Suppression of tensin 2 promotes intestinal tumorigenesis by liberating integrin-linked kinase-induced nuclear translocation of β-catenin

Abstract

Tensin 2 (TNS2) is a focal adhesion-localized multidomain protein expressed in various tissues. TNS2 expression significantly decreases in many tumor cell lines, and low TNS2 expression is associated with a poorer relapse-free survival in some cancers, suggesting that the loss of TNS2 may be related to tumor progression. Deregulation of Wnt/β-catenin signaling is frequently observed in colorectal cancer. In the present study, we found that TNS2 negatively regulated Wnt signaling by suppressing the nuclear translocation of β-catenin by reducing integrin-linked kinase (ILK) activity in colon cancer cell lines. To investigate the role of TNS2 in intestinal tumorigenesis in vivo, we introduced Tns2 mutation into Apc^Min/+ mouse, a model of human familial adenomatous polyposis. The compound mutant mice showed a significant increase in tumor number and size in the small intestine and colon. Thus, this study may contribute to the discovery of novel mechanisms underlying cancer malignancy, and pave the way for the development of treatment strategies for intestinal cancers.

Highlights

1. Knockdown or overexpression of TNS2 in colon cancer cell lines increases or decreases their proliferation and migration, respectively.

2. TNS2 inhibits Wnt signaling by suppressing β-catenin nuclear translocation via reduction in ILK activity.

3. Genetic disruption of Tns2 on the Apc-deficient background results in a significant increase in tumor number and size in the intestine.

Introduction

Colorectal cancer (CRC) is the second most common cancer and the second leading cause of cancer-related death worldwide [1]. Dysregulation in the Wnt/β-catenin signaling pathway is observed in 90% colorectal tumors, and the nuclear accumulation of β-catenin is detected in up to 80% CRC cases [2, 3]. The absence of adenomatous polyposis coli (APC) leads to the nuclear translocation of β-catenin and the subsequent activation of the Wnt/β-catenin signaling pathway [4]. APC mutation has been observed in ~80% sporadic CRC [5]. The Wnt/β-catenin signaling is involved in cell proliferation and migration [6, 7], and several proto-oncogenes such as those encoding c-MYC and cyclin D1 are known as the targets of the Wnt/β-catenin signaling pathway [8, 9].

The Apc^Min/+ mouse has been widely used as a model of intestinal tumor [10]. This model carries a non-sense mutation in the Apc gene at codon 850 that results in the development of several benign adenomas throughout the intestinal tract [11]. As the progression to adenocarcinoma in single Apc mutant is very rare, the study of the genes that modify intestinal tumorigenesis can be carried out in Apc mutant mice combined with other mutant mice. Many studies have contributed to the better understanding of the molecular mechanisms underlying multistage carcinogenesis in intestinal cancer [6,7,8,9,10, 12].

Tensin is a cytoskeletal protein that is widely expressed in human tissues, including the intestine, and is localized to the focal adhesion [13, 14]. Tensin 2 (TNS2) is a tensin family member that contains protein tyrosine phosphatase (PTP) and C2 domains at the N-terminal region and Src homology 2 (SH2) and phosphotyrosine binding (PTB) domains at the C-terminal region [15]. Tensin functions have been well investigated in cancer cell lines with a focus on focal adhesion, migration, proliferation, cytoskeleton, integrin-mediated signal transduction, and so on [16,17,18]. As tensins structurally resemble the two tumor suppressors, phosphatase homolog/tensin homolog (PTEN) and Rho GTPase-activating protein deleted in liver cancer 1 (DLC1) [19], it may serve as a potential target for cancer research. Recent transcriptome analysis studies by RNA-sequencing showed that TNS2 mRNA level was significantly lower in liquid biopsy samples from CRC patients than in those from unaffected controls (average 2.5-fold, P=5.1 × 10⁻⁸) [20]. However, its in vivo biological function remains poorly understood.

In the present study, we investigated the role of TNS2 in intestinal tumorigenesis in vitro and in vivo. The knockdown of TNS2 expression resulted in a significant increase in the proliferation and migration of human colon cancer cells, while TNS2 overexpression significantly decreased cell proliferation and migration. In addition, the genetic disruption of Tns2 on the Apc-deficient background resulted in a significant increase in tumor number and size in the intestine.

Materials and Methods

Cell culture

Human CRC cell lines Colo201, SW620, and HCT116 were purchased from the American Type Culture Collection (Manassas, VA, USA) and cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Nacalai Tesque, Kyoto, Japan), Leibovitz’s L-15 medium (Wako, Osaka Japan), and Dulbecco’s modified Eagle’s medium (DMEM; Nacalai Tesque) supplemented with 10% fetal bovine serum (HyClone, Logan, UT, USA), 100 units/ml of penicillin, and 100 µg/ml of streptomycin, respectively. The cells were maintained at 37°C in a humidified chamber with 5% CO₂.

Silencing of TNS2 gene

A stealth small-interfering RNA (siRNA) (GGAAGCUCUUCUUUCGCCGCCAUUA, HSS118661) against human TNS2 mRNA was purchased from Thermo Fisher Scientific (Waltham, MA, USA), and a negative-control siRNA (Mission siRNA SIC-001) was obtained from Sigma-Aldrich (St. Louis, MO, USA). Transfection of siRNAs was carried out using Lipofectamine 3000 reagent according to manufacturer’s instructions (Thermo Fisher Scientific). The cells at 48 hr of transfections were used for several assays. The silencing of endogenous TNS2 gene was confirmed by reverse-transcription quantitative polymerase chain reaction (RT-qPCR) (Fig. 1A).

Fig. 1.

Tns2 suppresses the proliferation and migration of colorectal cancer cell lines. (A) RT-qPCR analysis showed that TNS2 mRNA expression level was lower in HCT116 cells than in Colo201 and SW620 cells. In Colo201 and SW620 cells, siRNA treatment suppressed TNS2 mRNA expression. Relative fold changes in TNS2 expression were calculated using the comparative 2−ΔΔCT method and normalized to TNS2 level from HCT116 cells. (B) RT-PCR analysis showed the stable expression of murine Tns2 in HCT116 cells. Minus or plus indicates the absence or presence of pCAG-Tns2, respectively. (C–E) Proliferation of colorectal cancer cell lines in the presence or absence of TNS2 gene. TNS2 KD significantly increased the proliferation of Colo201 (C) and SW620 cells (D) (n=3). Tns2 overexpression induced a significant decrease in HCT116 cell proliferation (E) (n=4). (F–H) Migration of colorectal cancer cell lines in the presence or absence of TNS2 gene. TNS2 KD significantly increased the migration of Colo201 (F) and SW620 (G) cells (n=4). Tns2 overexpression induced a significant decrease in HCT116 cell migration (H) (n=4). Values are means ± SD. *P<0.05, ** P<0.01, ***P<0.001.

Stable expression of Tns2 in HCT116 cells

To discriminate between endogenous human TNS2 (NCBI accession no: NP_736610.2) and transgene-related expression, we used mouse Tns2 cDNA (NCBI accession no: NP_705761.2, 98% similarities at the amino acid level). HCT116 cells were transfected with empty pCAG or pCAG-murine Tns2 expression vector [21] using Lipofectamine 3000 according to the manufacturer’s instructions (Thermo Fisher Scientific) to obtain a Tns2-overexpressing stable cell line, HCT116-Tns2. Transfected cells were selected in a medium containing G418 at a final concentration of 400 µg/ml (Nacalai Tesque). To normalize cell-to-cell variation, 10 individual G418-resistant colonies were pooled and the expression of Tns2 was confirmed by RT-PCR (Fig. 1B). Primer sequences used were as follows: Tns2 transgene forward primer (AAAGGCGACGTCATGGTAAC) and reverse primer (CTCCACTGAGGCTTGGAAAG); Gapdh forward primer (CGACTTCAACAGCAACTC) and reverse primer (GCCGTATTCATTGTCATACCAG). RT-PCR was performed with ReverTra Ace reverse transcriptase and KOD FX Neo DNA polymerase according to the manufacturer’s instructions (TOYOBO, Osaka, Japan).

Colony formation assay

To measure cell proliferation, HCT116-Tns2 or TNS2-knockdown cell lines as well as Colo201 and SW620 cells were seed in six-well plates at 1.0 × 10³ cells/wells. After 48 hr, the cells were counted as colonies of more than 10 cells.

Transwell migration assay

We measured the migration ability of HCT116-Tns2 or TNS2 knockdown cell line as well as Colo201 and SW620 cells seeded in the upper chamber of an insert at 5.0 × 10⁴ cells in a serum-free medium. The lower chamber of a 24-well plate was filled with a complete culture medium containing 10% serum. After 24 hr of incubation, upper inserts were fixed and stained with 0.25% crystal violet (Nacalai Tesque) and 3.7% formaldehyde in 80% methanol for 10 min. Ten random fields per insert were observed, and the migrated cells were counted under a microscope.

Measurement of Wnt/β-catenin signaling activity using TOP/FOPFlash assay

TCF-mediated gene transcription can be determined by the corrected ratio of pTOPFlash/pFOPFlash luciferase activity [22]. Stable cell lines HCT116-empty and HCT116-Tns2 were seeded in 24-well plates. After 24 hr, the cells were transfected with 400 ng Super 8× TOPFlash or Super 8× FOPFlash reporter plasmid using Lipofectamine 3000 transfection reagent as per a previous report [23]. Colo201 cells were co-transfected with 50 pmol TNS2-siRNA or control siRNA and 400 ng Super 8× TOPFlash or Super 8× FOPFlash reporter plasmid. After 48 hr, cell lysates were assayed using the Dual-Luciferase Reporter Assay Kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Luciferase activity was measured by a Tristar LB941 Multimode Microplate Reader (Berthold Technologies, Bad Wildbad, Germany).

Immunofluorescence assay

Cells were cultured and treated in µ-Slide (Nippon Genetics, Kyoto, Japan), fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) for 10 min, permeabilized for 10 min with 0.1% Triton X-100 in PBS, and blocked with 5% goat serum albumin (GSA) for 1 hr at room temperature (25°C ± 2). Cells were treated with a primary β-catenin antibody (1:100; Proteintech, Chicago, IL, USA) in PBS/0.1% Tween-20 (PBST) containing 5% GSA for 1 hr at room temperature, and then probed with a secondary antibody (anti-rabbit IgG, 1:500; Cell Signaling Technology, Denver, MA, USA) in PBST containing 5% GSA for 1 hr at room temperature. Nuclear signal intensity per cell was measured using ImageJ. HCT116-empty (n=221) and HCT116-Tns2 (n=117) were randomly selected and analyzed.

RT-qPCR

Total RNA was extracted using TRI Reagent (COSMO BIO, Tokyo, Japan) according to the manufacturer’s instructions, and the cDNA was synthesized from RNA using ReverTra Ace (TOYOBO). RT-qPCR was performed using KAPA SYBR FAST qPCR kit (Kapa Biosystems, Woburn, MA, USA) according to the manufacturer’s instructions. The reaction was analyzed using the Eco Real-Time PCR system (Illumina, Wilmington, MA, USA).

Primer sequences used were as follows: Endogenous Tns2 forward primer (AAAGGCGACGTCATGGTAAC) and reverse primer (CTCCACTGAGGCTTGGAAAG); Gapdh forward primer (CGACTTCAACAGCAACTC) and reverse primer (GCCGTATTCATTGTCATACCAG); TNS2 forward primer (TGCAATCCAAGCACCGGGACAAGTA) and reverse primer (GGCCAGCCGAAGTCTTGAACCTTG); ILK forward primer (TCTGGAGAGCTATGGAAGGGCCG) and reverse primer (CGAGAAAATCCTGAGCCGGGGAC); ACTB forward primer (TTCCTTCCTGGGCATGGAGT) and reverse primer (TACAGGTCTTTGCGGATGTCC).

Western blot analysis

Western blot analysis was performed as previously described [21]. Primary antibodies for phospho-integrin-linked kinase (ILK; Ser246) (Merck, Darmstadt, Germany), ILK (65.1) (Santa Cruz Biotechnology, Santa Cruz, CA, USA), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Proteintech) and secondary horseradish peroxidase (HRP)-conjugated anti-rabbit IgG and anti-mouse IgG (Cell Signaling) were used. Protein band intensities were measured using ImageJ (http://rsb.info.nih.gov/ij/).

Animals

Tns2-deficient homozygous mice (Tns2^nph/nph) were generated as previously described [24]. Apc^Min/+ mice were obtained from the Jackson Laboratory (Bar Harbor, ME, USA) [10]. Tns2 homozygous mice were bred to Tns2;Apc double-heterozygous mice to produce hybrid mutants (Apc^Min/+;Tns2^nph/nph) on the C57BL/6J genetic background. Genomic DNA was extracted from mouse tail and PCR genotyping was performed according to the previously described protocol [10, 25]. The animal facility was air-conditioned at 22 ± 2°C and 40–60% relative humidity. Mice were maintained under a 12 hr light-dark cycle. A standard laboratory diet, CE-2 (Nihon Clea, Utsunomiya, Japan), and tap water were provided ad libitum. All animal experiments were conducted according to the Regulation for the Care and Use of Laboratory Animals of Kitasato University. Animal experimentation protocol was approved by the President of Kitasato University through the judgment by Institutional Animal Care and Use Committee of Kitasato University (Approval ID: No. 18-076). A humane end point was applied when mice with severe anemia or rectal prolapse became moribund.

Microscope analysis of the intestine

Mice were sacrificed by inhalation of an overdose of isoflurane, and the intestine was excised and rinsed with PBS to remove fecal material. Formalin-fixed intestinal polyps were counted under a stereomicroscope. Polyps were categorized as large (>3 mm in diameter), medium (1–3 mm in diameter), or small (<1 mm in diameter).

Immunohistochemical analysis

To assess Wnt/β-catenin signaling, β-catenin immunostaining was performed using a mouse monoclonal anti-β-catenin antibody (Santa Cruz Biotechnology). Antigen retrieval was carried out by autoclaving samples in 10 mM sodium citrate buffer (pH 6.0). Endogenous peroxidase activity was blocked by incubating the slides with 3% hydrogen peroxide (H₂O₂) for 30 min. Sections were incubated with a biotin-conjugated goat anti-mouse IgG secondary antibody (Histofine; Nichirei Biosciences, Tokyo, Japan) for 30 min at room temperature and then probed with an HRP-conjugated streptavidin complex (Histofine; Nichirei Biosciences) for 3,3-diaminobenzidine (DAB) staining. The signal intensity of DAB was measured for seven randomly selected polyps for each sample using ImageJ.

Statistical analysis

Data were compared using the Student’s t-test and Bonferroni’s multiple comparison test. The error bar represented mean ± standard deviation (SD) from three independent samples. Differences were considered significant at P<0.05 [*], P<0.01 [**], and P<0.001 [***].

Results

TNS2 inhibits the proliferation and migration of human CRC cell lines

We first measured TNS2 gene expression level in human colon cancer cells Colo201, SW620, and HCT116 by RT-qPCR. Colo201 and SW620 cells showed higher expression of TNS2 mRNA than HCT116 cells (Fig. 1A). Thus, to assess the effect of the presence/absence of TNS2 on cell proliferation and migration, Colo201 and SW620 cells were transfected with TNS2 siRNA. TNS2 gene expression significantly decreased in TNS2 siRNA-transfected cells as compared with that in the cells transfected with the negative-control siRNA (Fig. 1A). HCT116 cells stably expressing murine Tns2 (HCT116-Tns2) were established (Fig. 1B). To measure cell proliferation, the colony formation assay was performed. The colony number in TNS2-knockdown (TNS2 KD) cells was significantly higher than those that in control cells (Fig. 1C, 1D). In contrast, the colony number significantly decreased in HCT116-Tns2 cells as compared with that in control HCT116 cells (Fig. 1E). Next, to evaluate the effect of the presence/absence of TNS2 on cell migration, we performed the transwell migration assay using TNS2 KD-Colo201, TNS2 KD-SW620, and HCT116-Tns2 cells. Cell migration significantly increased in TNS2 KD cells as compared with that in control cells (Fig. 1F, 1G). In contrast, the number of migratory cells significantly decreased in HCT116-Tns2 group as compared with that in the control group (Fig. 1H). Thus, the downregulation or upregulation of TNS2 expression results in an increase or a decrease in human CRC cell proliferation and migration, respectively.

Tns2 inhibits the Wnt/β-catenin signaling pathway in CRC cell lines

The TOP/FOPFlash assay was performed to evaluate the activity of the Wnt/β-catenin signaling pathway in TNS2-modified cells. The TOP/FOPFlash activity was significantly higher in TNS2 KD cells than in control cells (Fig. 2A). On the contrary, the activity significantly decreased in HCT116-Tns2 as compared with that in control HCT116 cells (Fig. 2B). These findings show that TNS2 inhibits the Wnt/β-catenin signaling pathway in human CRC cell lines.

Fig. 2.

Tns2 suppresses the Wnt/β-catenin activity and nuclear translocation of β-catenin. (A)TNS2 KD increases Wnt/β-catenin activity in Colo201 cells, as detected by the TOPFlash luciferase assay (n=6). (B) Tns2 overexpression decreases Wnt/β-catenin activity in HCT116 cells, as detected by the TOPFlash luciferase assay (n=6). (C) β-catenin level was similar between the whole cell lysates of HCT116-Tns2 cells and control cells. (D) Tns2 overexpression decreased the nuclear translocation of β-catenin in HCT116 cells, as detected by immunofluorescence (Control: n=221, Tns2: n=117). White arrows indicate the position of the nucleus. Values are means ± SD. *P<0.05, **P<0.01.

TNS2 regulates the nuclear translocation of β-catenin

The canonical Wnt signaling pathway regulates the expression of the target genes via the stabilization and nuclear translocation of the cytoplasmic pool of β-catenin. We initially hypothesized that TNS2 promotes β-catenin degradation. However, no significant change was observed in β-catenin protein level in whole-cell lysates of HCT116-Tns2 and control HCT116 cells (Fig. 2C), implying that TNS2 is not involved in the degradation of β-catenin. Next, we analyzed the level of β-catenin in nuclear fractions by performing immunofluorescence staining and found a significant decrease in the translocation of β-catenin from the cytoplasm to the nucleus in HCT116-Tns2 cells as compared with that in control cells (Fig. 2D). Thus, TNS2 affects the nuclear localization of β-catenin, a phenomenon that is essential for the progression of various human cancers through the transcriptional upregulation of downstream genes.

TNS2 decreases the mRNA level of, and dephosphorylates, ILK

Many gene products modulate the subcellular localization of β-catenin and enhance the Wnt signaling activity [26]. ILK is known to regulate the stabilization and nuclear translocation of β-catenin in several epithelial cell models [27]. The phosphorylation of ILK was found to regulate its cytoplasmic localization [34]. As both TNS2 and ILK are localized to the focal adhesion and seem to regulate cell motility [15, 28], we tested whether TNS2 acts on the Wnt pathway through ILK signaling. The presence/absence of TNS2 had no influence on the level of ILK protein in all cell lines. In contrast, western blot analysis showed that TNS2 KD induced an increase in the phosphorylation of ILK protein in SW620 cells. Reciprocally, Tns2 expression decreased the level of phospho-ILK in HCT116 cells. In Colo201 cells, phospho-ILK could not be detected due to unknown reasons (Fig. 3).

Fig. 3.

Tns2 suppresses ILK expression in colorectal cancer cell lines. Western blot analysis showed that TNS2 KD increased the expression of phospho-ILK in SW620 cells, while Tns2 overexpression decreased phospho-ILK level in HCT116 cells. TNS2 or Tns2 expression had no effect on ILK levels in SW620 and HCT116 cells. Values are means ± SD. *P<0.05.

Tns2 suppresses the progression of intestinal tumors in Apc^Min/+ mice

The decrease or loss of TNS2 transcript was recently reported in several human cancer cells [20]; however, no information is available about intestinal polyps in Apc^Min/+ mice. Thus, we assessed the mRNA expression of Tns2 by RT-qPCR in the ileum (the most frequent site of polyps) and colon (the most infrequent site of polyps). Tns2 mRNA levels were significantly lower in colorectal polyps than in the normal mucosa. In contrast, no expression difference was observed in the ileum of Apc^Min/+ mice at 16 weeks of age (Fig. 4A). Thus, there was no correlation between Tns2 mRNA expression level and tumor incidence. Next, we hypothesized that the extreme downregulation of Tns2 in tumor cells may promote the expansion or dysplasia of polyps in the intestine. To determine the role of Tns2 in intestinal tumorigenesis, we crossed Tns2-deficient nph mice with Apc^Min/+ mice. Apc^Min/+;Tns2^nph/nph mice were viable, fertile, and showed no apparent histological abnormality in the intestine and colon (data not shown). Thus, Tns2 expression appears to be non-essential for the maintenance of the intestinal epithelium. Moreover, the loss of Tns2 function failed to induce spontaneous intestinal tumor formation in single Tns2^nph/nph mice. Next, to investigate the effect of Tns2 inhibition on tumor progression in vivo, we counted tumors in Apc^Min/+;Tns2^nph/nph and Apc^Min/+ mice at 8–12 weeks of age.

Fig. 4.

The number of intestinal polyps and expression of β-catenin in Apc^Min/+;Tns2^nph/nph mice as compared with those in Apc^Min/+ mice. (A) In Apc^Min/+ mice, Tns2 mRNA expression level significantly decreased in the polyps as compared with that in the normal mucosa of the colon, but no difference was observed in the ileum (six pieces of normal mucosa and six polyps from six Apc^Min/+ mice). Relative fold changes in Tns2 expression were calculated using the comparative 2−ΔΔCT method and normalized to Tns2 level from the normal mucosa of the ileum. (B–G) The number of polyps significantly increased in double-mutant mice as compared with that in Apc^Min/+ mice both in the small intestine (B) and colon (F). Polyps were categorized as large (>3 mm), medium (1–3 mm), or small (<1 mm) in the duodenum (C), jejunum (D), ileum (E), and colon (G) (Apc^Min/+: n=7, double-mutant: n=6). A and AT indicate single Apc^Min/+ mice and double-mutant mice, respectively. (H) The double-mutant mice showed adenocarcinoma with low-grade intraepithelial dysplasia (black arrows). (I) Immunohistochemical analysis revealed the strong expression of β-catenin in both Apc^Min/+ mice and double-mutant mice. Values are means ± SD. *P<0.05, **P<0.01, ***P<0.001.

Apc^Min/+ mice had many polyps throughout the small intestine but most predominantly in the terminal ileum (Fig. 4B–E). Apc^Min/+ mice also presented with 0–2 colonic polyps that were generally larger in size than the intestinal polyps, ranging in diameter from 1 to 3 mm (Fig. 4F, 4G). The genetic deficiency of Tns2 on the Apc^Min/+ background resulted in a significant increase in total polyps in the small intestine and colon (Fig. 4B, 4F). Size distribution analysis of polyps revealed the differential effect of Tns2 deficiency depending on the intestinal segment and polyp size ([. Tns2 deficiency strikingly increased the number of smaller polyps (<1 mm) in the jejunum and ileum and polyps (1 to 3 mm) in the colon, but no significant difference was observed in the duodenum and jejunum (there is a tendency for increasing polyp number in the jejunum) (Fig. 4C–E, 4G). The double-mutant mice suffered more severe anemia or rectal prolapse and became moribund earlier than single Apc^Min/+ mice. Hematoxylin and eosin (HE) staining of the tumors from both strains strictly confined to the mucosal crypts without any invasion to the mucosal stroma, submucosa, and muscle (data not shown). However, large tumors in the colon revealed adenocarcinoma with low-grade intraepithelial dysplasia with distorted crypt architecture and high nuclear to cytoplasmic ratio in double-mutant mice ([. The aberrant activation of the Wnt/β-catenin pathway is very common in human and mouse intestinal tumors. The expression of β-catenin was more intense in tumors, as observed by immunohistochemistry. The pattern and intensity of β-catenin staining in Apc/Tns2-deleted adenomas looked similar to those in Apc^Min/+ controls (Fig. 4I).

Discussion

The present study demonstrates that TNS2 deficiency increases the proliferation and migration of human CRC cell lines, and that the number of intestinal polyps increases in Apc and Tns2 compound mutant mice. Furthermore, the TOP/FOPFlash assay revealed the TNS2-mediated inhibition of Wnt/β-catenin signaling in human CRC cell lines. Wnt/β-catenin signaling is tightly associated with cancer, especially with the carcinogenesis of CRC [2]. In the absence of Wnt signaling, cytoplasmic β-catenin is degraded by a “destruction complex”, comprising axis inhibitor (AXIN), APC, casein kinase 1, and glycogen synthase kinase 3, and maintained at low levels [29, 30]. Apc mutation impairs the ability of the destruction complex, resulting in the accumulation of cytoplasmic β-catenin that mimics activated Wnt/β-catenin signaling regardless of Wnt signal [31]. In the Wnt/β-catenin signaling pathway, accumulated cytoplasmic β-catenin translocates to the nucleus, wherein it forms a transcriptional complex with the T-cell factor/lymphoid enhancer factor (TCF/LEF) [2, 3]. Immunofluorescence staining revealed the TNS2-mediated suppression of the translocation of β-catenin to the nucleus of human CRC cell lines. In addition, TNS2 may promote ILK dephosphorylation. TNS2 possesses a tyrosine phosphatase domain and exhibits phosphatase activity [32, 33], although whether it directly interacts with ILK is unknown. ILK shuttles between the cell nucleus and cytoplasm depending on its phosphorylation and switches its functions [34]. Upon dephosphorylation, ILK localizes to the nucleus [34] and induces the stabilization and nuclear translocation of β-catenin through the inhibition of GSK3 activity [35]. These findings suggest that TNS2 suppresses the nuclear translocation of β-catenin through the dephosphorylation of ILK, resulting in the inhibition of its cytoplasmic activity in the Wnt/β-catenin signaling pathway. In contrast to TNS2, the expression of PAK1, a kinase for ILK [34], is increased with the progression of human CRC [36]. PAK1 knockdown inhibits the proliferation of CRC cell lines independent of RAF/mitogen-activated protein kinase–extracellular signal-regulated kinase (ERK) kinase (MEK)/ERK and phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT) signaling [37]. It is interesting that HCT116 cells, which exhibited lower expression level of TNS2 in our study, were the most sensitive to PAK1 knockdown [37].

Conclusions

Our study demonstrates that TNS2 suppresses intestinal tumors by blocking the nuclear translocation of β-catenin, leading to the inhibition of Wnt/β-catenin signaling. The blockade of the nuclear translocation of β-catenin can be induced by the TNS2-mediated dephosphorylation of ILK. Our results may contribute to the discovery of a novel mechanism for cancer malignancy and encourage the development of treatment strategies for intestinal cancers.

Author Contributions

NS conceived and designed the work. KH, AS, SN, YT, MW, YT, NK, OT, AR, KS, and HS performed the experiments and analyzed the data. KH and NS drafted the manuscript. NS revised the manuscript. All authors reviewed the manuscript. All authors have read and approved the final version of the manuscript.

References

• 1.   Bray,  F.,  Ferlay,  J.,  Soerjomataram,  I.,  Siegel,  R. L.,  Torre,  L. A. and  Jemal,  A. 2018. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 68: 394–424.
• 2.   Sebio,  A.,  Kahn,  M. and  Lenz,  H. J. 2014. The potential of targeting Wnt/β-catenin in colon cancer. Expert Opin. Ther. Targets 18: 611–615.
• 3.   White,  B. D.,  Chien,  A. J. and  Dawson,  D. W. 2012. Dysregulation of Wnt/β-catenin signaling in gastrointestinal cancers. Gastroenterology 142: 219–232.
• 4.   Korinek,  V.,  Barker,  N.,  Morin,  P. J.,  van Wichen,  D.,  de Weger,  R.,  Kinzler,  K. W.,  Vogelstein,  B. and  Clevers,  H. 1997. Constitutive transcriptional activation by a β-catenin-Tcf complex in APC-/- colon carcinoma. Science 275: 1784–1787.
• 5.   Fearnhead,  N. S.,  Britton,  M. P. and  Bodmer,  W. F. 2001. The ABC of APC. Hum. Mol. Genet. 10: 721–733.
• 6.   MacDonald,  B. T.,  Tamai,  K. and  He,  X. 2009. Wnt/β-catenin signaling: components, mechanisms, and diseases. Dev. Cell 17: 9–26.
• 7.   Giles,  R. H.,  van Es,  J. H. and  Clevers,  H. 2003. Caught up in a Wnt storm: Wnt signaling in cancer. Biochim. Biophys. Acta 1653: 1–24.
• 8.   He,  T. C.,  Sparks,  A. B.,  Rago,  C.,  Hermeking,  H.,  Zawel,  L.,  da Costa,  L. T.,  Morin,  P. J.,  Vogelstein,  B. and  Kinzler,  K. W. 1998. Identification of c-MYC as a target of the APC pathway. Science 281: 1509–1512.
• 9.   Tetsu,  O. and  McCormick,  F. 1999. β-catenin regulates expression of cyclin D1 in colon carcinoma cells. Nature 398: 422–426.
• 10.   Moser,  A. R.,  Pitot,  H. C. and  Dove,  W. F. 1990. A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse. Science 247: 322–324.
• 11.   Su,  L. K.,  Kinzler,  K. W.,  Vogelstein,  B.,  Preisinger,  A. C.,  Moser,  A. R.,  Luongo,  C.,  Gould,  K. A. and  Dove,  W. F. 1992. Multiple intestinal neoplasia caused by a mutation in the murine homolog of the APC gene. Science 256: 668–670.
• 12.   Yamada,  Y. and  Mori,  H. 2007. Multistep carcinogenesis of the colon in Apc^Min/+ mouse. Cancer Sci. 98: 6–10.
• 13.   Chen,  H.,  Ishii,  A.,  Wong,  W. K.,  Chen,  L. B. and  Lo,  S. H. 2000. Molecular characterization of human tensin. Biochem. J. 351: 403–411.
• 14.   Lo,  S. H. 2004. Tensin. Int. J. Biochem. Cell Biol. 36: 31–34.
• 15.   Chen,  H.,  Duncan,  I. C.,  Bozorgchami,  H. and  Lo,  S. H. 2002. Tensin1 and a previously undocumented family member, tensin2, positively regulate cell migration. Proc. Natl. Acad. Sci. USA 99: 733–738.
• 16.   Qian,  X.,  Li,  G.,  Vass,  W. C.,  Papageorge,  A.,  Walker,  R. C.,  Asnaghi,  L.,  Steinbach,  P. J.,  Tosato,  G.,  Hunter,  K. and  Lowy,  D. R. 2009. The Tensin-3 protein, including its SH2 domain, is phosphorylated by Src and contributes to tumorigenesis and metastasis. Cancer Cell 16: 246–258.
• 17.   Muharram,  G.,  Sahgal,  P.,  Korpela,  T.,  De Franceschi,  N.,  Kaukonen,  R.,  Clark,  K.,  Tulasne,  D.,  Carpén,  O. and  Ivaska,  J. 2014. Tensin-4-dependent MET stabilization is essential for survival and proliferation in carcinoma cells. Dev. Cell 29: 421–436.
• 18.   Martuszewska,  D.,  Ljungberg,  B.,  Johansson,  M.,  Landberg,  G.,  Oslakovic,  C.,  Dahlbäck,  B. and  Hafizi,  S. 2009. Tensin3 is a negative regulator of cell migration and all four Tensin family members are downregulated in human kidney cancer. PLoS One 4: e4350.
• 19.   Haynie,  D. T. 2014. Molecular physiology of the tensin brotherhood of integrin adaptor proteins. Proteins 82: 1113–1127.
• 20.   Best,  M. G.,  Sol,  N.,  Kooi,  I.,  Tannous,  J.,  Westerman,  B. A.,  Rustenburg,  F.,  Schellen,  P.,  Verschueren,  H.,  Post,  E.,  Koster,  J.,  Ylstra,  B.,  Ameziane,  N.,  Dorsman,  J.,  Smit,  E. F.,  Verheul,  H. M.,  Noske,  D. P.,  Reijneveld,  J. C.,  Nilsson,  R. J. A.,  Tannous,  B. A.,  Wesseling,  P. and  Wurdinger,  T. 2015. RNA-Seq of tumor-educated platelets enables blood-based pan-cancer, multiclass, and molecular pathway cancer diagnostics. Cancer Cell 28: 666–676.
• 21.   Sasaki,  H.,  Takahashi,  Y.,  Ogawa,  T.,  Hiura,  K.,  Nakano,  K.,  Sugiyama,  M.,  Okamura,  T. and  Sasaki,  N. 2020. Deletion of the Tensin2 SH2-PTB domain, but not the loss of its PTPase activity, induces podocyte injury in FVB/N mouse strain. Exp. Anim. 69: 135–143.
• 22.   Korinek,  V.,  Barker,  N.,  Morin,  P. J.,  van Wichen,  D.,  de Weger,  R.,  Kinzler,  K. W.,  Vogelstein,  B. and  Clevers,  H. 1997. Constitutive transcriptional activation by a β-catenin-Tcf complex in APC-/- colon carcinoma. Science 275: 1784–1787.
• 23.   Veeman,  M. T.,  Slusarski,  D. C.,  Kaykas,  A.,  Louie,  S. H. and  Moon,  R. T. 2003. Zebrafish prickle, a modulator of noncanonical Wnt/Fz signaling, regulates gastrulation movements. Curr. Biol. 13: 680–685.
• 24.   Nishino,  T.,  Sasaki,  N.,  Nagasaki,  K.,  Ahmad,  Z. and  Agui,  T. 2010. Genetic background strongly influences the severity of glomerulosclerosis in mice. J. Vet. Med. Sci. 72: 1313–1318.
• 25.   Sasaki,  H.,  Sasaki,  N.,  Nishino,  T.,  Nagasaki,  K.,  Kitamura,  H.,  Torigoe,  D. and  Agui,  T. 2014. Quantitative trait Loci for resistance to the congenital nephropathy in tensin 2-deficient mice. PLoS One 9: e99602.
• 26.   Zhan,  T.,  Rindtorff,  N. and  Boutros,  M. 2017. Wnt signaling in cancer. Oncogene 36: 1461–1473.
• 27.   Novak,  A.,  Hsu,  S. C.,  Leung-Hagesteijn,  C.,  Radeva,  G.,  Papkoff,  J.,  Montesano,  R.,  Roskelley,  C.,  Grosschedl,  R. and  Dedhar,  S. 1998. Cell adhesion and the integrin-linked kinase regulate the LEF-1 and β-catenin signaling pathways. Proc. Natl. Acad. Sci. USA 95: 4374–4379.
• 28.   Acconcia,  F.,  Barnes,  C. J.,  Singh,  R. R.,  Talukder,  A. H. and  Kumar,  R. 2007. Phosphorylation-dependent regulation of nuclear localization and functions of integrin-linked kinase. Proc. Natl. Acad. Sci. USA 104: 6782–6787.
• 29.   Elad,  N.,  Volberg,  T.,  Patla,  I.,  Hirschfeld-Warneken,  V.,  Grashoff,  C.,  Spatz,  J. P.,  Fässler,  R.,  Geiger,  B. and  Medalia,  O. 2013. The role of integrin-linked kinase in the molecular architecture of focal adhesions. J. Cell Sci. 126: 4099–4107.
• 30.   Amit,  S.,  Hatzubai,  A.,  Birman,  Y.,  Andersen,  J. S.,  Ben-Shushan,  E.,  Mann,  M.,  Ben-Neriah,  Y. and  Alkalay,  I. 2002. Axin-mediated CKI phosphorylation of β-catenin at Ser 45: a molecular switch for the Wnt pathway. Genes Dev. 16: 1066–1076.
• 31.   Rubinfeld,  B.,  Albert,  I.,  Porfiri,  E.,  Fiol,  C.,  Munemitsu,  S. and  Polakis,  P. 1996. Binding of GSK3β to the APC-β-catenin complex and regulation of complex assembly. Science 272: 1023–1026.
• 32.   Fodde,  R. 2002. The APC gene in colorectal cancer. Eur. J. Cancer 38: 867–871.
• 33.   Hafizi,  S.,  Ibraimi,  F. and  Dahlbäck,  B. 2005. C1-TEN is a negative regulator of the Akt/PKB signal transduction pathway and inhibits cell survival, proliferation, and migration. FASEB J. 19: 971–973.
• 34.   Hafizi,  S.,  Gustafsson,  A.,  Oslakovic,  C.,  Idevall-Hagren,  O.,  Tengholm,  A.,  Sperandio,  O.,  Villoutreix,  B. O. and  Dahlbäck,  B. 2010. Tensin2 reduces intracellular phosphatidylinositol 3,4,5-trisphosphate levels at the plasma membrane. Biochem. Biophys. Res. Commun. 399: 396–401.
• 35.   Tan,  C.,  Costello,  P.,  Sanghera,  J.,  Dominguez,  D.,  Baulida,  J.,  de Herreros,  A. G. and  Dedhar,  S. 2001. Inhibition of integrin linked kinase (ILK) suppresses β-catenin-Lef/Tcf-dependent transcription and expression of the E-cadherin repressor, snail, in APC-/- human colon carcinoma cells. Oncogene 20: 133–140.
• 36.   Carter,  J. H.,  Douglass,  L. E.,  Deddens,  J. A.,  Colligan,  B. M.,  Bhatt,  T. R.,  Pemberton,  J. O.,  Konicek,  S.,  Hom,  J.,  Marshall,  M. and  Graff,  J. R. 2004. Pak-1 expression increases with progression of colorectal carcinomas to metastasis. Clin. Cancer Res. 10: 3448–3456.
• 37.   Tabusa,  H.,  Brooks,  T. and  Massey,  A. J. 2013. Knockdown of PAK4 or PAK1 inhibits the proliferation of mutant KRAS colon cancer cells independently of RAF/MEK/ERK and PI3K/AKT signaling. Mol. Cancer Res. 11: 109–121.