Abstract
A PCR method targeting 16S rDNA was used for detecting the causative agent of bacterial hemolytic jaundice in yellowtail Seriola quinqueradiata. A primer set (forward primer : AGCACTTATGTATAGGTGTA; reverse primer : GTATAAAACGCCAAACATAT) amplified a 387bp product, which was specific for this bacterium. Using yellowtail intraperitoneally injected with this bacterium, the PCR product was observed in templates from blood, liver, kidney and spleen, but not from muscle. Blood specimen was expected to be best for diagnosis of the disease by PCR.
