2020 Volume 2 Issue 1 Pages 19-23
C1q/TNF-related protein 3 (CTRP3), a member of the CTRP family, is a soluble protein that is expressed during chondrogenic differentiation and promotes proliferation in chondrogenic cells. However, functional receptor(s) for CTRP3 has not been identified yet. In this study, we reveal progestin and adipoQ receptor family member 2 (PAQR2) [adiponectin receptor 2 (AdipoR2)] as a functional receptor of CTRP3 in chondrogenic cell line (ATDC5). Using RNA interference, we found that PAQR2 inhibition, and not PAQR1, PAQR3, or PAQR4, suppresses CTRP3-induced chondrogenic cell proliferation. In addition, a peptide blocker against PAQR2, and not against PAQR1, was observed to neutralize the growth promoting effect of CTRP3 on chondrogenic cells. Thus, our results suggested that PAQR2 is a functional receptor of CTRP3 in promoting proliferation in chondrogenic cells.
CTRP3 is a known growth factor for chondrogenic cells. However, functional receptor(s) of CTRP3 has not been identified yet. We have identified PAQR2 (AdipoR2) as a functional CTRP3 receptor in chondrogenic cells. The finding of our study will be useful in the development of cartilage regenerative medicine.
Chondrogenic cells are differentiated from mesenchymal cells. Their proliferation, maturation, and extracellular matrix synthesis is regulated by cytokines, hormones, and growth factors. Chondrogenic cells are crucial for cartilage homeostasis as they have been observed to regulate catabolic and anabolic activities. Chondrogenic cells produce extracellular matrix components including collagens and proteoglycans for cartilage formation in catabolic phase. During anabolic phase, chondrogenic cells secrete aggrecanase and collagenase to degenerate cartilage. Studies have suggested that regulation of chondrogenic cell proliferation is important as disruption in its metabolic equilibrium leads to the development of osteoarthritis [1, 2].
C1q/TNF-related protein (CTRP) family consists of soluble proteins, which are comprised of a collagen domain and C-terminal globular C1q domain. Adiponectin is a typical member of CTRP family that has been shown to play an important role in lipid metabolism, glucose uptake, insulin sensitivity, and inflammation suppression [3]. AdipoR1 and AdipoR2 (also referred as PAQR1 and PAQR2, respectively) are receptors of adiponectin [4]. Furthermore, a study using yeast-based assay has suggested PAQR3 (also known as AdipoR3) as an alternate receptor of adiponectin [5]. In contrast, CTRP6, another member of CTRP family, has been shown to regulate myoblast lipogenesis, and proliferation and differentiation of adipocytes via adiponectin receptor, PAQR1 [6, 7]. Although CTRP6 has been shown to inhibit complement alternative pathway, the activity has been suggested to be receptor independent [8]. Furthermore, CTPR9 has been shown to regulate vascular relaxation and protect against acute myocardial injury via activation of PAQR1–AMPK axis in endothelial cells and cardiac myocytes [9, 10].
CTRP3 (also known as CORS-26, cartducin, or cartnectin; gene symbol: C1qtnf3) is known to be another member of CTRP family [11]. Maeda et al. cloned CTRP3 and suggested it as a growth factor for chondrogenic cells [12]. CTRP3 has been shown to mainly express in the proliferative zone of epiphyseal growth plate cartilage [13]. Our previous study showed that C1qtnf3 is highly expressed in the joints of rheumatoid arthritis mouse model, and on expression, CTRP3 suppresses the development of experimental autoimmune arthritis in mice [14]. However, studies have indicated that unlike CTRP6, CTRP3 does not inhibit complement activation pathway [8, 14]. Kopp et al. reported that CTRP3 is an endogenous antagonist of lipopolysaccharide (LPS) although it has not been observed to directly bind LPS or toll-like receptor 4 (TLR4) [15]. Although many of these CTRP3-related activities are speculated to be mediated by specific receptors for CTRP3, none have been identified yet [16]. In this study, we probed for CTRP3 receptor that is responsible for proliferation of chondrogenic cells, and identified PAQR2, and not PAQR1, as a functional receptor of CTRP3.
ATDC5 cells, mouse teratocarcinoma AT805-derived chondrogenic cells [17], were purchased from RIKEN BioResource Center (Tsukuba, Japan). ATDC5 cells were cultured in HAM’s F-12 medium (Nacalai Tesque, Kyoto, Japan) containing 5% fetal bovine serum (FBS), penicillin (10 µg/ml), and streptomycin (10 µg/ml). Cells were subcultured at 80–90% confluency using 0.05% trypsin/0.53 mM EDTA.
Cell proliferation assayATDC5 cells (1 × 104 cells/well) were seeded in 48-well Falcon plates (Corning, Corning, NY, USA) and cultured with or without recombinant human CTRP3 (Aviscera Bioscience, Santa Clara, CA, USA) for 1 or 2 days. After trypsinization, number of cells were counted using hemocytometer. To analyze the functional roles of PAQR1 and PAQR2, ATDC5 cells were treated with 10 µg/ml of PAQR1 blocker (Alpha-Diagnostic International, San Antonio, TX, USA) or PAQR2 blocker (Alpha-Diagnostic International), respectively, in the absence or presence of CTRP3 (50 ng/ml).
Real-time PCRTotal RNA was extracted using Sepasol-RNA I Super (Nacalai Tesque, Kyoto, Japan) and reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). We performed real-time RT-PCR using SYBR Green qPCR kit (Takara, Kyoto, Japan) and iCycler System (Bio-Rad, Hercules, CA, USA) with a set of primers as described in Table 1.
| Gene name | Primer sequence | |
|---|---|---|
| Gapdh | F: | TTCACCACCATGGAGAAGGC |
| R: | GGCATGGACTGTGGTCATGA | |
| Paqr1 | F: | AGACAAGAGCAGGAGTGTTCCT |
| R: | GGTGATGTACATCACAGCCATG | |
| Paqr2 | F: | GGACACATCTCCTAGGTTGTGT |
| R: | TGGCAGTACACCGTGTGGAAGA | |
| Paqr3 | F: | TTCCAGGTCTGCATGCTTTGCT |
| R: | AGACATAGCAGCCCAGTATTCC | |
| Paqr4 | F: | AACATCTACACACACGGGCTAG |
| R: | AGAGGTGATACAGCACAGAGGC | |
| Paqr5 | F: | TTCTACAGGCTCTTCCTGTTCC |
| R: | GTGACTGTGGCCAATGTAGTCA | |
| Paqr6 | F: | TTCTACAGGCTGCGGCTGTGTT |
| R: | TGGTGGCTGTGGCCAATATAGT | |
| Paqr7 | F: | ATCGTCTTGGCCTCCTTCACCT |
| R: | CAGGACGGCTCTATGGCATAGT | |
| Paqr8 | F: | AGAAGCACAACGAGGTGGTCAA |
| R: | CAAGAGGCTGCAGGTGAGGTAA | |
| Paqr9 | F: | AGTGCTTCATCCTGTCCGGCTA |
| R: | GCAGAACTTACTGAGGAACAGC | |
| Paqr10 | F: | CACCTCAGGATGGTAGAGCACT |
| R: | TGATCCACACCAGCCAGCGCAT | |
| Paqr11 | F: | TGCTACACACACGCATTTCATG |
| R: | AGTAGATGACCATCCGATCGCA | |
*F, forward sequence; R, reverse sequence.
For RNA interference (RNAi) experiments, ATDC5 cells (1 × 106 cells/well) were seeded in 24-well Falcon plates (Corning, Corning, NY, USA) and cultured for 24 hr in HAM’s F-12 medium containing 2.5% FBS. Subsequently, cells were transfected with 30 pmol of Paqr1 siRNA, Paqr2 siRNA, and control siRNA-1; or 6 pmol of Paqr3 siRNA, Paqr4 siRNA, and control siRNA-2 (scrambled universal negative control, NC1) using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Sense and anti-sense sequences of siRNA targeting Paqr are described in Table 2. We used siRNA sequences for Paqr1 and Paqr2 as reported by Yamauchi et al. [4], whereas siRNA sequences for Paqr3 and Paqr4, and control siRNA-2 were purchased from Integrated DNA Technologies (TriFECTa RNAi Kit; Coralville, IA, USA). Following transfection, ATDC5 cells were cultured for 48 hr and used for further experiments.
| Target gene | Sequence | |
|---|---|---|
| Negative control-1 | S: | GUGCGCUGCUGGUGCCAACCCTT |
| AS: | GGGUUGGCACCAGCAGCGCACTT | |
| Paqr1 | S: | GAGACUGGCAACAUCUGGACATT |
| AS: | UGUCCAGAUGUUGCCAGUCUCTT | |
| Paqr2 | S: | GCUUAGAGACACCUGUUUGUUTT |
| AS: | AACAAACAGGUGUCUCUAAGCTT | |
| Negative control-2 | S: | CGUUAAUCGCGUAUAAUACGCGUAT |
| AS: | CAGCAAUUAGCGCAUAUUAUGCGCAUA | |
| Paqr3 | S: | GGCAUUGGAUUAUGCAGGAAUUUCT |
| AS: | AGAAAUUCCUGCAUAAUCCAAUGCCAU | |
| Paqr4 | S: | ACAUUGGUCCUGCUUGUAUCAUCTG |
| AS: | CAGAUGAUACAAGCAGGACCAAUGUCC | |
*S, sense sequence; AS, anti-sense sequence
Two-sided Student’s t-test was performed for all statistical evaluations. P<0.05 was considered as statistically significant (*P<0.05, **P<0.01, ***P<0.001). Data are expressed as an average and standard error of the mean (SEM).
Study approvalAll experiments were approved by the committee of gene modification and safety of Tokyo University of Science and performed according to the safety guidelines for gene manipulation experiments.
Maeda et al. showed that CTRP3 regulates proliferation in chondrogenic cells, including C3H10T1/2, N1511, and HCS-2/8 cells [12, 18]. In this study, we used different chondrogenic cell line, ATDC5 cells [17]. Consistent with the previous reports, we found that CTRP3 promotes proliferation in chondrogenic cells in a dose dependent manner. However, the stimulating activity was found to be saturated at 50 ng/ml (Fig. 1).
C1q/TNF-related protein 3 (CTRP3) promotes proliferation of chondrogenic cells. Chondrogenic cells (ATDC5) were seeded at a density of 1 × 104 cells/well in 48-well plates and cultured in the presence of recombinant CTRP3 at different concentrations for 2 days (n=4 each). Cell number was determined by direct cell counting. Average and standard error of the mean (SEM) are indicated. *P<0.05. Data were analyzed using Student’s t-test. All data were reproduced in another independent experiment with similar results.
As PAQR1 and PAQR2 are receptors of adiponectin [4], and PAQR3 is shown to bind adiponectin [5], we examined the possibility whether one of the PAQR proteins can act as receptor of CTRP3. Further, we investigated chondrogenic cells for mRNA expression of PAQR family. Based on amino acid sequence homology, these members of PAQR family have been classified into three groups: class I, PAQR1-4; class II, PAQR5-9; and class III, PAQR10 and PAQR11 [18]. We found that class I PAQR family genes (Paqr1, Paqr2, Paqr3, and Paqr4) and some class II PAQR family genes (Paqr7 and Paqr8) are expressed in ATDC5 cells (Fig. 2A). However, remaining class II PAQR family genes (Paqr5, Paqr6 and Paqr9) and class III PAQR family genes (Paqr10 and Paqr11) were not expressed in ATDC5 cells. Furthermore, we primed siRNAs to inhibit the expression of class I PAQR family receptors in ATDC cells. On transfecting ATDC5 cells, siRNAs targeting Paqr1, Paqr2, Paqr3, and Paqr4 were found to significantly suppress the expression of respective mRNAs (87%, 91%, 97%, and 97%, respectively) (Fig. 2B–E).
mRNA expression of progestin and adipoQ receptor (PAQR) family members in ATDC5 cells. (A) Expression of PAQR mRNAs in ATDC5 cells was determined by real-time PCR (n=3 each). Average and SEM are indicated. (B–E) Knockdown efficiency of siRNA duplexes targeting Paqr1 (B), Paqr2 (C), Paqr3 (D), and Paqr4(E) in ATDC5 cells. Relative Paqr mRNA levels were determined by real-time PCR. All data were reproduced in another independent experiment with similar results.
Further, we examined the effect of these siRNAs on CTRP3-mediated activation of chondrogenic cell proliferation. We found that siRNA-mediated PAQR2 knockdown significantly inhibited CTRP3-induced proliferation in ATDC5 cells (Fig. 3A). However, the enhancing activity of CTRP3 was not affected on treating with siRNAs targeting Paqr1, Paqr3, or Paqr4 mRNAs. These results suggested that PAQR2 is a receptor of CTRP3 in chondrogenic cells, and not PAQR1, PAQR3, or PAQR4.
PAQR2 mediates CTRP3-induced chondrocyte proliferation. (A, B) ATDC5 cells (1 × 104 cells/well in 48-well plates) were transfected with PAQR-specific siRNA duplexes (A: control-1, Paqr1, and Paqr2; B: control-2, Paqr3, and Paqr4), and were cultured in the absence (−) or presence (+) of CTRP3 (50 ng/ml) for 2 days (n=4 each). Further, cell number was determined by direct cell counting. Average and SEM are indicated. ***P<0.001. Data were analyzed using Student’s t-test. (C) ATDC5 cells (1 × 104 cells/well in 48-well plates) were cultured with 10 µg/ml of PAQR1 blocker or PAQR2 blocker in the absence (−) or presence (+) of CTRP3 (50 ng/ml) for 1 day (n=4 each). Cell number was determined by direct cell counting. Average and SEM are indicated. ***P<0.001. All data were reproduced in another independent experiment with similar results.
Furthermore, we examined the effects of peptide blockers for PAQR1 and PAQR2 on CTRP3-induced stimulation of chondrogenic cell proliferation. We found that PAQR2 blocker, and not PAQR1 blocker, neutralized the proliferation enhancing effect of CTRP3 (Fig. 3B). These results demonstrated that PAQR2 is a functional CTRP3 receptor that promotes cell proliferation in chondrogenic cells.
CTRP3 has been shown to stimulate proliferation in different types of cells, which suggests the presence of functional receptor(s) in these cells [16]. However, functional receptor(s) of CTRP3 has not been identified yet. Based on ligand-receptor capture technology, Li et al. have identified lysosomal-associated membrane protein 1 (LAMP-1) and lysosome membrane protein 2 (LIMP-2) in rat hepatoma cells (H4IIE) as putative CTRP3 receptors [19]. However, functional roles of these receptors remain to be elucidated. In this report, we found PAQR2 as a functional CTRP3 receptor.
Tong et al. showed that adiponectin, a member of CTRP family, upregulates MMP-3 expression in human chondrocytes through PAQR1, and not PAQR2 [20]. Based on the above study, we focused our efforts on PAQR family. Furthermore, adiponectin enhances the proliferation of PAQR1 and PAQR2-expressing ATDC5 cells; however, the role of PAQR receptors in chondrogenic cell proliferation is unclear [21, 22]. In addition, CTRP1 has been shown to enhance proliferation of chondrogenic cell line, N1511 via unknown receptor(s) [23]. Studies have shown that CTRP6 regulates lipogenesis in myoblasts, and adipocyte proliferation and differentiation via PAQR1 [6, 7]. Moreover, CTRP9 via PAQR1 is known to protect against acute cardiac damage and high glucose-induced endothelial oxidative damage [10, 24] and inhibit macrophage-mediated inflammatory response against oxidized LDL [25].
In this study, we showed that not only Paqr1 and Paqr2 but also Paqr3, Paqr4, Paqr7, and Paqr8 mRNA are expressed in ATDC5 chondrogenic cells (Fig. 2A). Further, we focused on class I PAQR family as progestin, a synthetic progesterone, has been shown to be a ligand of class II PAQR family, including PAQR7 and PAQR8, and not class I PAQR family members such as PAQR1 and PAQR2 [18, 26]. Using siRNAs targeting different Paqr mRNAs and receptor-specific blockers, we showed that PAQR2, and not PAQR1, PAQR3, or PAQR4, is a functional CTRP3 receptor that has the potential to stimulate ATDC5 cell proliferation (Fig. 3).
C1qtnf3 is highly expressed in osteoarthritis mouse model [27], and Paqr1 and Paqr2 expression is upregulated in damaged cartilages of patients with osteoarthritis [28]. CTRP3 has been shown to exhibit chondroprotective effects in IL-1β-induced injury suggesting the protective role of CTRP3 in osteoarthritis [29]. Overall, these findings suggest that the CTRP3–PAQR2 axis is a potential target for the development of new therapeutics against bone metabolic diseases including osteoarthritis.
The authors have declared that no conflict of interest exists.
We thank all the members of our laboratory for their kind cooperation and discussion. This work was supported by JSPS KAKENHI (Grant No. JP17K14978, JP19K20681, JP19K12766, JP24220011, and JP15H05787); Science and Technology Research Promotion Program for Agriculture, Forestry, Fisheries, and Food Industry (No. 25031AB); SRF Foundation (No. 2019Y005); Uehara Memorial Foundation (No. 201910142); and Koyanagi Foundation (No. 19060062).
