2025 Volume 60 Issue 3 Pages 113-129
In recent years, there have been many publications reporting mass mortality events and genotyping of carp edema virus (CEV) around the world, but molecular phylogenetic knowledge of CEV in Japan is scarce. Therefore, in this study, we performed a comprehensive survey to understand the prevalence and genotypes of CEV in koi fish farms in Japan. PCR was performed to amplify a portion of the p4a gene of CEV from 585 samples collected in 2021 across 96 aquaculture farms in 16 prefectures. The results showed that 62.5% of prefectures and 21.9% of fish farms were found to be positive for CEV. Overall, 42 samples were positive for CEV, and a total of 12 genotypes were detected by sequencing a portion of the p4a gene. Phylogenetic analysis revealed that all of the genotypes obtained in this study belonged to genogroup II. Of the 12 CEV genotypes found in Japan, 10 were identical to CEVs reported in other parts of the world. We speculate that the international koi trade has contributed to the spread of genogroup II. This study represents the first large-scale genetic survey of CEV in koi in Japan.
Viral edema of carp, also known as koi sleepy disease, is a serious disease affecting carp culture in Japan. The disease was first reported in 1974 in ornamental koi carp, Cyprinus carpio (hereinafter referred to as koi) (Murakami et al., 1976; Ono et al., 1986; Amita et al., 2002). The causative agent of the disease, carp edema virus (CEV), is a member of the Poxviridae family and possesses a linear double-stranded DNA genome approximately 460 kbp in size (Mekata et al., 2021). CEV infection causes whole-body edema in juveniles in early summer (June–July), followed by a mass mortality event several days later and a cumulative mortality rate of more than 80% (Oyamatsu et al., 1997). Clinical manifestations of the disease differ in adult fish; infected koi become lethargic, remaining on the bottom of tanks as if sleeping, and eventually die (Amita et al., 2002).
Many publications have been reported to date on CEV-associated mass mortality events and the detection of the virus across Asia, the Middle East, Europe, and other regions (Adamek et al., 2018; Kim et al., 2018; Lovy et al., 2018; Luo et al., 2020; Matějíčková et al., 2020; Kushala et al., 2022). CEV is classified into two major genogroups, genogroup I and genogroup II, based on the p4a gene sequence (Machat et al., 2021). These two genogroups appear to exhibit unique geographical distributions and different characteristics or pathogenicity in koi and common carp Cyprinus carpio. Genogroup I has been primarily detected in the United States as well as in European and Middle Eastern countries, while genogroup II has been detected in Asian and European countries (Machat et al., 2021). In addition, genogroup I has been mainly detected in common carp, where it is associated with devastating mass mortality events, but has not been commonly detected in koi. For example, according to Adamek et al. (2021), the cumulative mortality of CEV genogroup I in koi was relatively low (~10%), and this genogroup was rarely detected in koi (Matějíčková et al., 2020; Adamek et al., 2021). In contrast, genogroup II appears to be highly pathogenic in koi, but not in common carp (Adamek et al., 2021). Although genogroup II has been detected in common carp, reports of mass mortality associated with this genogroup in common carp are scarce (Matras et al., 2017; Soliman et al., 2019; Adamek et al., 2021). Some researchers have further subdivided CEV genogroup II into the subgroups IIa and IIb (Matras et al., 2017; Adamek et al., 2018; Soliman et al., 2019). In addition to genogroups I and II, Baud et al. (2021) and Soliman et al. (2019) proposed another genogroup, genogroup III.
To better understand the prevalence of CEV and its genogroups in koi in Japan, we conducted an epidemiological survey using samples collected in 2021 from apparently healthy koi across various regions of Japan. We expected that analyzing the genogroups of CEV in Japan would provide insights into current trends in the dissemination of CEV, including horizontal transmission patterns and potential connections to CEV strains from other countries.
In this study, a total of 585 gill samples were collected from 96 fish farms across 16 prefectures in Japan in 2021. Those gill samples were obtained from 2,605 apparently healthy koi aged 0–3 years; note that, in general, most of the samples were pooled to reduce the number of samples to analyze (2–10 individuals). Detailed information regarding the fish examined in this survey is shown in Table 1.
| Pref. | Farm | Fish Information | Pref. | Farm | Fish Information | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| n | Age (year) | SL (mm) | BW (g) | n | Age (year) | SL (mm) | BW (g) | ||||
| A | F-1 | 30 | 2 | 142.0 | 68.4 | J | F-14 | 5 | ND | 125.4 | ND |
| 30 | 1 | 119.0 | 33.5 | F-15 | 5 | ND | 183.8 | ND | |||
| F-22 | 30 | 0.5-1 | 135.0 | 39.4 | F-16 | 10 | ND | 212.2 | ND | ||
| 60 | 0.5-1 | 151.0 | ND | F-17 | 7 | ND | 338.9 | ND | |||
| F-23 | 30 | 0.5-1 | 121.0 | 35.3 | F-18 | 5 | ND | 320.0 | ND | ||
| 15 | 0.5-1 | 138.0 | ND | F-50 | 10 | ND | 171.0 | ND | |||
| B | F-2 | 60 | 1 | 88.2 | 24.5 | F-51 | 4 | ND | 444.0 | ND | |
| F-6 | 60 | 1 | 87.5 | 23.4 | F-52 | 1 | ND | 542.0 | ND | ||
| F-7 | 60 | 1 | 127.1 | 53.8 | F-53 | 5 | ND | 206.2 | ND | ||
| F-19 | 60 | 1 | 71.7 | 15.2 | F-54 | 5 | ND | 164.8 | ND | ||
| F-20 | 30 | 1 | 118.1 | 57.6 | F-55 | 3 | ND | 392.3 | ND | ||
| F-21 | 60 | 1 | 102.9 | 41.2 | F-56 | 5 | ND | 134.0 | ND | ||
| F-24 | 60 | 1 | 80.8 | 17.0 | F-57 | 5 | ND | 202.6 | ND | ||
| F-25 | 60 | 1 | 98.1 | 29.8 | F-58 | 5 | ND | 144.2 | ND | ||
| F-26 | 60 | 1 | 108.7 | 46.6 | F-59 | 5 | ND | 250.2 | ND | ||
| F-27 | 60 | 1 | 121.1 | 55.0 | F-60 | 5 | ND | 159.8 | ND | ||
| F-28 | 60 | 1 | 93.1 | 28.3 | F-61 | 5 | ND | 185.4 | ND | ||
| F-29 | 60 | 1 | 92.0 | 26.8 | F-62 | 5 | ND | 303.8 | ND | ||
| F-30 | 60 | 1 | 97.7 | 29.0 | F-63 | 3 | ND | 373.0 | ND | ||
| F-31 | 60 | 1 | 135.6 | 81.3 | F-64 | 5 | ND | 359.6 | ND | ||
| F-32 | 60 | 1 | 90.9 | 24.4 | F-65 | 5 | ND | 358.5 | ND | ||
| F-33 | 60 | 1 | 86.0 | 22.3 | F-66 | 5 | ND | 359.8 | ND | ||
| F-34 | 30 | 1 | 90.2 | 27.3 | F-67 | 5 | ND | 207.2 | ND | ||
| F-35 | 30 | 1 | 79.1 | 16.6 | F-68 | 5 | ND | 205.8 | ND | ||
| F-36 | 20 | 1 | ND | ND | F-69 | 1 | ND | 432.0 | ND | ||
| C | F-3 | 30 | 1-3 | 129.0 | 30.7 | F-70 | 2 | ND | 290.4 | ND | |
| 60 | 1-3 | 96.0 | ND | F-71 | 1 | ND | 501.0 | ND | |||
| F-37 | 30 | 1-2 | 172.0 | 132.5 | F-72 | 5 | ND | 331.2 | ND | ||
| D | F-4 | 30 | 1-2 | 113.0 | 23.5 | F-73 | 5 | ND | 389.8 | ND | |
| 60 | 1-2 | 166.0 | ND | F-74 | 5 | ND | 280.2 | ND | |||
| F-38 | 30 | 2 | 123.0 | 38.9 | F-75 | 5 | ND | 246.6 | ND | ||
| F-39 | 30 | 1 | 142.0 | 44.2 | F-76 | 1 | ND | 556.0 | ND | ||
| E | F-5 | 30 | 0.5-1 | 171.0 | 82.3 | F-77 | 5 | ND | 282.2 | ND | |
| F-13 | 30 | 0.5-1 | 138.0 | 47.0 | F-78 | 1 | ND | 592.0 | ND | ||
| 30 | 0.5-1 | 151.0 | ND | F-79 | 5 | ND | 273.0 | ND | |||
| F-40 | 30 | <0.5 | 123.0 | 39.2 | F-80 | 5 | ND | 364.6 | ND | ||
| F-41 | 30 | <0.5 | 114.0 | 25.9 | F-81 | 5 | ND | 163.4 | ND | ||
| F-42 | 30 | 0.5-1 | 155.0 | 65.2 | F-82 | 5 | ND | 143.4 | ND | ||
| F | F-8 | 30 | <0.5 | 130.0 | 27.7 | F-83 | 5 | ND | 304.0 | ND | |
| F-43 | 36 | ND | ND | ND | F-84 | 5 | ND | 338.2 | ND | ||
| 30 | 0.5-1 | 115.0 | 27.7 | F-85 | 1 | ND | 503.0 | ND | |||
| F-44 | 114 | <0.5 | ND | ND | F-86 | 1 | ND | 510.0 | ND | ||
| F-45 | 48 | <0.5 | ND | ND | F-87 | 1 | ND | 495.0 | ND | ||
| F-46 | 30 | 0.5-1 | 114.0 | 23.0 | F-88 | 2 | ND | 459.5 | ND | ||
| F-47 | 30 | 0.5-1 | 75.0 | 6.8 | F-89 | 5 | ND | 280.4 | ND | ||
| G | F-10 | 30 | 0.5-1 | 111.0 | 16.8 | F-90 | 3 | ND | 393.7 | ND | |
| F-9 | 30 | 1 | 118.0 | 23.5 | K | F-91 | 30 | 1 | 148.0 | 46.7 | |
| F-48 | 30 | 1 | 109.0 | 19.1 | L | F-92 | 30 | <0.5 | 103.0 | 18.9 | |
| F-49 | 30 | 1 | 107.0 | 18.6 | M | F-93 | 30 | 1 | 141.0 | 46.9 | |
| H | F-11 | 30 | 0.5-1 | 113.0 | 28.0 | N | F-94 | 30 | 1 | 153.0 | 54.4 |
| I | F-12 | 30 | 0.5-1 | 92.0 | 10.8 | O | F-95 | 30 | 0.5-1 | 116.0 | 23.4 |
| P | F-96 | 30 | 1 | 122.0 | 25.1 | ||||||
| 75 | 1 | 124.0 | ND | ||||||||
The number of fish tested (n), age, average standard length (SL), and body weight (BW) are shown. For Prefecture B, the SL and BW data were obtained for only half of the fish included in the survey. ND: no data. Age: <0.5: less than 6 months old, and 0.5–1: 6 to 11 months old.
Three research institutes, (1) the Niigata Prefectural Inland Water Fisheries Experiment Station, (2) Fisheries and Marine Technology Center, Hiroshima Prefectural Technology Research Institute, and (3) Japan Fisheries Resource Conservation Association, provided all the samples analyzed in this study. The Niigata Prefectural Inland Water Fisheries Experiment Station and the Hiroshima Prefectural Technology Research Institute provided samples collected in the respective prefectures, while the Japan Fisheries Resource Conservation Association supplied all the other samples. The samples from Niigata Prefectural Inland Water Fisheries Experiment Station were frozen gills so that genomic DNA extraction was performed at the Japan Fisheries Research and Education Agency using a commercially available kit (Quick-DNA/RNA Pathogen Miniprep from Zymo Research). The Hiroshima Prefectural Technology Research Institute and Japan Fisheries Resource Conservation Association provided genomic DNA samples, which were extracted using Gentra Puregene Tissue Kit or QIAamp DNA Mini Kit (Qiagen).
PCR and sequencingThe PCR for CEV p4a gene was performed as described by Adamek et al. (2017a) with some modifications. The PCR primers developed by Adamek et al. (2017a) were used (Table 2). DNA amplification was performed using TaKaRa ExTaq Hot Start Version DNA polymerase (TaKaRa Bio Inc.). The reaction mixture (20 μL total volume) consisted of 2 μL of 10× Ex Taq Buffer (Mg2+ plus), 1.6 μL of dNTP Mixture (2.5 mM each), template genomic DNA (<500 ng), 0.2 μL each of forward and reverse primers (100 μM), 0.1 μL of TaKaRa Ex Taq HS (5 U/μL), and nuclease-free water. The reactions were performed using a SimpliAmp-S2TCP thermal cycler (Applied Biosystems). The cycling conditions consisted of an initial denaturation step at 95°C for 5 min, followed by 45 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s, with a final extension step of 72°C for 7 min (Adamek et al., 2017a). When necessary, nested PCR was performed using a 1:30 diluted PCR product from the initial reaction (1.0 μL) with the same reaction mixture and primers described above. To minimize non-specific amplification, the number of cycles for the nested PCR was reduced to 35.
| PCR name | Oligo name | Sequence (5′-3′) | Amplified product size (bp) | Reference |
|---|---|---|---|---|
| 1st PCR | CEFAS_F (CEV for B) | ATGGAGTATCCAAAGTACTTAG | 528 | (Adamek et al., 2017a; Matras et al., 2017) |
| (CEFAS end-point) | CEFAS_R (CEV rev J) | CTCTTCACTATTGTGACTTTG | ||
| nested PCR | CEFAS_nF (CEV ForB-int) | GTTATCAATGAAATTTGTGTATTG | 478 | |
| (CEFAS nested end-point) | CEFAS_nR (CEV RevJ-int) | TAGCAAAGTACTACCTCATCC |
For sequencing reactions, amplified PCR DNA fragments were purified using an illustra ExoProStar kit (Cytiva, Danaher Corporation) to remove unincorporated primers and dNTPs. The sequencing analysis was performed by Fasmac Co., Ltd. For the analysis of sequencing data, unique sequences obtained from individual fish farms, regardless of the source of fish, were treated as distinct strains. In addition, unique sequences detected from multiple fish farms were treated as genotypes.
Phylogenetic analysisMultiple sequence alignments were performed using the Clustal W program implemented in BioEdit software ver. 7.0.9.0 (Hall, 1999). The analysis included 425 bp of the p4a gene sequence from a total of 42 sequences obtained in this study (Table 3) and 238 sequences available in the GenBank Database as of June 2022 (Table 4). Details of the sequences obtained from the database, including strain name, location, year, genogroup, and host, are summarized in Table 4. The aligned sequences were trimmed to 348 bp to obtain an overlapping region among all the sequences for the subsequent analyses. The obtained alignment was then used for similarity searches with MatGAT software ver. 2.02 (Campanella et al., 2003) and for phylogenetic analyses with Molecular Evolutionary Genetics Analysis (MEGA) software ver. 6.06 (Tamura et al., 2013). Phylogenetic trees were constructed with using the maximum likelihood method with Tamura-Nei nucleotide substitution model and 1,000 bootstrap replicates.
| Pref. | Number and percentage of CEV positive fish farms in each prefecture | Farm | GenBank Accession No. | Strain Name | Sample Name | Genotype Name | CEV PCR and sequencing results | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Number of CEV positive sample | Number of sample | Details of sample (pooled or not pooled) | Farm | Prefecture | ||||||||||
| CEV p4a sequence similarity within samples (%) | CEV positive perc. | CEV p4a sequence similarity within samples (%) | CEV positive perc. | |||||||||||
| Number of CEV positive fish farm and its percentage | Total number of fish farm | |||||||||||||
| A | 1 (33.3%) | 3 | F-1 | LC855105 | JP21-033 | JP21-033 | GT-1 | 1 | 6 | 5 fish/sample | 98.4-100 | 38.5 | 98.4-100 | 12.5 |
| LC855106 | JP21-163 | JP21-163 JP21-164 | GT-6 | 2 | 7 | 4 or 5 fish/sample | ||||||||
| LC855107 | JP21-167 | JP21-167 JP21-168 | GT-3 | 2 | ||||||||||
| F-22 | NA | NA | NA | NA | 0 | 18 | 5 fish/sample | NA | 0.0 | |||||
| F-23 | NA | NA | NA | NA | 0 | 9 | 5 fish/sample | NA | 0.0 | |||||
| B | 6 (31.5%) | 19 | F-2 | LC855108 | JP21-404 | JP21-404 | GT-1 | 1 | 12 | 5 fish/sample | NA | 8.3 | 98.1-100 | 5.0 |
| F-6 | LC855109 | JP21-399 | JP21-399 | GT-6 | 1 | 12 | 5 fish/sample | NA | 8.3 | |||||
| F-7 | LC855110 | JP21-482 | JP21-482 JP21-483 | GT-6 | 2 | 12 | 5 fish/sample | 100 | 16.7 | |||||
| F-19 | LC855111 | JP21-487 | JP21-487 | GT-3 | 1 | 12 | 5 fish/sample | NA | 8.3 | |||||
| F-20 | LC855112 | JP21-551 | JP21-551 JP21-552 JP21-553 JP21-556 | GT-3 | 4 | 6 | 5 fish/sample | 100 | 66.7 | |||||
| F-21 | LC855113 | JP21-521 | JP21-521 | GT-4 | 1 | 12 | 5 fish/sample | NA | 8.3 | |||||
| F-24 | NA | NA | NA | NA | 0 | 12 | 5 fish/sample | NA | 0.0 | |||||
| F-25 | NA | NA | NA | NA | 0 | 12 | 5 fish/sample | NA | 0.0 | |||||
| F-26 | NA | NA | NA | NA | 0 | 12 | 5 fish/sample | NA | 0.0 | |||||
| F-27 | NA | NA | NA | NA | 0 | 12 | 5 fish/sample | NA | 0.0 | |||||
| F-28 | NA | NA | NA | NA | 0 | 12 | 5 fish/sample | NA | 0.0 | |||||
| F-29 | NA | NA | NA | NA | 0 | 12 | 5 fish/sample | NA | 0.0 | |||||
| F-30 | NA | NA | NA | NA | 0 | 12 | 5 fish/sample | NA | 0.0 | |||||
| F-31 | NA | NA | NA | NA | 0 | 12 | 5 fish/sample | NA | 0.0 | |||||
| F-32 | NA | NA | NA | NA | 0 | 12 | 5 fish/sample | NA | 0.0 | |||||
| F-33 | NA | NA | NA | NA | 0 | 12 | 5 fish/sample | NA | 0.0 | |||||
| F-34 | NA | NA | NA | NA | 0 | 6 | 5 fish/sample | NA | 0.0 | |||||
| F-35 | NA | NA | NA | NA | 0 | 6 | 5 fish/sample | NA | 0.0 | |||||
| F-36 | NA | NA | NA | NA | 0 | 2 | 10 fish/sample | NA | 0.0 | |||||
| C | 1 (50%) | 2 | F-3 | LC855114 | JP21-038 | JP21-038 | GT-6 | 1 | 18 | 5 fish/sample | NA | 5.6 | NA | 4.2 |
| F-37 | NA | NA | NA | NA | 0 | 6 | 5 fish/sample | NA | 0.0 | |||||
| D | 1 (33.3%) | 3 | F-4 | LC855115 | JP21-174 | JP21-174 | GT-6 | 1 | 6 | 5 fish/sample | 100 | 26.9 | 100 | 18.4 |
| LC855115 | JP21-174 | JP21-182 JP21-183 JP21-185 JP21-186 JP21-187 JP21-189 | GT-6 | 6 | 20 | 3 fish/sample | ||||||||
| F-38 | NA | NA | NA | NA | 0 | 6 | 5 fish/sample | NA | 0.0 | |||||
| F-39 | NA | NA | NA | NA | 0 | 6 | 5 fish/sample | NA | 0.0 | |||||
| E | 2 (40%) | 5 | F-5 | LC855116 | JP21-268 | JP21-268 | GT-6 | 1 | 6 | 5 fish/sample | NA | 16.7 | 99.3 | 4.5 |
| F-13 | LC855117 | JP21-327 | JP21-327 | GT-10 | 1 | 10 | 3 fish/sample | NA | 6.3 | |||||
| NA | NA | NA | NA | 0 | 6 | 5 fish/sample | ||||||||
| F-40 | NA | NA | NA | NA | 0 | 10 | 3 fish/sample | NA | 0.0 | |||||
| F-41 | NA | NA | NA | NA | 0 | 6 | 5 fish/sample | NA | 0.0 | |||||
| F-42 | NA | NA | NA | NA | 0 | 6 | 5 fish/sample | NA | 0.0 | |||||
| F | 1 (16.6%) | 6 | F-8 | LC855118 | JP21-073 | JP21-073 JP21-077 | GT-11 | 2 | 6 | 5 fish/sample | 100 | 33.3 | 100 | 2.2 |
| F-43 | NA | NA | NA | NA | 0 | 12 | 3 fish/sample | NA | 0.0 | |||||
| NA | NA | NA | NA | 0 | 6 | 5 fish/sample | ||||||||
| F-44 | NA | NA | NA | NA | 0 | 38 | 3 fish/sample | NA | 0.0 | |||||
| F-45 | NA | NA | NA | NA | 0 | 16 | 3 fish/sample | NA | 0.0 | |||||
| F-46 | NA | NA | NA | NA | 0 | 6 | 5 fish/sample | NA | 0.0 | |||||
| F-47 | NA | NA | NA | NA | 0 | 6 | 5 fish/sample | NA | 0.0 | |||||
| G | 2 (50%) | 4 | F-10 | LC855119 | JP21-232 | JP21-232 | GT-7 | 1 | 6 | 5 fish/sample | NA | 16.7 | 99.5-100 | 16.7 |
| F-9 | LC855120 | JP21-245 | JP21-245 | GT-12 | 1 | 6 | 5 fish/sample | 99.8-100 | 50.0 | |||||
| LC855121 | JP21-246 | JP21-246 JP21-248 | GT-11 | 2 | ||||||||||
| F-48 | NA | NA | NA | NA | 0 | 6 | 5 fish/sample | NA | 0.0 | |||||
| F-49 | NA | NA | NA | NA | 0 | 6 | 5 fish/sample | NA | 0.0 | |||||
| H | 1 (100%) | 1 | F-11 | LC855122 | JP21-308 | JP21-308 JP21-309 JP21-310 JP21-312 JP21-313 | GT-12 | 5 | 6 | 5 fish/sample | 100 | 83.3 | 100 | 83.3 |
| I | 1 (100%) | 1 | F-12 | LC855123 | JP21-314 | JP21-314 | GT-8 | 1 | 6 | 5 fish/sample | NA | 16.7 | NA | 16.7 |
| J | 5 (10.8%) | 46 | F-14 | LC855124 | JP21-342 | JP21-342 | GT-5 | 1 | 1 | 5 fish/sample | NA | 100.0 | 98.8-100 | 10.0 |
| F-15 | LC855125 | JP21-346 | JP21-346 | GT-2 | 1 | 1 | 5 fish/sample | NA | 100.0 | |||||
| F-16 | LC855126 | JP21-350 | JP21-350 | GT-9 | 1 | 2 | 5 fish/sample | NA | 50.0 | |||||
| F-17 | LC855127 | JP21-351 | JP21-351 | GT-9 | 1 | 1 | 5 fish/sample | NA | 50.0 | |||||
| NA | NA | NA | NA | 0 | 1 | 2 fish/sample | ||||||||
| F-18 | LC855128 | JP21-375 | JP21-375 | GT-9 | 1 | 1 | 5 fish/sample | NA | 100.0 | |||||
| F-50 | NA | NA | NA | NA | 0 | 2 | 5 fish/sample | NA | 0.0 | |||||
| F-51 | NA | NA | NA | NA | 0 | 2 | 2 fish/sample | NA | 0.0 | |||||
| F-52 | NA | NA | NA | NA | 0 | 1 | not pooled | NA | 0.0 | |||||
| F-53 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-54 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-55 | NA | NA | NA | NA | 0 | 1 | 3 fish/sample | NA | 0.0 | |||||
| F-56 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-57 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-58 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-59 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-60 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-61 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-62 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-63 | NA | NA | NA | NA | 0 | 1 | 3 fish/sample | NA | 0.0 | |||||
| F-64 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-65 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-66 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-67 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-68 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-69 | NA | NA | NA | NA | 0 | 1 | not pooled | NA | 0.0 | |||||
| F-70 | NA | NA | NA | NA | 0 | 1 | 2 fish/sample | NA | 0.0 | |||||
| F-71 | NA | NA | NA | NA | 0 | 1 | not pooled | NA | 0.0 | |||||
| F-72 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-73 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-74 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-75 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-76 | NA | NA | NA | NA | 0 | 1 | not pooled | NA | 0.0 | |||||
| F-77 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-78 | NA | NA | NA | NA | 0 | 1 | not pooled | NA | 0.0 | |||||
| J | 5 (10.8%) | 46 | F-79 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | ||
| F-80 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-81 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-82 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-83 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-84 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-85 | NA | NA | NA | NA | 0 | 1 | not pooled | NA | 0.0 | |||||
| F-86 | NA | NA | NA | NA | 0 | 1 | not pooled | NA | 0.0 | |||||
| F-87 | NA | NA | NA | NA | 0 | 1 | not pooled | NA | 0.0 | |||||
| F-88 | NA | NA | NA | NA | 0 | 1 | 2 fish/sample | NA | 0.0 | |||||
| F-89 | NA | NA | NA | NA | 0 | 1 | 5 fish/sample | NA | 0.0 | |||||
| F-90 | NA | NA | NA | NA | 0 | 1 | 3 fish/sample | NA | 0.0 | |||||
| K | 0 (0%) | 1 | F-91 | NA | NA | NA | NA | 0 | 6 | 5 fish/sample | NA | 0.0 | NA | 0.0 |
| L | 0 (0%) | 1 | F-92 | NA | NA | NA | NA | 0 | 6 | 5 fish/sample | NA | 0.0 | NA | 0.0 |
| M | 0 (0%) | 1 | F-93 | NA | NA | NA | NA | 0 | 6 | 5 fish/sample | NA | 0.0 | NA | 0.0 |
| N | 0 (0%) | 1 | F-94 | NA | NA | NA | NA | 0 | 6 | 5 fish/sample | NA | 0.0 | NA | 0.0 |
| O | 0 (0%) | 1 | F-95 | NA | NA | NA | NA | 0 | 6 | 5 fish/sample | NA | 0.0 | NA | 0.0 |
| P | 0 (0%) | 1 | F-96 | NA | NA | NA | NA | 0 | 8 | 3 or 4 fish/sample | NA | 0.0 | NA | 0.0 |
| NA | NA | NA | NA | 0 | 25 | 3 fish/sample | ||||||||
CEV strains and genotypes identified in this study are summarized. Fish farms that CEV was not detected (75 farms, F-22 to F-96) are not included in this table. NA: ‘not applicable’ (i.e., CEV was not detected in the fish farm). perc.: percentage.
All sequences were retrieved in June 2022. The font colors in the ‘Host’ column indicate the type of carp: black for common carp, red for koi, yellow for mirror carp, and green for carp without information. Font colors in the ‘Genogroup’ column are as follows: black for Genogroup I, red for Genogroup II or IIa, blue for Genogroup IIb, green for Genogroup III or IIIa, and yellow for Genogroup IIIb. A single asterisk (*) indicates CEV strains detected in koi exported from Japan. Double asterisks (**) denote 26 strains from the USA with identical sequences.
CEV was detected in 62.5% (10 out of 16) of the surveyed prefectures and 21.9% (21 out of 96) of fish farms. The PCR-positive rate for CEV was 7.2% (42 out of 585) of the gill samples, and sequencing a portion of the p4a gene identified 24 strains and 12 distinct genotypes (Table 3). All of the obtained sequences were deposited in the GenBank database (Table 3). The 12 genotypes identified in this study exhibited 97.6–100% similarity to each other. Generally, these sequences showed very high similarity to genogroup I (93.4–96.3%) and genogroup II (96.3–100%), with higher similarity to genogroup II. CEV was frequently detected in some of the fish farms, and multiple genotypes were often detected within a single farm (Table 3, Fig. 1). For example, three genotypes, GT-1, GT-3, and GT-6, were detected in fish farm F-1, with sequence similarities ranging from 98.4 to 100% (Table 3). Interestingly, most of the strains identified in this study were identical or nearly identical to those reported in other countries. For example, all the CEV sequences obtained in this study, except for JP21-314 and JP21-346, were identical to strains from Germany, Austria, France, the United Kingdom, the Czech Republic, the United States, and China. Strain JP21-314 showed 99% similarity to several strains from abroad, including strain 15-048 from France (GenBank accession number; MW854740). Similarly, strain JP21-346 shared 99% sequence similarity with several known strains, including strain P054 from the United Kingdom (GenBank accession number: KX254023).

The phylogenetic analysis revealed that CEV strains from different locations in Japan clustered together (Fig. 1). This trend is particularly evident for sequences classified as GT-6, where strains from five prefectures formed a distinct cluster. Furthermore, all sequences obtained in this study clustered within the genogroup II clade (Fig. 2B).

Nearly all the CEV sequences in the genogroup II clade were detected in koi, with several exceptions, for example, the sequences from Poland (GenBank Accession No. KX253997, KX254003), Austria (MK875985), Germany (KY550437), Hungary (MF418005), and China (MG550021, MG550022, MG550024, MG550025), were identified in common carp (Table 4). In contrast, CEV strains from common carp and mirror carp Cyprinus carpio predominantly clustered within the genogroup I clade (Table 4, Fig. 2A). The strain from the Czech Republic (CZ-13_1845; MN996228) was detected in koi, but was not associated with mortality. In addition to genogroups I and II, a third genogroup, genogroup III, has been proposed (Soliman et al., 2019; Baud et al., 2021). However, the strains that were classified as genogroup III in those studies, such as A-114/17, A-234/17, and 15-166 (GenBank accession numbers MK875986, MK875991, and MW854743), were not grouped into a distinct clade in this study. Similarly, subgroups IIa and IIb of genogroup II did not form distinct clusters.
Overall, CEV was detected in 62.5% of prefectures and 21.9% of aquaculture farms, indicating its widespread distribution throughout Japan. The overall positivity rate for CEV was 7.2% (42 out of 585). This rate appears lower than the overall prevalence suggested earlier (62.5% and 21.9%), which is likely due to sampling bias. Specifically, a disproportionate number of samples were collected from certain fish farms, many of which tested negative for CEV (e.g., F-24 to F-36 and F-43 to F-45 in Prefecture B; Tables 1 and 3). Nevertheless, the observed positivity rate across prefectures and aquaculture farms provides a valuable estimate of the current status and prevalence of CEV infection in Japan. Furthermore, we speculate that the actual positive rate is higher and the distribution of CEV is wider than estimated in this study. This is due to the latent nature of CEV infections, influenced by seasonal changes in water temperature, which makes the detection of CEV more difficult when using nucleic acid amplification-based diagnostic methods (Adamek et al., 2021).
Our sequencing results suggest that the spread of CEV or CEV-infected fish among fish farms is driven by anthropogenic activities, followed by horizontal infection between fish. This hypothesis is supported by two key findings: (1) identical genotypes were detected in multiple individuals from the same fish farm, and (2) identical genotypes were detected in multiple individuals from different fish farms (Table 3, Fig. 1). For example, genotype GT-6 was detected in two samples from fish farm F-1, two samples from fish farm F-7, and seven samples from fish farm F-4 (Table 3). Similar trends were observed for five out of 12 genotypes (i.e., GT-3, GT-6, GT-9, GT-11, and GT-12). The widespread distribution of CEV in Japan may be attributed to the use of saltwater bathing as a treatment (Murakami et al., 1976; Seno et al., 2003; Miyazaki et al., 2005; Stevens et al., 2018). It is speculated that moving saltwater-treated koi that were infected with CEV facilitated horizontal infection, contributing to the broad dissemination of CEV (Table 3, Fig. 1). Other studies have similarly highlighted the risks associated with saltwater bathing (Adamek et al., 2017b). As observed in other viruses, such treatment may promote latent infection, which poses a risk of subsequent viral spread upon reactivation.
This study identified 12 highly diverse genotypes of genogroup II. This finding was unexpected given that Japan is primarily an exporter of koi and not an importer. When a phylogenetic tree was constructed based on the CEV sequences reported from all over the world, all of the CEV sequences obtained in this study clustered within genogroup II and were almost evenly distributed across the major clades in this genogroup (Fig. 2). In addition, some of the genotypes identified in this study were identical to those reported previously in studies conducted abroad. Although the origin of genogroup II remains unknown, these results imply that mutations in the CEV p4a gene occur frequently in Japan.
CEV genogroup II was previously divided into two subclusters: IIa, detected in both Europe and Asia, and IIb, primarily detected in Europe (Adamek et al., 2017a; Matras et al., 2017; Adamek et al., 2018; Soliman et al., 2019). However, our molecular phylogenetic analysis did not reveal such a clear division, and all of the 12 genotypes detected in this study were classified as genotype II without further resolution into subclusters (Fig. 1B). One possible explanation for this discrepancy is the advancement of research on CEV since 2010 (Way et al., 2017). With a significantly larger dataset of CEV p4a gene sequences available in recent years, molecular phylogenetic analyses can now capture the broader diversity within genogroup II, effectively “filling the gap”. Another possible reason is the limitation of distinguishing IIa and IIb using only a 354 bp portion of the p4a gene (Baud et al., 2021). Such short sequences require differentiation based on fewer than 10 substitutions, which can be challenging. Also, PCR errors and poor-quality sequencing data may introduce noise, significantly affecting data interpretation. Consequently, using longer sequences to analyze genogroups of CEV at a higher resolution is considered necessary. Similarly, Soliman et al. (2019) proposed IIIa and IIIb as new subclusters within genogroup III. In their study, genogroup III, comprising IIIa and IIIb, clustered separately from genogroup I and II. However, in this study, all of the IIIa strains reported by Soliman et al. (2019) clustered within genogroup II, while IIIb strains clustered within genogroup I in this study. Our findings are consistent with those of other research groups (Zrnčić et al., 2020; Adamek et al., 2021; Machat et al., 2021). Notably, Zrnčić et al. (2020) suggested the possibility of a technical error regarding genogroup III sequences deposited in the GenBank database, as these sequences were reported in the reverse orientation.
The impacts of CEV on wild common carp populations in Japan remain unclear. All CEV strains detected in koi in this study were classified as genogroup II, which is consistent with previous reports (Zhang et al., 2017; Kim et al., 2018; Ouyang et al., 2018; Kim et al., 2020; Luo et al., 2020; Ouyang et al., 2020; Jeong et al., 2023; Zhou et al., 2024). Common carp are highly susceptible to genogroup I, which has been associated with devastating mass mortality events globally (Lovy et al., 2018; Padhi et al., 2019; Matějíčková et al., 2020; Sauerwald et al., 2020; Toffan et al., 2020; Marsella et al., 2021; Pikula et al., 2021; Kafi et al., 2022). In this study, genogroup I was not detected, suggesting a low risk of mass mortality in wild common carp populations due to the CEV originating from koi fish farms. However, CEV genogroup II, which has been shown to infect both koi and common carp, was detected. Although genogroup II rarely causes mass mortality in common carp (Adamek et al., 2018; Adamek et al., 2017a; Matras et al., 2017; Soliman et al., 2019), it is of interest to evaluate its prevalence in wild populations. Effluent water from koi farms, which may contain infectious CEV particles, is often discharged into natural environments (e.g., lakes and rivers) that common carp inhabit. While genogroup II has been reported to exhibit low pathogenicity in common carp, it remains unclear whether common carp exposed to genogroup II strains in natural settings can become infected with the virus and establish a carrier state. Further investigations are needed to assess the potential risk and implications of CEV transmission in wild populations.
This study was funded by a Grant-in-Aid from the Food Safety and Consumer Affairs Bureau, the Ministry of Agriculture, Forestry, and Fisheries of Japan.