Microbes and Environments
Online ISSN : 1347-4405
Print ISSN : 1342-6311
ISSN-L : 1342-6311
Regular Papers
The Tomato Wilt Fungus Fusarium oxysporum f. sp. lycopersici shares Common Ancestors with Nonpathogenic F. oxysporum isolated from Wild Tomatoes in the Peruvian Andes
Keigo Inami, Takeshi Kashiwa, Masato Kawabe, Akiko Onokubo-Okabe, Nobuko Ishikawa, Enrique Rodríguez Pérez, Takuo Hozumi, Liliana Aragón Caballero, Fatima Cáceres de Baldarrago, Mauricio Jiménez Roco, Khalid A. Madadi, Tobin L. Peever, Tohru Teraoka, Motoichiro Kodama, Tsutomu Arie
Author information
Keywords: nonpathogenic F. oxysporum, phylogenetic analysis, Solanum, tomato, tomato wilt fungus
JOURNAL FREE ACCESS FULL-TEXT HTML
Supplementary material

2014 Volume 29 Issue 2 Pages 200-210

Browse “Advance online publication” version
Details
Download PDF (919K)
Download citation RIS

(compatible with EndNote, Reference Manager, ProCite, RefWorks)

BIB TEX

(compatible with BibDesk, LaTeX)

Text
How to download citation
Contact us
Abstract

Fusarium oxysporum is an ascomycetous fungus that is well-known as a soilborne plant pathogen. In addition, a large population of nonpathogenic F. oxysporum (NPF) inhabits various environmental niches, including the phytosphere. To obtain an insight into the origin of plant pathogenic F. oxysporum, we focused on the tomato (Solanum lycopersicum) and its pathogenic F. oxysporum f. sp. lycopersici (FOL). We collected F. oxysporum from wild and transition Solanum spp. and modern cultivars of tomato in Chile, Ecuador, Peru, Mexico, Afghanistan, Italy, and Japan, evaluated the fungal isolates for pathogenicity, VCG, mating type, and distribution of SIX genes related to the pathogenicity of FOL, and constructed phylogenies based on ribosomal DNA intergenic spacer sequences. All F. oxysporum isolates sampled were genetically more diverse than FOL. They were not pathogenic to the tomato and did not carry SIX genes. Certain NPF isolates including those from wild Solanum spp. in Peru were grouped in FOL clades, whereas most of the NPF isolates were not. Our results suggested that the population of NPF isolates in FOL clades gave rise to FOL by gaining pathogenicity.

Fusarium oxysporum Schlecht. emend. Snyd. et Hans. is an ascomycetous fungus that inhabits various environments including the phytosphere, which includes both plant tissues and the rhizosphere. Most isolates from asymptomatic plants do not cause disease on any plants, and are referred to as nonpathogenic F. oxysporum (12).

On the other hand, plant pathogenic forms, formae speciales (f. spp.), are recognized in the species, and each form is defined by its strict host specificity (4, 5). F. oxysporum f. sp. lycopersici Snyd. et Hans. (FOL) is a pathogenic form that causes soilborne vascular wilt disease in the tomato (Solanum lycopersicum L.). Moreover, each of the three FOL pathogenic races (1, 2, 5) has been defined based on the possession of different combinations of SIX (secreted in xylem) protein genes, SIX4, SIX3, and SIX1 (16, 17, 41), and determined by their specificities to particular tomato cultivars (2, 13, 53). These SIX genes are recognized to be pathogenic determinants and can be useful tools for race determination (18, 30).

“When, where, and how did plant pathogenic F. oxysporum emerge?” This is a very fundamental, but difficult question to address. Several phylogenetic studies have examined other plant pathogenic fungi using isolates from the places of origin and domestication of plants, for example, rice blast fungus Pyricularia oryzae Cavara [synonym, Magnaporthe oryzae (Hebert) Barr], late blight pathogen Phytophthora infestans (Mont.) de Bary, wheat fungal leaf blotch pathogen Mycosphaerella graminicola (Fückel) Schrot, and corn smut fungus Ustilago maydis (DC.) Corda (8, 14, 33, 48). To date, phylogenetic studies have also been extensively performed on F. oxysporum isolates (9, 12, 21–23, 29, 32, 34). For example, FOL is considered to be polyphyletic because it is composed of isolates involved in three clades (19, 23), and the pathogen of Fusarium wilt of melon (f. sp. melonis) has also been shown to be polyphyletic (12), whereas the cabbage yellows fungus (f. sp. conglutinans) is composed of one cluster and appears to be monophyletic (22). Studies on pathogenic isolates are generally limited, and very little is known about the relationship between pathogenic and nonpathogenic isolates. Therefore, we focused on the co-evolution of the tomato wilt pathogen and tomato.

The tomato (S. lycopersicum) is thought to have originated in South America, which is now occupied by Peru, Chile, Ecuador, and Bolivia. This region continues to sustain wild species of Solanum L. section Lycopersicon (Miller) Wettstein, such as S. cheesmaniae (Riley) Fosberg (syn. Lycopersicon cheesmaniae Riley), S. chilense (Dunal) Reiche (syn. L. chilense Dunal), S. chmielewskii Rick et al. (syn. L. chmielewskii Rick et al.), S. galapagense Darwin et Peralta (syn. L. cheesmaniae Riley), S. habrochaites Knapp et Spooner (syn. L. hirsutum Dunal), S. neorickii Spooner et al. (syn. L. parviflorum Rick et al.), S. pennellii Correll (syn. L. pennellii [Correll] D’Arcy), S. peruvianum L. (syn. L. peruvianum [L.] Miller), and S. pimpinellifolium L. (syn. L. pimpinellifolium [L.] Miller) (39).

A wild Solanum sp., possibly S. pimpinellifolium, spread prehistorically from South America to Central America (Mexico) in which the tomato was domesticated (20). S. lycopersicum var. cerasiforme, an apparent intermediate between wild and cultivated tomatoes (42), is currently found as a natively grown (“silvestre” in Spanish) tomato in some rural areas of Mexico. Traditional tomato cultivars, so-called “jitomate criollo” in Spanish, have been handed down by generations of peasants in mountain villages, and are considered the archetype of modern tomatoes due to their diverse morphologies (20). S. lycopersicum var. cerasiforme and jitomate criollo were designated transition tomatoes in this study. Tomatoes were transported to European countries, such as Italy and Spain, in which modern tomato breeding started, during the Spanish conquest in the 16th century (20, 39, 50).

In the present study, we 1) collected F. oxysporum isolates from tissues and the rhizosphere of asymptomatic Solanum biotypes: wild tomatoes in Chile, Ecuador, and Peru; transition tomatoes in Mexico; and modern tomatoes worldwide, 2) evaluated the pathogenicity of each isolate by an inoculation test using tomato tester cultivars, 3) evaluated the susceptibility of each Solanum biotype to FOL by the inoculation test, 4) determined the mating type and VCG of each isolate, 5) performed phylogenetic analyses based on sequences of the ribosomal DNA intergenic spacer (rDNA-IGS) region of the F. oxysporum isolates, together with FOL and other f. spp. collected worldwide, and 6) detected SIX genes in the F. oxysporum isolates collected. Based on the results obtained, we attempted to determine when, where, and how the plant pathogenic forms of F. oxysporum emerged.

Materials and Methods

Plant tissues and rhizosphere soil samples

We sampled the leaves, flowers, stems, fruits, roots, and rhizosphere soils of asymptomatic Solanum (sect. Lycopersicon) spp. in Chile, Peru, Ecuador, Mexico, Italy, Afghanistan, and Japan between 2002 and 2011 (Table 1). Here, rhizosphere soil refers to soil sampled from an area ca. 5 cm from the plant base and the surface at a depth of ca. 5 cm.

Table 1 Fusarium oxysporum isolated from the tissue and rhizosphere of Solanum spp. (sec. Lycopersicon)
Name Source of fungal isolates Collected site Year Country/latitude/longitude/altitudea Mating type GenBank Accession No.
F. oxysporum from wild species
CC161-4s S. chilense soil 2004 Chile/S18°28′01.8″/W69°49′27.5″/1939 m 1-1 AB373843
CC161-12s S. chilense soil 2004 Chile/S18°28′3.0″/W69°49′45.9″/1939 m 1-1 AB373844
CC361-14s S. chilense soil 2004 Chile/S18°27′16.3″/W69°46′22.1″/2460 m 1-2 AB373845
PC11-751s S. chilense soil 2011 Peru/S16°59′04.0″/W71°46′14.2″/924 m 1-1 AB697899
PC11-7611s S. chilense soil 2011 Peru/S17°09′47.4″/W70°52′21.4″/1653 m 1-2 AB697900
PC11-7612s S. chilense soil 2011 Peru/S17°09′47.4″/W70°52′21.4″/1653 m 1-2 AB697901
PC11-7613s S. chilense soil 2011 Peru/S17°09′47.4″/W70°52′21.4″/1653 m 1-2 AB697902
PC11-7614s S. chilense soil 2011 Peru/S17°09′47.4″/W70°52′21.4″/1653 m 1-1 AB697903
PC11-7723s S. chilense soil 2011 Peru/S17°08′48.1″/W70°51′24.2″/1795 m 1-2 AB697904
PC11-7731s S. chilense soil 2011 Peru/S17°08′48.1″/W70°51′24.2″/1795 m 1-2 AB697905
PC11-7744s S. chilense soil 2011 Peru/S17°08′48.1″/W70°51′24.2″/1795 m 1-2 AB697906
PC11-783s S. chilense soil 2011 Peru/S17°07′32.6″/W70°50′25.9″/1912 m 1-1 AB697907
PC11-791s S. chilense soil 2011 Peru/S17°06′46.8″/W70°50′32.3″/2014 m 1-2 AB697908
PC11-7922s S. chilense soil 2011 Peru/S17°06′46.8″/W70°50′32.3″/2014 m 1-2 AB697909
PC11-7931s S. chilense soil 2011 Peru/S17°06′46.8″/W70°50′32.3″/2014 m 1-1 AB697910
PC11-7933s S. chilense soil 2011 Peru/S17°06′46.8″/W70°50′32.3″/2014 m 1-1 AB697911
PC11-7935s S. chilense soil 2011 Peru/S17°06′46.8″/W70°50′32.3″/2014 m 1-1 AB697912
CP2-2L S. peruvianum stem 2002 Chile/S18°25′02.1″/W70°06′02.9″/436 m 1-1 AB373833
CP2-1G S. peruvianum stem 2002 Chile/S18°24′32.7″/W70°12′20.0″/215 m 1-1 AB373835
CP2-2B S. peruvianum stem 2002 Chile/S18°25′02.1″/W70°06′02.9″/436 m 1-2 AB373836
CP2-2OQ S. peruvianum stem 2002 Chile/S18°25′02.1″/W70°06′02.9″/436 m 1-2 AB373837
CP4-46 S. peruvianum stem 2004 Chile/S18°25′03.6″/W70°06′13.3″/410 m 1-2 AB373846
CP2-1AF S. peruvianum fruit 2002 Chile/S18°24′32.7″/W70°12′20.0″/215 m 1-2 AB373834
CP4-45 S. peruvianum fruit 2004 Chile/S18°25′35.4″/W70°06′19.6″/408 m 1-2 AB373847
CP4-4310s S. peruvianum soil 2004 Chile/S18°24′42.8″/W70°12′43.8″/211 m 1-2 AB373852
CP4-4318s S. peruvianum soil 2004 Chile/S18°24′42.8″/W70°12′43.8″/211 m 1-2 AB373848
CP4-441s S. peruvianum soil 2004 Chile/S18°24′43.9″/W70°12′06.2″/233 m 1-1 AB373855
CP4-4412s S. peruvianum soil 2004 Chile/S18°24′43.9″/W70°12′06.2″/233 m 1-2 AB373849
CP4-4510s S. peruvianum soil 2004 Chile/S18°25′35.4″/W70°06′19.6″/408 m 1-2 AB373857
CP4-4512s S. peruvianum soil 2004 Chile/S18°25′35.4″/W70°06′19.6″/408 m 1-2 AB373850
CP4-4515s S. peruvianum soil 2004 Chile/S18°25′35.4″/W70°06′19.6″/408 m 1-1 AB373856
CP4-453s S. peruvianum soil 2004 Chile/S18°25′35.4″/W70°06′19.6″/408 m 1-1 AB373854
CP4-454s S. peruvianum soil 2004 Chile/S18°25′35.4″/W70°06′19.6″/408 m 1-2 AB373853
CP4-46s S. peruvianum soil 2004 Chile/S18°25′03.6″/W70°06′13.3″/410 m 1-2 AB373851
PP10-2710s S. peruvianum soil 2010 Peru/S11°46′18.7″/W76°18′15.0″/3038 m 1-2 AB627132
PP10-3021s S. peruvianum soil 2010 Peru/S11°48′24.6″/W76°20′27.5″/2595 m 1-1 AB627133
PP10-3026s S. peruvianum soil 2010 Peru/S11°48′24.6″/W76°20′27.5″/2595 m 1-1 AB627134
PP10-314s S. peruvianum soil 2010 Peru/S11°49′07.7″/W76°21′25.1″/2499 m 1-2 AB627135
PP10-316s S. peruvianum soil 2010 Peru/S11°49′07.7″/W76°21′25.1″/2499 m 1-1 AB627136
PP10-326s S. peruvianum soil 2010 Peru/S11°51′23.9″/W76°25′10.0″/2225 m 1-1 AB627137
PP11-672s S. peruvianum soil 2011 Peru/S16°24′57.2″/W71°28′02.5″/2682 m 1-1 AB697913
PP11-692s S. peruvianum soil 2011 Peru/S16°24′33.2″/W71°27′03.1″/2830 m 1-1 AB697914
PP11-704s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-1 AB697915
PP11-705s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-1 AB697916
PP11-7021s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-2 AB697917
PP11-7022s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-1 AB697918
PP11-7024s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-1 AB697919
PP11-7025s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-1 AB697920
PP11-7031s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-1 AB697921
PP11-7033s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-1 AB697922
PP11-7035s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-1 AB697923
PP11-7041s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-2 AB697924
PP11-7042s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-1 AB697925
PP11-7044s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-1 AB697926
PP11-7049s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-2 AB697927
PP11-70411s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-2 AB697928
PP11-70412s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-1 AB697929
PP11-7052s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-1 AB697930
PP11-7053s S. peruvianum soil 2011 Peru/S16°17′41.0″/W71°38′53.2″/2632 m 1-2 AB697931
PP11-712s S. peruvianum soil 2011 Peru/S16°17′44.6″/W71°38′29.0″/2642 m 1-1 AB697932
PP11-831s S. peruvianum soil 2011 Peru/S17°00′161″/W72°03′891″/177 m 1-2 AB697933
PP11-8321s S. peruvianum soil 2011 Peru/S17°00′161″/W72°03′891″/177 m 1-2 AB697934
PP11-8323s S. peruvianum soil 2011 Peru/S17°00′161″/W72°03′891″/177 m 1-1 AB697935
PP11-8328s S. peruvianum soil 2011 Peru/S17°00′161″/W72°03′891″/177 m 1-1 AB697936
PP11-841s S. peruvianum soil 2011 Peru/S16°58′142″/W72°04′003″/378 m 1-1 AB697937
PP11-843s S. peruvianum soil 2011 Peru/S16°58′142″/W72°04′003″/378 m 1-1 AB697938
PP11-8421s S. peruvianum soil 2011 Peru/S16°58′142″/W72°04′003″/378 m 1-2 AB697939
PP11-8422s S. peruvianum soil 2011 Peru/S16°58′142″/W72°04′003″/378 m 1-1 AB697940
PP11-8423s S. peruvianum soil 2011 Peru/S16°58′142″/W72°04′003″/378 m 1-1 AB697941
PP11-84219s S. peruvianum soil 2011 Peru/S16°58′142″/W72°04′003″/378 m 1-1 AB697942
PP11-8431s S. peruvianum soil 2011 Peru/S16°58′142″/W72°04′003″/378 m 1-1 AB697943
PP11-8433s S. peruvianum soil 2011 Peru/S16°58′142″/W72°04′003″/378 m 1-1 AB697944
MP-2 S. peruvianumb leaf 2005 Mexico/N18°38′21.5″/W100°49′23.3″/217 m ntc AB373871
PH11-572s S. habrochaites soil 2011 Peru/S11°19′15.7″/W76°52′19.0″/1269 m 1-2 AB697945
PH11-582s S. habrochaites soil 2011 Peru/S11°19′12.4″/W76°52′17.8″/1265 m 1-1 AB697946
PH11-583s S. habrochaites soil 2011 Peru/S11°19′12.4″/W76°52′17.8″/1265 m 1-2 AB697947
PH11-585s S. habrochaites soil 2011 Peru/S11°19′12.4″/W76°52′17.8″/1265 m 1-1 AB697948
PH11-601s S. habrochaites soil 2011 Peru/S11°21′26.1″/W76°48′49.0″/1953 m 1-1 AB697949
PH11-602s S. habrochaites soil 2011 Peru/S11°21′26.1″/W76°48′49.0″/1953 m 1-2 AB697950
PH11-603s S. habrochaites soil 2011 Peru/S11°21′26.1″/W76°48′49.0″/1953 m 1-1 AB697951
PH11-605s S. habrochaites soil 2011 Peru/S11°21′26.1″/W76°48′49.0″/1953 m 1-2 AB697952
PH11-606s S. habrochaites soil 2011 Peru/S11°21′26.1″/W76°48′49.0″/1953 m 1-2 AB697953
PH11-608s S. habrochaites soil 2011 Peru/S11°21′26.1″/W76°48′49.0″/1953 m 1-2 AB697954
PH11-6021s S. habrochaites soil 2011 Peru/S11°21′26.1″/W76°48′49.0″/1953 m 1-2 AB697955
PH11-6022s S. habrochaites soil 2011 Peru/S11°21′26.1″/W76°48′49.0″/1953 m 1-1 AB697956
PH11-6024s S. habrochaites soil 2011 Peru/S11°21′26.1″/W76°48′49.0″/1953 m 1-2 AB697957
PH11-6025s S. habrochaites soil 2011 Peru/S11°21′26.1″/W76°48′49.0″/1953 m 1-1 AB697958
PH11-6026s S. habrochaites soil 2011 Peru/S11°21′26.1″/W76°48′49.0″/1953 m 1-1 AB697959
PH11-6029s S. habrochaites soil 2011 Peru/S11°21′26.1″/W76°48′49.0″/1953 m 1-1 AB697960
PH11-60210s S. habrochaites soil 2011 Peru/S11°21′26.1″/W76°48′49.0″/1953 m 1-1 AB697961
PH11-60211s S. habrochaites soil 2011 Peru/S11°21′26.1″/W76°48′49.0″/1953 m 1-2 AB697962
PH11-60212s S. habrochaites soil 2011 Peru/S11°21′26.1″/W76°48′49.0″/1953 m 1-2 AB697963
PH11-611s S. habrochaites soil 2011 Peru/S11°21′25.3″/W76°48′50.6″/1963 m 1-1 AB697964
PH11-612s S. habrochaites soil 2011 Peru/S11°21′25.3″/W76°48′50.6″/1963 m 1-2 AB697965
PH11-613s S. habrochaites soil 2011 Peru/S11°21′25.3″/W76°48′50.6″/1963 m 1-1 AB697966
PH11-614s S. habrochaites soil 2011 Peru/S11°21′25.3″/W76°48′50.6″/1963 m 1-1 AB697967
PPn11-721s S. pennellii soil 2011 Peru/S16°01′19.8″/W72°29′17.8″/703 m 1-2 AB697968
PPn11-7321s S. pennellii soil 2011 Peru/S16°01′11.5″/W72°29′14.2″/734 m 1-2 AB697969
PPn11-741s S. pennellii soil 2011 Peru/S16°01′15.8″/W72°29′15.8″/709 m 1-2 AB697970
EPp411-17 S. pimpinellifolium stem 2008 Ecuador/S00°41′27.1″/W90°19′21.9″/189 m 1-1 AB515354
EPp411-16 S. pimpinellifolium root 2008 Ecuador/S00°41′27.1″/W90°19′21.9″/189 m 1-2 AB515353
EPp40-1s S. pimpinellifolium soil 2008 Ecuador/S00°39′03.8″/W90°24′12.9″/432 m 1-1 AB515355
EPp40-2s S. pimpinellifolium soil 2008 Ecuador/S00°39′03.8″/W90°24′12.9″/432 m 1-2 AB515356
EPp40-3s S. pimpinellifolium soil 2008 Ecuador/S00°39′03.8″/W90°24′12.9″/432 m 1-1 AB515357
EPp40-4s S. pimpinellifolium soil 2008 Ecuador/S00°39′03.8″/W90°24′12.9″/432 m 1-2 AB515358
EPp40-5s S. pimpinellifolium soil 2008 Ecuador/S00°39′03.8″/W90°24′12.9″/432 m 1-1 AB515359
EPp411-1rs S. pimpinellifolium soil 2008 Ecuador/S00°41′27.1″/W90°19′21.9″/189 m 1-2 AB515360
EPp411-2rs S. pimpinellifolium soil 2008 Ecuador/S00°41′27.1″/W90°19′21.9″/189 m 1-2 AB515361
EPp411-4rs S. pimpinellifolium soil 2008 Ecuador/S00°41′27.1″/W90°19′21.9″/189 m 1-2 AB515362
EPp411-5rs S. pimpinellifolium soil 2008 Ecuador/S00°41′27.1″/W90°19′21.9″/189 m 1-2 AB515363
EPp411-8rs S. pimpinellifolium soil 2008 Ecuador/S00°41′27.1″/W90°19′21.9″/189 m 1-2 AB515364
EPp411-10rs S. pimpinellifolium soil 2008 Ecuador/S00°41′27.1″/W90°19′21.9″/189 m 1-1 AB515365
EPp411-13rs S. pimpinellifolium soil 2008 Ecuador/S00°41′27.1″/W90°19′21.9″/189 m 1-1 AB515366
EPp411-16s S. pimpinellifolium soil 2008 Ecuador/S00°41′27.1″/W90°19′21.9″/189 m 1-1 AB515367
EPp412s S. pimpinellifolium soil 2008 Ecuador/S00°41′27.1″/W90°19′21.9″/189 m 1-2 AB515368
EPp43-1s S. pimpinellifolium soil 2008 Ecuador/S00°41′23.0″/W90°19′10.3″/208 m 1-2 AB515369
EPp43-2s S. pimpinellifolium soil 2008 Ecuador/S00°41′23.0″/W90°19′10.3″/208 m 1-2 AB515370
EPp43-3s S. pimpinellifolium soil 2008 Ecuador/S00°41′23.0″/W90°19′10.3″/208 m 1-2 AB515371
EPp43-4s S. pimpinellifolium soil 2008 Ecuador/S00°41′23.0″/W90°19′10.3″/208 m 1-1 AB515372
EPp45-1s S. pimpinellifolium soil 2008 Ecuador/S00°40′05.2″/W90°16′08.9″/253 m 1-2 AB515373
EPp45-4s S. pimpinellifolium soil 2008 Ecuador/S00°40′05.2″/W90°16′08.9″/253 m 1-2 AB515374
EPp45-5s S. pimpinellifolium soil 2008 Ecuador/S00°40′05.2″/W90°16′08.9″/253 m 1-2 AB515375
EPp45-7s S. pimpinellifolium soil 2008 Ecuador/S00°40′05.2″/W90°16′08.9″/253 m 1-2 AB515376
PPp10-351s S. pimpinellifolium soil 2010 Peru/S12°05′0.70″/W76°56′32.2″/248 m 1-2 AB627138
PPp10-361s S. pimpinellifolium soil 2010 Peru/S12°04′34.8″/W76°56′31.1/247 m 1-2 AB627139
PPp10-36223s S. pimpinellifolium soil 2010 Peru/S12°04′34.8″/W76°56′31.1/247 m 1-1 AB627140
PPp11-5721s S. pimpinellifolium soil 2011 Peru/S11°19′15.7″/W76°52′19.0″/1269 m 1-2 AB697971
PPp11-801s S. pimpinellifolium soil 2011 Peru/S17°00′40.8″/W72°01′21.2″/139 m 1-1 AB697972
PPp11-802s S. pimpinellifolium soil 2011 Peru/S17°00′40.8″/W72°01′21.2″/139 m 1-1 AB697973
PPp11-8021s S. pimpinellifolium soil 2011 Peru/S17°00′40.8″/W72°01′21.2″/139 m 1-1 AB697974
PPp11-8022s S. pimpinellifolium soil 2011 Peru/S17°00′40.8″/W72°01′21.2″/139 m 1-1 AB697975
PPp11-811s S. pimpinellifolium soil 2011 Peru/S17°00′10.6″/W72°02′20.0″/132 m 1-1 AB697976
PPp11-8121s S. pimpinellifolium soil 2011 Peru/S17°00′10.6″/W72°02′20.0″/132 m 1-1 AB697977
PPp11-821s S. pimpinellifolium soil 2011 Peru/S17°00′20.0″/W72°02′18.7″/130 m 1-1 AB697978
PPp11-8221s S. pimpinellifolium soil 2011 Peru/S17°00′20.0″/W72°02′18.7″/130 m 1-2 AB697979
PPp11-8222s S. pimpinellifolium soil 2011 Peru/S17°00′20.0″/W72°02′18.7″/130 m 1-1 AB697980
F. oxysporum from transition tomatoes
MCE-77 S. lycopersicum var. cerasiforme leaf 2005 Mexico/N20°13′08.6″/W98°39′14.6″/2281 m nt AB373873
MCE-9515s S. lycopersicum var. cerasiforme soil 2005 Mexico/N20°24′21.4″/W89°45′25.2″/40 m 1-1 AB373874
MCE-952s S. lycopersicum var. cerasiforme soil 2005 Mexico/N20°24′21.4″/W89°45′25.2″/40 m 1-2 AB373875
MCE10-C2s S. lycopersicum var. cerasiforme soil 2010 Mexico/N21°00′05.0″/W98°32′10.8″/638 m 1-1 AB627141
MCE10-C3s S. lycopersicum var. cerasiforme soil 2010 Mexico/N21°00′05.0″/W98°32′10.8″/638 m 1-1 AB627142
MCE10-C5s S. lycopersicum var. cerasiforme soil 2010 Mexico/N21°00′05.0″/W98°32′10.8″/638 m 1-1 AB627143
MCE10-E14s S. lycopersicum var. cerasiforme soil 2010 Mexico/N21°00′05.2″/W98°32′16.3″/635 m 1-1 AB627144
MCE10-E19s S. lycopersicum var. cerasiforme soil 2010 Mexico/N21°00′05.2″/W98°32′16.3″/635 m 1-2 AB627145
MCE10-F11s S. lycopersicum var. cerasiforme soil 2010 Mexico/N21°00′05.7″/W98°32′16.6″/655 m 1-1 AB627146
MCE10-F12s S. lycopersicum var. cerasiforme soil 2010 Mexico/N21°00′05.7″/W98°32′16.6″/655 m 1-1 AB627147
MCE10-F16s S. lycopersicum var. cerasiforme soil 2010 Mexico/N21°00′05.7″/W98°32′16.6″/655 m 1-1 AB627148
MCE10-F18s S. lycopersicum var. cerasiforme soil 2010 Mexico/N21°00′05.7″/W98°32′16.6″/655 m 1-1 AB627149
MCE10-J52s S. lycopersicum var. cerasiforme soil 2010 Mexico/N21°03′30.8″/W98°16′33.6″/449 m 1-1 AB627150
MCE10-J58s S. lycopersicum var. cerasiforme soil 2010 Mexico/N21°03′30.8″/W98°16′33.6″/449 m 1-2 AB627151
ME-2m S. lycopersicum (jitomate criollo) fruit 2005 —d 1-1 AB373881
ME-7s S. lycopersicum (jitomate criollo) soil 2005 Mexico/N17°24′22.4″/W92°02′01.0″/400 m 1-2 AB373889
ME-8s S. lycopersicum (jitomate criollo) soil 2005 Mexico/N17°24′22.4″/W92°02′01.0″/400 m 1-2 AB373882
ME-12s S. lycopersicum (jitomate criollo) soil 2005 Mexico/N17°24′22.4″/W92°02′01.0″/400 m 1-1 AB373883
ME-15s S. lycopersicum (jitomate criollo) soil 2005 Mexico/N17°24′22.4″/W92°02′01.0″/400 m 1-1 AB373887
ME-19s S. lycopersicum (jitomate criollo) soil 2005 Mexico/N17°24′22.4″/W92°02′01.0″/400 m 1-2 AB373884
ME-23s S. lycopersicum (jitomate criollo) soil 2005 Mexico/N17°24′22.4″/W92°02′01.0″/400 m 1-1 AB373885
ME-42s S. lycopersicum (jitomate criollo) soil 2005 Mexico/N17°24′22.4″/W92°02′01.0″/400 m 1-1 AB373888
ME-44s S. lycopersicum (jitomate criollo) soil 2005 Mexico/N17°24′22.4″/W92°02′01.0″/400 m 1-1 AB373886
ME9-6713s S. lycopersicum (jitomate criollo) soil 2009 Mexico/N20°03′08.5″/W97°33′13.7″/587 m 1-2 AB591425
ME9-67110s S. lycopersicum (jitomate criollo) soil 2009 Mexico/N20°03′08.5″/W97°33′13.7″/587 m 1-1 AB591426
ME9-67111s S. lycopersicum (jitomate criollo) soil 2009 Mexico/N20°03′08.5″/W97°33′13.7″/587 m 1-2 AB591427
ME9-6721s S. lycopersicum (jitomate criollo) soil 2009 Mexico/N20°03′08.5″/W97°33′13.7″/587 m 1-1 AB591428
ME9-67212s S. lycopersicum (jitomate criollo) soil 2009 Mexico/N20°03′08.5″/W97°33′13.7″/587 m 1-2 AB591429
F. oxysporum from modern tomato cultivars
CE2-8DE S. lycopersicum fruit 2002 Chile/S18°29′29.7″/W70°16′19.5″/97 m 1-2 AB373839
CE2-17 S. lycopersicum fruit 2002 Chile/S18°29′29.7″/W70°16′19.5″/97 m 1-1 AB373840
CE2-5 S. lycopersicum stem 2002 Chile/S18°30′08.3″/W70°13′17.4″/184 m 1-2 AB373838
CE2-18 S. lycopersicum stem 2002 Chile/S18°29′29.7″/W70°16′19.5″/97 m 1-1 AB373841
CE2-19 S. lycopersicum stem 2002 Chile/S18°29′29.7″/W70°16′19.5″/97 m 1-2 AB373842
CE4-12 S. lycopersicum stem 2004 Chile/S18°31′32.8″/W70°13′03.8″/213 m 1-2 AB373860
CE4-15 S. lycopersicum stem 2004 Chile/S18°31′32.8″/W70°13′03.8″/213 m 1-1 AB373861
CE4-16 S. lycopersicum stem 2004 Chile/S18°31′32.8″/W70°13′03.8″/213 m 1-2 AB373863
CE4-19 S. lycopersicum stem 2004 Chile/S18°31′32.8″/W70°13′03.8″/213 m 1-2 AB373859
CE4-392 S. lycopersicum stem 2004 Chile/S18°31′32.8″/W70°13′03.8″/213 m 1-1 AB373858
CE4-398s S. lycopersicum soil 2004 Chile/S18°31′32.8″/W70°13′03.8″/213 m 1-1 AB373866
CE4-3912s S. lycopersicum soil 2004 Chile/S18°31′32.8″/W70°13′03.8″/213 m 1-2 AB373867
CE4-3916s S. lycopersicum soil 2004 Chile/S18°31′32.8″/W70°13′03.8″/213 m 1-1 AB373868
CE4-3917s S. lycopersicum soil 2004 Chile/S18°31′32.8″/W70°13′03.8″/213 m 1-2 AB373864
CE4-3924s S. lycopersicum soil 2004 Chile/S18°31′32.8″/W70°13′03.8″/213 m 1-2 AB373870
CE4-3927s S. lycopersicum soil 2004 Chile/S18°31′32.8″/W70°13′03.8″/213 m 1-1 AB373865
ME-51 S. lycopersicum leaf 2005 Mexico/N19°49′10.4″/W97°48′34.1″/1753m 1-2 AB373876
ME-54 S. lycopersicum leaf 2005 Mexico/N19°49′10.4″/W97°48′34.1″/1753m nt AB373877
ME-53 S. lycopersicum root 2005 Mexico/N19°49′10.4″/W97°48′34.1″/1753m nt AB373879
ME-55 S. lycopersicum root 2005 Mexico/N18°47′13.9″/W99°10′29.7″/1184m nt AB373880
AMEs S. lycopersicum soil 2007 Afghanistan/N34°31′10.0″/E69°12′10.7″/1814 m 1-2 AB373936
ASEs S. lycopersicum soil 2007 Afghanistan/N34°49′26.7″/E69°15′05.6″/1591 m 1-2 AB373937
AGEs S. lycopersicum soil 2007 Afghanistan/N33°35′27.5″/E69°14′08.0″/2306 m 1-2 AB515352
ItE-1 S. lycopersicum leaf 2007 Italy/N40°49′01.9″/E14°21′25.2″/148 m 1-2 AB373918
ItE-2s S. lycopersicum soil 2007 Italy/N40°49′04.9″/E14°22′18.1″/238 m 1-2 AB373919
ItE-3s S. lycopersicum soil 2007 Italy/N40°49′04.9″/E14°22′18.1″/238 m 1-2 AB373920
ItE-4s S. lycopersicum soil 2007 Italy/N40°49′04.9″/E14°22′18.1″/238 m 1-2 AB373922
ItE-5s S. lycopersicum soil 2007 Italy/N40°49′01.9″/E14°21′25.2″/148 m 1-1 AB373923
ItE-6s S. lycopersicum soil 2007 Italy/N40°49′01.9″/E14°21′25.2″/148 m 1-2 AB373924
ItE-8s S. lycopersicum soil 2007 Italy/N40°49′01.9″/E14°21′25.2″/148 m 1-1 AB373926
ItE-10s S. lycopersicum soil 2007 Italy/N40°49′01.9″/E14°21′25.2″/148 m 1-2 AB373927
ItE-11s S. lycopersicum soil 2007 Italy/N40°49′04.9″/E14°22′18.1″/238 m 1-2 AB373928
ItE-12s S. lycopersicum soil 2007 Italy/N40°49′01.9″/E14°21′25.2″/148 m 1-1 AB373929
ItE-14s S. lycopersicum soil 2007 Italy/N40°49′01.9″/E14°21′25.2″/148 m 1-2 AB373930
ItE-15s S. lycopersicum soil 2007 Italy/N40°49′01.9″/E14°21′25.2″/148 m 1-1 AB373921
ItE-16s S. lycopersicum soil 2007 Italy/N40°49′04.9″/E14°22′18.1″/238 m 1-2 AB373925
ItE-19s S. lycopersicum soil 2007 Italy/N40°49′01.9″/E14°21′25.2″/148 m 1-1 AB373931
ItE-21s S. lycopersicum soil 2007 Italy/N40°49′01.9″/E14°21′25.2″/148 m 1-2 AB373932
ItE-23s S. lycopersicum soil 2007 Italy/N40°49′01.9″/E14°21′25.2″/148 m 1-2 AB373933
ItE-29s S. lycopersicum soil 2007 Italy/N40°49′01.9″/E14°21′25.2″/148 m 1-2 AB373934
ItE-31s S. lycopersicum soil 2007 Italy/N40°49′04.9″/E14°22′18.1″/238 m 1-1 AB373935
JKE-15 S. lycopersicum flower 2007 Japan/N32°52′06.1″/E130°33′12.3″/0 m 1-1 AB373894
JKE-1 S. lycopersicum root 2007 Japan/N32°52′06.1″/E130°33′12.3″/0 m 1-1 AB373890
JKE-3 S. lycopersicum root 2007 Japan/N32°52′06.1″/E130°33′12.3″/0 m 1-2 AB373891
JKE-5 S. lycopersicum root 2007 Japan/N32°52′06.1″/E130°33′12.3″/0 m 1-2 AB373892
JKE-6 S. lycopersicum root 2007 Japan/N32°52′06.1″/E130°33′12.3″/0 m 1-1 AB373893
JKE-11s S. lycopersicum soil 2007 Japan/N32°52′06.1″/E130°33′12.3″/0 m 1-2 AB373895
JKE-26s S. lycopersicum soil 2007 Japan/N32°52′06.1″/E130°33′12.3″/0 m 1-2 AB373896
JKE-27s S. lycopersicum soil 2007 Japan/N32°52′06.1″/E130°33′12.3″/0 m 1-1 AB373897
JKE-28s S. lycopersicum soil 2007 Japan/N32°52′06.1″/E130°33′12.3″/0 m 1-2 AB373899
JKE-29s S. lycopersicum soil 2007 Japan/N32°52′06.1″/E130°33′12.3″/0 m 1-2 AB373898
JKE-31s S. lycopersicum soil 2007 Japan/N32°52′06.1″/E130°33′12.3″/0 m 1-1 AB373900
JKE-34s S. lycopersicum soil 2007 Japan/N32°52′06.1″/E130°33′12.3″/0 m 1-2 AB373901
JIE-1s S. lycopersicum soil 2007 Japan/N36°21′19.0″/E136°22′15.4″/23 m 1-1 AB373902
JIE-2s S. lycopersicum soil 2007 Japan/N36°21′19.0″/E136°22′15.4″/23 m 1-1 AB373903
JIE-4s S. lycopersicum soil 2007 Japan/N36°21′19.0″/E136°22′15.4″/23 m 1-2 AB373905
JIE-7s S. lycopersicum soil 2007 Japan/N36°21′19.0″/E136°22′15.4″/23 m 1-2 AB373904
JIE-13s S. lycopersicum soil 2007 Japan/N36°21′19.0″/E136°22′15.4″/23 m 1-2 AB373906
JIE-15s S. lycopersicum soil 2007 Japan/N36°21′19.0″/E136°22′15.4″/23 m 1-1 AB373907
JIE-16s S. lycopersicum soil 2007 Japan/N36°21′19.0″/E136°22′15.4″/23 m 1-2 AB373908
JIE-17s S. lycopersicum soil 2007 Japan/N36°21′19.0″/E136°22′15.4″/23 m 1-2 AB373909
JIE-18s S. lycopersicum soil 2007 Japan/N36°21′19.0″/E136°22′15.4″/23 m 1-2 AB373910
JIE-19s S. lycopersicum soil 2007 Japan/N36°21′19.0″/E136°22′15.4″/23 m 1-2 AB373911
JIE-20s S. lycopersicum soil 2007 Japan/N36°21′19.0″/E136°22′15.4″/23 m 1-1 AB373912
JTE-1s S. lycopersicum soil 2007 Japan/N35°41′05.8″/E139°29′13.6″/62 m 1-1 AB373913
JTE-2s S. lycopersicum soil 2007 Japan/N35°41′05.8″/E139°29′13.6″/62 m 1-2 AB373914
JTE-3s S. lycopersicum soil 2007 Japan/N35°41′05.8″/E139°29′13.6″/62 m 1-1 AB373915
JTE-4s S. lycopersicum soil 2007 Japan/N35°41′05.8″/E139°29′13.6″/62 m 1-2 AB373916
JTE-5s S. lycopersicum soil 2007 Japan/N35°41′05.8″/E139°29′13.6″/62 m 1-1 AB373917
a  N: North, S: South, W: West, E: East, lat/long is shown as dd°mm′ss.s″. (d: degree, m: minute, s: second).

b  S. peruvianum in Mexico was cultivated for experimental purpose.

c  Not tested.

d  ME-2m was isolated from a jitomate criollo fruit sold in a Mexican market, latitude/longitude/altitude were not measured.

Isolation of F. oxysporum from plant tissues and rhizosphere soil

Fungal isolations were prepared within 10 d of collecting the Solanum tissues. Small pieces (ca. ≤ 9 mm2) from individual tissue samples were cut and placed on Fusarium-selective media (25, 35) and potato sucrose agar (PSA) medium in a Petri dish, and incubated at 28°C in the dark.

Fungal isolations from the rhizosphere were prepared by the soil-plate method (54) using Fusarium-selective media. Briefly, approximately 0.5 g of a soil sample was dispersed in 15 mL molten medium in a Petri dish and then incubated at 28°C under dark.

Fungal colonies that emerged after the 2–4-d incubation were transferred onto fresh medium and purified by repeated single hyphal tip isolation. Each established isolate was maintained on a PSA plate at 28°C, and isolates identified as F. oxysporum based on morphological characteristics (28) were subjected to further studies. All the isolates were stored in 25% glycerol solution at −150°C.

Inoculation test

The pathogenicity of each F. oxysporum isolate was evaluated using tomato tester cultivars. To prepare the inoculum, each isolate was cultured for 5 d on 3 mL potato dextrose broth (PDB; Becton and Dickinson, MA, USA) in a 15-mL screw cap test-tube at 25°C on a reciprocal shaker (Taitec, Saitama, Japan) at 200 strokes min−1. Budding cells were collected by centrifugation (3000×g, 15 min) and adjusted to ≥1.0×107 cells mL−1. FOL MAFF 305121 (race 1), JCM 12575 (race 2), and Chz1-A (race 3) were used as positive controls in this assay.

Three tomato standard tester cvs. Ponderosa (i i2 i3, susceptible to all FOL races; Takayama Seed, Kyoto, Japan), Momotaro (I i2 i3, resistant to race 1 and susceptible to races 2 and 3; Takii seeds, Kyoto, Japan), and Walter (I I2 i3, resistant to races 1 and 2 and susceptible to race 3; gift from the National Institute of Vegetable and Tea Science, Mie, Japan) were used (3). Two seeds were sown for each test in sterilized soil (andosol) in a plastic pot (7 cm in diameter) and were grown in a greenhouse at 28°C.

Prior to the inoculation, the roots of 2–3-week-old plants were injured by repeatedly inserting a plastic peg into the soil. The inoculum (2 mL pot−1) was poured on the soil surface and allowed to soak into the rhizosphere. After a month, the external symptoms of each plant were evaluated as follows: 0, no wilt or yellowing; 1, lower leaves yellowing; 2, lower and upper leaves yellowing; 3, lower leaves yellowing and wilting, and upper leaves yellowing; 4, all leaves wilting and yellowing, or dead.

Susceptibility of collected wild and transitional Solanum spp. to FOL

A part of the Solanum spp. germ collection was used to evaluate susceptibility to FOL MAFF 305121 (race 1), JCM 12575 (race 2) and Chz1-A (race 3); S. chilense Lc0036 (Chile/S18°27′16.3″/W69°46′22.1″/altitude, 2460 m), S. peruvianum Lp0043-1 (Chile/S18°24′42.8″/W70°12′43.8″/altitude, 211 m), S. peruvianum Lp0044 (Chile/S18°24′43.9″/W70°12′06.2″/altitude, 233 m), S. peruvianum Lp0046 (Chile/S18°25′03.6″/W70°06′13.3″/altitude, 410 m), S. pimpinellifolium Lpp0040 (Ecuador/S00°39′03.8″/W90° 24′12.9″/altitude, 432 m), S. pimpinellifolium Lpp0041w1 (Ecuador/S00°41′27.1″/W90°19′21.9″/altitude, 189 m), S. pimpinellifolium Lpp0043 (Ecuador/S00°41′23.0″/W90°19′10.3″/altitude, 208 m), S. pimpinellifolium Lpp0045 (Ecuador/S00°40′05.2″/W90°16′08.9″/altitude, 253 m), S. lycopersicum var. cerasiforme Lec0001 (Mexico/N20°24′21.4″/W89°45′25.2″/altitude, 40 m), S. lycopersicum (jitomate criollo) Lecr0001 (Mexico/N17°24′22.4″/W92°02′01.0″/altitude, 400 m). Each of these plants was prepared as described above, and the inoculation with FOL races 1–3 was performed after the third leaf appeared. After a month, the inner symptoms of each plant were evaluated as follows: 0, no vascular browning; 1, browning in 1–25% of vascular; 2, browning in 26–50% of vascular; 3, browning in 51–75% of vascular; 4, browning in 75–100% of vascular.

Fungal DNA extraction

Genomic DNA (gDNA) was extracted from fungal mycelia following a protocol modified from the original method (45). Briefly, a small amount of mycelia on PSA medium (≤25 mm2) was placed in 500 μL lysis buffer (50 mM EDTA, 200 mM NaCl, 1% n-lauroylsarcosine sodium salt, 200 mM Tris-HCl pH 8.0) in a microtube, incubated for 10 min at room temperature, centrifuged at 20,000×g for 5 min at 4°C after the addition of 150 μL of 3 M potassium acetate. The supernatant was then transferred to a fresh microtube. gDNA in the supernatant was concentrated by ethanol precipitation and resuspended in TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA).

Polymerase chain reaction (PCR)

A standard reaction mixture (20 μL) contained 20 ng gDNA, 2 μL 10×buffer (Takara Bio, Otsu, Japan), 1.6 μL of 2.5 mM (each) dNTPs (Takara Bio), 8 pM of each primer, and 0.5 U of Ex-Taq polymerase (Takara Bio) or 5 μL of GoTaq® Master Mix (Promega, Madison, WI, USA). The primers used in this study are listed in Table 2.

Table 2 Nucleotide primers used in this study
Name Sequence (5′-3′) Targeting gene/region Thermal conditions Amplicon sizea Reference
FIGS11 GTAAGCCGTCCTTCGCCTCG ribsomal DNA IGS region 94°C 2 min; 30 × (94°C 1 min, 60°C 30 s, 72°C 1 min); 72°C 6 min 600 bp (22)
FIGS12 GCAAAATTCAATAGTATGGC ribsomal DNA IGS region (22)
Gfmat1a GCAAAATTCAATAGTATGGC MAT1-1-1 alpha-box (MAT1-1) 94°C 2 min; 30 × (94°C 30 s, 58°C 30 s, 72°C 45 s); 72°C 6 min 280 bp (19)
Gfmat1b TAAGCGCCCTCTTAACGCCTTC MAT1-1-1 alpha-box (MAT1-1) (19)
GfHMG11 TACCGTAAGGAGCGTCAC MAT1-2-1 HMG-box (MAT1-2) 220 bp (19)
GfHMG12 GTACTGTCGGCGATGTTC MAT1-2-1 HMG-box (MAT1-2) (19)
P12-F2 GTATCCTCCGGATTTTGAGC SIX1 (AVR3) 94°C 2 min; 32 x (94°C 30 s, 58°C 45 s, 72°C 2 min); 72°C 7 min 840 bp (41)
P12-R1 AATAGAGCCTGCAAAGCATG SIX1 (AVR3) (51)
SIX3-F1 CCAGCCAGAAGGCCAGTTT SIX3 (AVR2) 570 bp (51)
SIX3-R2 GGCAATTAACCACTCTGCC SIX3 (AVR2) (51)
SIX4F ACTCGTTGTTATTGCTTCGG SIX4 (AVR1) 800 bp (19)
SIX4R CGGAGTGAAGAAGAAGCTAA SIX4 (AVR1) (19)
a  Approximate size is shown.

To identify F. oxysporum and perform a phylogenetic analysis, a part of the rDNA-IGS region (ca. 600 bp) was amplified using the primer set FIGS11/FIGS12 (22). The mating type (MAT1-1 or MAT1-2) of each isolate was determined using primer sets Gfmat1a/Gfmat1b and GfHMG1/GfHMG2 (19). The presence of SIX4, SIX3 and SIX1 genes in each isolate was determined using the primer sets SIX4F/SIX4R, SIX3-F2/SIX3-R1, and P12-F2/P12-R1, respectively (Table 2).

DNA sequencing

The IGS amplicons of rDNA-IGS from F. oxysporum were purified with EXOSAP-IT (USB, Cleveland, OH, USA) and sequenced with a 3130xl Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) using the BigDye® Terminator v1.1/v3.1 Cycle Sequencing kit (Applied Biosystems) and the primer set FIGS11/FIGS12 (22). Sequences were deposited in GenBank (http://www.ncbi.nlm.nih.gov/Database/), where they were assigned accession numbers (Table 1).

Phylogenetic analyses

Nucleotide sequences were arranged with GENETYX-MAC ver.10.1/13 (Genetyx, Tokyo, Japan) and aligned with the sequences of other Fusarium isolates (Table 3) using CLUSTALX v.2.0 (26). All gaps in the alignment were ignored in subsequent analyses.

Table 3 Previously described fungal strains used in this study
Fungal strain Host planta Sourceb Strain No. Origin Mating type GenBank Accession No.c
Fusarium oxysporum
f. sp. lycopersici Solanum lycopersicum
 race 1 MAFF 103036 Japan 1-1 AB106020
NBRC 6531 Japan 1-1 AB106018
H. C. Kistler OSU-451B USA 1-1 AB106026
NRRL 26034 Italy 1-1 AB106025
M. Bon CT-1 France 1-1 AB120970
MAFF 103038 Japan 1-1 AB106031
 race 2 MAFF 103043 Japan 1-1 AB106032
JCM 12575 Japan 1-1 AB106027
Y. Hirano Saitama-ly2 Japan 1-1 AB373817 *
H. C. Kistler MN-66 USA 1-1 AB106036
A. D. Pietro 4287 Spain 1-1 AB120973
R. Allende mx-20 Mexico 1-1 AB373818 *
 race 3 Y. Hosobuchi F-1-1 Japan 1-2 AB106037
Y. Hosobuchi H-1-4 Japan 1-2 AB106038
T. Arie tomino1-c Japan 1-2 AB106044
C. Yoshioka Chz1-A Japan 1-2 AB373819 *
H. C. Kistler DA-1/7 USA 1-2 AB106047
E. Vivoda F240 USA 1-1 AB120976
R. Allende mx-4 Mexico 1-1 AB373820 *
f. sp. radicis-lycopersici Solanum lycopersicum MAFF 103047 Japan 1-2 AB106059
Y. Hirano Saitama-rly Japan 1-2 AB373821 *
Y. Hirano Saitama-rly2 Japan 1-2 AB373822 *
A. Vermunt NetRL The Netherlands 1-1 AB373823 *
This study CE-391s Chile 1-1 AB373869 *
f. sp. melonis Cucumis melo NRRL 26406 USA 1-2 AB106056
f. sp. batatas Ipomoea batatas MAFF 103070 Japan 1-2 AB106049
f. sp. spinaciae Spinacia oleracea T. Arie 880803e-2 Japan 1-2 AB373824
f. sp. lactucae Lactuca sativa T. Arie SB1-1 Japan 1-2 AB373825 *
f. sp. asparagi Asparagus officinalis F. Kodama FokF233 Japan 1-2 AB373827 *
f. sp. conglutinans Brassica oleracea var. capitata T. Yoshida Cong: 1-1 Japan 1-1 AB106051
f. sp. niveum Citrullus lanatus MAFF 305608 Japan 1-2 AB106057
f. sp. cucumerinum Cucumis sativus T. Arie Rif-1 Japan 1-1 AB106052
f. sp. melongenae Solanum melongena MAFF 103051 Japan 1-1 AB106055
f. sp. apii Cryptotaenia japonica SUF 1017 Japan 1-2 AB106048
f. sp. matthioli Matthiola incana T. Arie 880116a Japan 1-1 AB106054
f. sp. glycines Glycine max T. Arie 851209m Japan 1-1 AB373826 *
f. sp. fragariae Fragaria spp. T. Arie 851209e Japan 1-1 AB106053
nonpathogenic Y. Amemiya Fo304 Japan 1-1 AB373828 *
K. Watanabe 101-2 Japan 1-1 AB373829 *
S. Suwa F4 Japan 1-1 AB373830 *
K. Watanabe 9901 Japan 1-1 AB373831 *
A. Vermunt MDI31216059 The Netherlands 1-1 AB373832 *
Fusarium sacchari Saccharum officinarum FGSC 7610 USA 1-2 GU170582
a  Each host plant corresponds to formae specialis (f. sp.)

b  MAFF, Microorganisms Section of the Gene Bank in the Ministry of Agriculture, Forestry and Fisheries of Japanese Government (Tsukuba, Ibaraki, Japan); NRRL, Agriculture Research Service Culture Collection of United State Department of Agriculture (Peolia, IL, USA); SUF, Culture Collection of Fusarium in Shinshu University (Ueda, Nagano, Japan); FGSC, Fungal Genetics Stock Center (University of Kansas Medical Center, Kansas city, KS, USA); CBS, Centraalbureau voor Schimmelcultures (Baarn, The Netherlands); NBRC, NITE (National Institute of Technology and Evaluation) Biological Resource Center (Kazusakamatari, Chiba, Japan); JCM, Japan Collection of Microorganisms (Tsukuba, Ibaraki, Japan)

c  Asterisks show the sequence data registrated in this study.

F. oxysporum phylogenies were estimated using three methods including maximum likelihood (ML) (10), maximum parsimony (MP) (11), and Bayesian inference (BI) (55). All of the following F. oxysporum phylogenies were rooted with F. sacchari strain FGSC 7610 (Table 3) as the outgroup.

ML phylogenies were estimated using RAxML implemented in raxmlGUI 1.0 (46). MrModeltest v2.3 (36) determined the appropriate substitution model as the HKY+G model from the model of the hierarchical likelihood ratio test (hLRT). Although the HKY+G model was not implemented in raxmlGUI, the HKY+G model was displaceable by the GTR model (A. Stamatakis, pers. comm.); therefore, the analysis was performed with the GTRGAMMA model and rapid bootstrap option (47) with 1,000 bootstrap replicates.

In the MP analysis using PAUP* 4.0b10 (49), searches of trees included 1,000 random additions, heuristic replicates with tree bisection, and reconnection (TBR) branch-swapping. One thousand bootstrap replicates were performed with the heuristic search option.

BI phylogenies were estimated using MrBayes 3.1.2 (43) based on the HKY+G model. In the BI analysis, the Markov Chain Monte Carlo (MCMC) iterations with four chains were started from a random tree topology and lasted 500,000,000 generations. When the average standard deviation of the split frequencies was below 0.01, the MCMC iterations were stopped automatically. Trees were saved at each 100-generation interval, and 12,500 trees were discarded as burn-in. Finally, the posterior probabilities of each branch were calculated.

Vegetative compatibility group (VCG) typing

VCG reflects genetic variations among fungal isolates (40). Four VCGs (0030+0032, 0031, 0033 and 0035) have been reported previously in FOL (6), and these have correlated with phylogeny (23, 32). The following FOL tester isolates: OSU-451B (VCG 0031), MN-66 (VCG 0030+0032), and H-1-4 (VCG 0033) were used to determine the VCG of each isolate. The basis of the VCG test was as follows; by a selection on MMC (minimal agar medium with 1.5% chlorate), a mutation (at either nit1 or NitM) causing nitrate nonutilization was introduced into each collected isolate to be tested and into each of the three tester strains. The mutation in each tester was assessed using hypoxanthine medium (0.2 g L−1 of hypoxanthine plus minimal agar medium without NaNO3; nit1 +, NitM −) and nitrite medium (0.5 g L−1 of NaNO2 plus minimal agar medium without NaNO3; nit1 +, NitM +). To assess VCGs, a part of the collected isolates was paired on MM (minimal medium) with nit-complementary testers; nit-complementary testers were paired with each other as positive controls. Vigorous growth on MM reflected heterokaryon formation, which indicating that the paired isolates belonged to the same VCG of the tester (7).

Results

Sampling of Solanum spp. and isolation of fungi from plant tissue and rhizosphere soil

Among the wild tomatoes, S. chilense was sampled in Chile and Peru, S. habrochaites was sampled in Peru, S. pennellii was sampled in Peru, S. peruvianum was sampled in Chile and Peru, and S. pimpinellifolium was sampled in Peru and Ecuador. Transition tomatoes were sampled in Mexico. The Mexican transition tomatoes were morphologically diverse; the colors of mature fruits were red, orange, or yellow. In addition, jitomate criollo fruits had irregular multiloculated shapes and were heterogeneous in size (Fig. S1i, j). Modern tomatoes cultivated in farmlands were sampled in Chile, Mexico, Italy, Afghanistan, and Japan. None of the plants exhibited wilt symptoms at the time of collection. The precise locations (latitude, longitude, and altitude) of each collection field and plant sample are presented in Table 1 and Fig. S1a–j.

Approximately 2,500 fungal isolates were obtained from the plant and rhizosphere soil samples. Based on the morphological characteristics and nucleotide sequences of IGS regions, 433 of these isolates were identified as F. oxysporum; 42 were from plant tissues and 391 were from rhizosphere soils. F. oxysporum was not isolated from the tissues of S. chilense. A multitude of other fungi were also recovered from plant tissues and rhizosphere soils, e.g. mitosporic ascomycetes such as Fusarium spp., Trichoderma spp., Penicillium spp., Cladosporium spp., Alternaria spp., and Phoma spp., and zygomycetes such as Mucor spp.

F. oxysporum pathogenicity assay

None of the 433 F. oxysporum isolates, except for CE-391s, caused wilt disease when inoculated on the three tomato tester cultivars. We designated the F. oxysporum isolates that did not cause wilt on the tomato as NPF in this study (Table 1). CE4-391s was isolated from the rhizosphere soil of a modern tomato cultivar in a Chilean tomato farmland, and caused crown and root rot symptoms (27) on all three tester cultivars (Table 3). The IGS sequence of CE4-391s was identical to that of F. oxysporum Schlecht. f. sp. radicis-lycopersici Jarvis et Shoem. (FORL) strain Saitamarly (Fig. 1, Table 3), a known crown and root rot pathogen of the tomato. These results, along with the finding that CE4-391s lacked SIX genes that are unique to FOL (52), led us to conclude that CE4-391s was neither NPF nor FOL, but rather FORL.

Fig. 1

Maximum likelihood (ML) tree based on the intergenic spacer (IGS) region of Fusarium oxysporum isolates estimated using raxmlGUI 1.0 (46). F. sacchari strain FGSC 7610 was used as the outgroup. Bootstrap values (1,000 bootstrapped datasets) calculated in the ML analysis as greater than 60% are shown beside the branches. The FOL clusters A1, A2, and A3 (shown in black bars) are identical to those reported in a previous study (23), and bootstrap values in maximum likelihood (ML)/maximum parsimony (MP) analyses and posterior probability values in BI analysis are shown on the three clades only. FOL isolates and their clades are shown in bold characters with their race in parentheses. Filled circles show MAT1-2 isolates.

Phylogenetic analyses

Among the 432 NPFs identified, several isolates from the same sample and carrying identical rDNA-IGS sequences, were considered clonal, and one of them was used as their representative for phylogenetic studies. Therefore, phylogenetic trees were estimated using 233 NPFs (Table 1), together with 18 FOL isolates, 18 isolates of other formae speciales, and 5 NPFs isolated in previous studies (Table 3).

Maximum likelihood (ML), maximum parsimony (MP), and Bayesian inference (BI) methods were used to construct phylogenetic trees, and the ML tree was shown in Fig. 1. The topology of the ML tree was nearly identical to those of the MP and BI trees (data not shown). Each branch was statistically estimated by a bootstrap (BS) test in ML and MP analyses, and posterior probability (PP) in BI analysis. The parameter of the ML tree (−ln L = 3419.861497) was as follows; base frequencies = (A = 0.159040, C = 0.175477, G = 0.363070, T = 0.302413). MP analysis yielded 1,000 equally parsimonious trees (tree length = 413 steps; consistency index = 0.741; retention index = 0.929; rescaled consistency index = 0.688; homoplasy index = 0.259).

In the ML tree, FOL isolates were found in three clades (A1, A2, and A3; indicated in black bars in Fig. 1). This was also the case for MP and BI trees (data not shown). These results were consistent with the findings of previous studies (23, 38), in which FOL was shown to be polyphyletic. In these FOL clades, not only FOL isolates, but also 16 NPF isolates (8 for the A1 clade, 3 for the A2 clade, and 5 for the A3 clade) were grouped. Within each clade, the IGS sequences of NPF were 99.8 to 100% identical to those of FOL.

The A2 clade was supported (BS; ML = 89%, MP = 86%: PP; BI = 1.00), in which three NPF isolates, PP11-7035s (from the rhizosphere of S. peruvianum, Peru), PH11-572s (from the rhizosphere of S. habrochaites, Peru), and MCE-9515s (from the rhizosphere of S. lycopersicum var. cerasiforme, Mexico), were grouped together with FOL (F240, NRRL 26034, MN-66, MAFF 103036, mx-20, mx-4, CT-1, and 4287) and also FORL isolates. The A3 clade was supported well (BS; ML = 95%, MP = 95%: PP; BI = 1.00), in which five NPF isolates, ME-44s (from the rhizosphere of jitomate criollo, Mexico), CE4-3916s (from the rhizosphere of S. lycopersicum, Chile), MCE10-E14s (from the rhizosphere of S. lycopersicum var. cerasiforme, Mexico), MCE10-F11s (from the rhizosphere of S. lycopersicum var. cerasiforme, Mexico), and MCE10-F12s (from the rhizosphere of S. lycopersicum var. cerasiforme, Mexico), were grouped with FOL isolates (DA-1/7, Chz1-A, tomato1-c and F-1-1). The A1 clade included eight NPF isolates, PH11-613s (from the rhizosphere of S. habrochaites, Peru), PP11-8328s (from the rhizosphere of S. peruvianum, Peru), PP11-8422s (from the rhizosphere of S. peruvianum, Peru), PPp11-802s (from the rhizosphere of S. pimpinellifolium, Peru), ME-2m (from S. lycopersicum jitomate criollo fruit, Mexico), Fo304 (from the rhizosphere of S. lycopersicum, Japan), JTE-3s (from the rhizosphere of S. lycopersicum, Japan), and ItE-2s (from the rhizosphere of S. lycopersicum, Italy), together with FOL isolates (OSU-451B, NBRC 6531, MAFF 103043, JCM 12575, Saitama-ly2, and MAFF 103038). This A1 clade was less supported (BS; ML = 77, MP = 62: PP; BI = 0.95) than the A2 and A3 clades. However, the A1 clade was reproducible in ML, MP, and BI phylogenies, which indicated that the isolates in the A1 clade as well as those in the A2 and A3 clades were monophyletic.

These 16 NPF isolates in the FOL clades were obtained from Peruvian wild species of tomatoes, Mexican transitional tomatoes and modern tomato cultivars worldwide, while none of the NPF isolates were obtained from wild species in Chile and Ecuador.

Mating type and VCG determination

Among the 432 NPFs, 184 and 243 isolates were MAT1-1 and MAT1-2, respectively (5 isolates were not tested). Homothallic (MAT1-1 + MAT1-2) isolates were not detected.

We tested vegetative compatibility between FOL and the subset of 16 NPF isolates from our fungal collection that fell into the three FOL clades (Fig. 1). Although each of the NPFs was paired with the VCG 0031, 0030+0032, and 0033 tester strains, none were compatible.

Tests for SIX genes

PCR analyses indicated that the 16 NPF isolates that grouped into the FOL clades did not carry SIX1, SIX3, or SIX4. These genes were readily amplified from the authentic FOL strains.

Solanum spp. susceptibility assay

The Mexican transition tomatoes, S. lycopersicum var. cerasiforme and S. lycopersicum (jitomate criollo), showed an almost equivalent degree of susceptibility to that of cv. Ponderosa (a modern tomato cultivar carrying no resistance) to FOL races 1–3. Among the wild species of tomatoes, S. chilense and S. peruvianum showed resistance to FOL races 1–3 (Table 4). On the other hand, the resistance of all S. pimpinellifolium collections from Ecuador was less than that of the above two wild species (Table 4), although they presented no external symptoms.

Table 4 Susceptibility of wild and transition tomatoes (Solanum section Lycopersicon) to F. oxysporum f. sp. lycopersici
Sample Name Sampled year Sampled country F. oxysporum f. sp. lycopersicia
race 1 race 2 race 3
S. chilense
 Lc0036 2002 Chile 0.0 0.0 0.0
S. peruvianum
 Lp0043-1 2004 Chile 0.0 0.0 0.0
 Lp0044 2004 Chile 0.0 0.0 0.0
 Lp0046 2004 Chile 0.0 0.0 0.0
S. pimpinellifolium
 Lpp0040 2008 Ecuador 1.0 0 1.0
 Lpp0041w1 2008 Ecuador 1.0 1.0 1.0
 Lpp0043 2008 Ecudoar 1.0 2.0 1.0
 Lpp0045 2008 Ecuador 1.0 1.0 1.0
S. lycopersicum var. cerasiforme
 Lec0001 2005 Mexico 2.0 2.0 3.0
S. lycopersicum (jitomate criollo)
 Lecr0001 2005 Mexico 2.0 3.0 3.0
S. lycopersicum
 cv. Ponderosa (control) — — 2.0 1.0 2.0
a  MAFF 305121, JCM 12575, and Chz1-A were used as race 1, 2, and 3 isolate for positive control. Inner symptom was estimated as follows. 0 (no symptoms) to 4 (death) scale.

Discussion

It has generally been assumed that a plant pathogen emerged from a nonpathogenic strain during the domestication and breeding of its host plants. Several previous studies (8, 14, 33, 48) suggested a relationship between the origin of pathogens and domestication of host plants. However, such studies have not yet been performed on Fusarium oxysporum.

In the present study, we isolated F. oxysporum from the tissues and rhizosphere soils of asymptomatic Solanum spp. sect. Lycopersicon and found that all the F. oxysporum isolates recovered were nonpathogenic F. oxysporum (NPF), except for one isolate (CE4-391s) from a modern tomato field in Chile, which was considered to be FORL. This result was consistent with the findings of previous studies (12), which showed that NPFs were frequently isolated from plants and, therefore, are part of the normal field population. In our phylogeny, FOL isolates were distributed in any of the three clades (A1, A2, and A3; Fig. 1), suggesting that FOL has at least three origins (polyphyletic), which is consistent with the findings of previous studies (23, 37, 38). We also found that 16 NPFs were grouped in the three FOL clades (3 for the A2 clade, 8 for the A1 clade and 5 for the A3 clade), and that they are more closely related to FOL (99.8 to 100% nucleotide identity of rDNA-IGS) than to other NPFs and isolates of other forms (82.0 to 99.5% nucleotide identity). These 16 NPFs were isolated from Peruvian wild species, transition tomatoes, or modern cultivars. This result suggests that these NPFs share common ancestors with FOL and that the possible origin of FOL existed with the wild Solanum spp. in the Andes, possibly in Peru.

How did FOL acquire pathogenicity to the tomato? Kistler proposed a horizontal gene transfer (HGT) to explain the evolution of pathogenicity in F. oxysporum (24). HGT or horizontal chromosomal transfer (HCT) has been reported in other plant pathogenic fungi, such as Nectria haematococca (15), Cochliobolus heterostrophus (44), and Alternaria alternata (1). A small (ca. 2.0 Mb) chromosome, designated chromosome 14 (Ch14), was recently detected on FOL (31), and was found to carry effector genes, such as SIX1, SIX3, SIX4 and other genes presumably related to pathogenicity (19, 51). FOL isolates belonging to each distinct FOL clade in the phylogeny shared genes (Fig. 1). These results suggest that FOL had a polyphyletic origin, and that the original NPF may have acquired the small chromosome involved in pathogenicity and/or host specificity of FOL by HCT.

The detailed mechanisms underlying HCT and HGT in fungi are unclear (51). However, Ma and co-workers demonstrated detected HCT in F. oxysporum in vitro (31). They co-incubated the pathogenic FOL strain Fol007 (possessing Ch14) with the NPF strain Fo-47 (lacking Ch14), and recovered a Fo-47 bearing Ch14 that presented pathogenicity to the tomato. Ch14 could only be transferred to strain Fo-47, but not to F. oxysporum f. sp. melonis or F. oxysporum f. sp. cubense, by the same manner. This experiment suggested that HGT or HCT may not occur randomly among strains, but rather depends on particular strains or environmental conditions. To test this foregoing hypothesis, it will be necessary to demonstrate that the 16 NPF isolates in the FOL clades (Fig. 1) have a greater capacity to acquire the small chromosome carrying effector genes than other more distantly related isolates.

The results of this study suggest that the nonpathogenic ancestors of FOL were in Peru, and a part of their progenitors gained effector genes or the small chromosome later, which resulted in the emergence of FOL. The origin(s) of the effector genes carried by the small chromosome are of interest. Mexican transitional tomatoes and modern cultivars are less resistant to FOL than wild species (Table 4); therefore, clear damage by FOL may have appeared during/after tomato domestication in Mexico.

Our study represents an initial step in an investigation to discover the origin of FOL. We are now interested in examining the origin of the pathogenicity determinants/Ch14 in FOL (31). Studies on the distribution of resistance genes (I–I3) among tomatoes, Solanum section Lycopersicon, are also warranted. Our goal is to advance our understanding on the molecular mechanisms underlying host-parasite co-evolution.

Acknowledgements

The authors would like to show our gratitude to O. Yoder (Celgene, USA) for discussing this research and reviewing our manuscript; to F. Reyes and L. Torres (Chapingo Autonomous University, Mexico), I. Meneses (Inifap, Mexico), C. Valverde, J. Proano, R. Ramirez, and L. Paz (Agricultural University of Ecuador, Ecuador) for helping to collect the tomato samples in each tomato field; to Y. Hirano (Saitama Prefectural Agriculture and Forestry Research Center, Japan), F. Kodama (Hokkaido Research Organization, Agriculture Research Department Central Agricultural Experiment Station, Japan), K. Watanabe (Ibaraki Agriculture Institute, Japan), T. Yoshida (Bio-oriented Technology Research Advancement Institution, Japan), Y. Amemiya (Chiba University, Japan), S. Suwa (Gunma Agricultural Technology Center, Japan), Y. Hosobuchi (Sakata Seed, Japan), C. Kistler (USDA-ARS, USA; University of Minnesota, USA), A Di Pietro (University of Cordoba, Spain), M. Bon (Tezier S.A., France), E. Vivoda (Harris Moran Seed Company, USA), A. Vermunt (Groen Agro Control, The Netherlands), and R. Allende (Center for Research on Food and Development, Mexico) for providing the fungal isolates, and A. Stamatakis (Heidelberg Institute for Theoretical Studies, Germany) for technical advice on the phylogenetic analysis. This research was partly supported by the Grant-in-Aids (14405024, 16405021, 18380030, 22405018 and 22-8126) for Scientific Research from Japan Society for the Promotion of Science (JSPS) for TA and KI.

References
 
© 2014 by Japanese Society of Microbial Ecology / Japanese Society of Soil Microbiology / Taiwan Society of Microbial Ecology
feedback
 Top