, Tönjes A, van Dongen J, van Iterson M, Veldink JH, Völker U, Warmerdam R, Wijmenga C, Swertz M, Andiappan A, Montgomery GW, Ripatti S, Perola M, Kutalik Z, Dermitzakis E, Bergmann S, Frayling T, van Meurs J, Prokisch H, Ahsan H, Pierce BL, Lehtimäki T, Boomsma DI, Psaty BM, Gharib SA, Awadalla P, Milani L, Ouwehand WH, Downes K, Stegle O, Battle A, Visscher PM, Yang J, Scholz M, Powell J, Gibson G, Esko T, Franke L. Large-scale cis- and trans-eQTL analyses identify thousands of genetic loci and polygenic scores that regulate blood gene expression. Nat Genet, 2021; 53: 1300-1310
• 22)  GTEx Consortium. The GTEx Consortium atlas of genetic regulatory effects across human tissues. Science, 2020; 369: 1318-1330
• 23)  Schmidt AF, Finan C, Gordillo-Marañón M, Asselbergs FW, Freitag DF, Patel RS, Tyl B, Chopade S, Faraway R, Zwierzyna M, Hingorani AD. Genetic drug target validation using Mendelian randomisation. Nat Commun, 2020; 11: 3255
• 24)  Elsworth B, Lyon M, Alexander T, Liu Y, Matthews P, Hallett J, Bates P, Palmer T, Haberland V, Smith GD, Zheng J, Haycock P, Gaunt TR, Hemani G. The MRC IEU OpenGWAS data infrastructure. BioRxiv, 2020
• 25)  Hemani G, Zheng J, Elsworth B, Wade KH, Haberland V, Baird D, Laurin C, Burgess S, Bowden J, Langdon R, Tan VY, Yarmolinsky J, Shihab HA, Timpson NJ, Evans DM, Relton C, Martin RM, Davey Smith G, Gaunt TR, Haycock PC. The MR-Base platform supports systematic causal inference across the human phenome. eLife, 2018; 7: e34408
• 26)  Kurki MI, Karjalainen J, Palta P, Sipilä TP, Kristiansson K, Donner KM, Reeve MP, Laivuori H, Aavikko M, Kaunisto MA, Loukola A, Lahtela E, Mattsson H, Laiho P, Della Briotta Parolo P, Lehisto AA, Kanai M, Mars N, Rämö J, Kiiskinen T, Heyne HO, Veerapen K, Rüeger S, Lemmelä S, Zhou W, Ruotsalainen S, Pärn K, Hiekkalinna T, Koskelainen S, Paajanen T, Llorens V, Gracia-Tabuenca J, Siirtola H, Reis K, Elnahas AG, Sun B, Foley CN, Aalto-Setälä K, Alasoo K, Arvas M, Auro K, Biswas S, Bizaki-Vallaskangas A, Carpen O, Chen C-Y, Dada OA, Ding Z, Ehm MG, Eklund K, Färkkilä M, Finucane H, Ganna A, Ghazal A, Graham RR, Green EM, Hakanen A, Hautalahti M, Hedman ÅK, Hiltunen M, Hinttala R, Hovatta I, Hu X, Huertas-Vazquez A, Huilaja L, Hunkapiller J, Jacob H, Jensen J-N, Joensuu H, John S, Julkunen V, Jung M, Junttila J, Kaarniranta K, Kähönen M, Kajanne R, Kallio L, Kälviäinen R, Kaprio J, FinnGen, Kerimov N, Kettunen J, Kilpeläinen E, Kilpi T, Klinger K, Kosma V-M, Kuopio T, Kurra V, Laisk T, Laukkanen J, Lawless N, Liu A, Longerich S, Mägi R, Mäkelä J, Mäkitie A, Malarstig A, Mannermaa A, Maranville J, Matakidou A, Meretoja T, Mozaffari SV, Niemi MEK, Niemi M, Niiranen T, O Donnell CJ, Obeidat ME, Okafo G, Ollila HM, Palomäki A, Palotie T, Partanen J, Paul DS, Pelkonen M, Pendergrass RK, Petrovski S, Pitkäranta A, Platt A, Pulford D, Punkka E, Pussinen P, Raghavan N, Rahimov F, Rajpal D, Renaud NA, Riley-Gillis B, Rodosthenous R, Saarentaus E, Salminen A, Salminen E, Salomaa V, Schleutker J, Serpi R, Shen H-Y, Siegel R, Silander K, Siltanen S, Soini S, Soininen H, Sul JH, Tachmazidou I, Tasanen K, Tienari P, Toppila-Salmi S, Tukiainen T, Tuomi T, Turunen JA, Ulirsch JC, Vaura F, Virolainen P, Waring J, Waterworth D, Yang R, Nelis M, Reigo A, Metspalu A, Milani L, Esko T, Fox C, Havulinna AS, Perola M, Ripatti S, Jalanko A, Laitinen T, Mäkelä TP, Plenge R, McCarthy M, Runz H, Daly MJ, Palotie A. FinnGen provides genetic insights from a well-phenotyped isolated population. Nature, 2023; 613: 508-518
• 27)  Boehm FJ, Zhou X. Statistical methods for Mendelian randomization in genome-wide association studies: A review. Comput Struct Biotechnol J, 2022; 20: 2338-2351
• 28)  Arasteh O, Nomani H, Baharara H, Sadjadi SA, Mohammadpour AH, Ghavami V, Sathyapalan T, Sahebkar A. Antipsychotic Drugs and Risk of Developing Venous Thromboembolism and Pulmonary Embolism: A Systematic Review and Meta-Analysis. Curr Vasc Pharmacol, 2020; 18: 632-643
• 29)  Di X, Chen M, Shen S, Cui X. Antipsychotic use and Risk of Venous Thromboembolism: A Meta-Analysis. Psychiatry Res, 2021; 296: 113691
• 30)  Liu Y, Xu J, Fang K, Xu Y, Gao J, Zhou C, Tang X, Fang X, Chen J, Xie C, Zhang F, Zhang X, Wang C. Current antipsychotic agent use and risk of venous thromboembolism and pulmonary embolism: a systematic review and meta-analysis of observational studies. Ther Adv Psychopharmacol, 2021; 11: 2045125320982720
• 31)  Manoubi SA, Boussaid M, Brahim O, Ouanes S, Mahjoub Y, Zarrouk L, Mesrati MA, Aissaoui A. Fatal pulmonary embolism in patients on antipsychotics: case series, systematic review and meta-analysis. Asian J Psychiatry, 2022; 73: 103105
• 32)  Wang M-T, Liou J-T, Huang Y-W, Lin CW, Wu G-J, Chu C-L, Yeh C-B, Wang Y-H. Use of antipsychotics and risk of venous thromboembolism in postmenopausal women. A population-based nested case-control study. Thromb Haemost, 2016; 115: 1209-1219
• 33)  Ishiguro C, Wang X, Li L, Jick S. Antipsychotic drugs and risk of idiopathic venous thromboembolism: a nested case-control study using the CPRD. Pharmacoepidemiol. Drug Saf, 2014; 23: 1168-1175
• 34)  Skrivankova VW, Richmond RC, Woolf BAR, Davies NM, Swanson SA, VanderWeele TJ, Timpson NJ, Higgins JPT, Dimou N, Langenberg C, Loder EW, Golub RM, Egger M, Davey Smith G, Richards JB. Strengthening the reporting of observational studies in epidemiology using mendelian randomisation (STROBE-MR): explanation and elaboration. BMJ, 2021; 375: n2233
• 35)  Luo S, Schooling CM, Wong ICK, Au Yeung SL. Evaluating the impact of AMPK activation, a target of metformin, on risk of cardiovascular diseases and cancer in the UK Biobank: a Mendelian randomisation study. Diabetologia, 2020; 63: 2349-2358
• 36)  Rosoff DB, Bell AS, Jung J, Wagner J, Mavromatis LA, Lohoff FW. Mendelian Randomization Study of PCSK9 and HMG-CoA Reductase Inhibition and Cognitive Function. J Am Coll Cardiol, 2022; 80: 653-662
• 37)  Zai CC, Tiwari AK, Zai GC, Maes MS, Kennedy JL. New findings in pharmacogenetics of schizophrenia. Curr Opin Psychiatry, 2018; 31: 200-212
• 38)  Islam F, Men X, Yoshida K, Zai CC, Müller DJ. Pharmacogenetics-Guided Advances in Antipsychotic Treatment. Clin Pharmacol Ther, 2021; 110: 582-588
• 39)  Płaza O, Gałecki P, Orzechowska A, Gałecka M, Sobolewska-Nowak J, Szulc A. Pharmacogenetics and Schizophrenia-Can Genomics Improve the Treatment with Second-Generation Antipsychotics? Biomedicines, 2022; 10: 3165
• 40)  Li J, Pang J, Si S, Zhang K, Tang F, Xue F. Identification of novel proteins associated with movement-related adverse antipsychotic effects by integrating GWAS data and human brain proteomes. Psychiatry Res, 2022; 317: 114791
• 41)  de Bartolomeis A, Barone A, Begni V, Riva MA. Present and future antipsychotic drugs: A systematic review of the putative mechanisms of action for efficacy and a critical appraisal under a translational perspective. Pharmacol Res, 2022; 176: 106078
• 42)  Wallaschofski H, Eigenthaler M, Kiefer M, Donné M, Hentschel B, Gertz HJ, Lohmann T. Hyperprolactinemia in patients on antipsychotic drugs causes ADP-stimulated platelet activation that might explain the increased risk for venous thromboembolism: pilot study. J Clin Psychopharmacol, 2003; 23: 479-483
• 43)  Axelsson S, Hägg S, Eriksson AC, Lindahl TL, Whiss PA. In vitro effects of antipsychotics on human platelet adhesion and aggregation and plasma coagulation. Clin Exp Pharmacol Physiol, 2007; 34: 775-780
• 44)  Peuskens J, Pani L, Detraux J, De Hert M. The effects of novel and newly approved antipsychotics on serum prolactin levels: a comprehensive review. CNS Drugs, 2014; 28: 421-453
• 45)  Miura I, Zhang J-P, Hagi K, Lencz T, Kane JM, Yabe H, Malhotra AK, Correll CU. Variants in the DRD2 locus and antipsychotic-related prolactin levels: A meta-analysis. Psychoneuroendocrinology, 2016; 72: 1-10
• 46)  Theisen FM, Haberhausen M, Firnges MA, Gregory P, Reinders JH, Remschmidt H, Hebebrand J, Antel J. No evidence for binding of clozapine, olanzapine and/or haloperidol to selected receptors involved in body weight regulation. Pharmacogenomics J, 2007; 7: 275-281