Article ID: 2025-009
Large-scale production of recombinant adeno-associated viruses (rAAV) for clinical use involves bioreactors and complex purification processes. Monitoring genomic DNA during manufacturing procedures is crucial to ensure the quality of the final product, as production can vary from batch to batch. We conducted a 50-L bioreactor production, with sampling conducted at each processing step, from transfection to anion-exchange chromatography purification. The rAAV genome can be monitored in transfected cells via a concise DNA extraction method, even in the presence of cellular impurities, using automated electrophoretic quantification with a TapeStation. The rAAV genomic DNA recovery rate was 64% for the affinity column and 41% for anion exchange, as measured using the TapeStation, whereas droplet digital polymerase chain reaction yielded recovery rates of 51% and 45% for the affinity and anion-exchange columns, respectively. Therefore, automated electrophoresis is a reliable and quantitative method for monitoring rAAV genome integrity during production.
▪ We applied automated electrophoresis to monitor a 50-L manufacturing process of recombinant adeno-associated viruses.
▪ This convenient method provides precise quantification comparable to droplet digital polymerase chain reaction while enabling direct DNA size monitoring, which is a crucial metric for ensuring batch-to-batch consistency and product quality.
Recombinant adeno-associated virus (rAAV) vectors offer great potential for gene therapy because of their safety and efficiency in delivering genetic material to target cells [1, 2]. All rAAV production systems share common components that support vector genome replication and packaging. The rAAV genome is structured with two inverted terminal repeats (ITR) flanking the gene of interest (GOI), replacing the viral genes rep and cap. rAAV production is achieved utilizing mammalian cells through transient transfection with a GOI plasmid, along with plasmids carrying rep, cap, and encoding helper factors [3, 4].
rAAV manufacturing involves cultivation in bioreactors and purification processes combined with chromatography steps [4,5,6,7,8]. Monitoring the rAAV genome during the manufacturing process is crucial for quality control. Quantitative real-time polymerase chain reaction (qPCR) and droplet digital PCR (ddPCR) have primarily been used to quantify rAAV owing to their precise quantification properties and broad detection range [9,10,11,12,13]. However, PCR cannot discriminate between complete and truncated rAAV genomes. In the intermediate and final products, rAAV capsids contain both partial rAAV genomes and DNA impurities derived from the three transfection plasmids and host cell DNA [14, 15].
We previously demonstrated the robustness of the automated electrophoresis system TapeStation for the quantification and integrity of the rAAV genome [16]. Following a simple DNA extraction step, TapeStation allows for size-based resolution of the single-stranded rAAV genome, overcoming the limitations of accurate measurement owing to ITR-structure hindrance and plus-minus strand annealing. This report demonstrates that automated electrophoresis can effectively monitor the quality and quantity of the rAAV genome throughout the manufacturing process, from the transfection of mammalian cells to the final purification by anion-exchange chromatography in 50-L scale cultivation.
The rAAV2-ZsGreen1 crude extracts and final products were obtained from the Manufacturing Technology Association of Biologics (MAB). rAAV2-ZsGreen1 genome consists of a Cytomegalovirus (CMV) immediate early gene promoter, the ZsGreen1 reporter gene, and a bovine growth hormone (bHG) polyadenylation signal, all flanked by Inverted Terminal Repeat (ITR) derived from AAV2 at both ends. Viral production cells 2.0 (VPC2.0) (Thermo Fisher Scientific, Waltham, MA, USA, cat#A49784) were maintained in HE400AZ medium (Gmep Inc., Fukuoka, Japan, cat#HE400AZ-0010). Scale-up was performed in a 50-L bioreactor (ZACROS Co., Tokyo, Japan) at 37°C, pH 7.0, 210 rpm, and 40% dissolved oxygen. For transient transfection, optimal Good Laboratory Practice parameters were employed: a cell density of 3 × 106 cells/ml, 1.5 µg of plasmid DNA per 3 × 106 cells, and a three-plasmid ratio of pAAV-ZsGreen1 (Takara Bio, Shiga, Japan, cat#6231): pRC2-mi342 (Takara Bio, cat#6234): pHelper (Takara Bio, cat#6234) (1:1:1). The three plasmids were purified using chromatography. Plasmid DNA was premixed with FectoVIR-AAV (PolyPlus-transfection, Illkirch-Graffenstaden, France, cat#101000004) and transfected into a culture medium weighing approximately 50 kg. During viral production, glucose and GlutaMAX Supplement (Thermo Fisher Scientific, cat#35050038) were maintained at 6 g/l and 4 mM, respectively. VPC2.0 were harvested 72 hr post-transfection, solubilized, and rAAV particles were released using lysis buffer with the addition of a conditioning buffer and 90 U/ml benzonase (Merck Millipore, Darmstadt, Germany, cat#1.01697.0001) at 37°C for 60 min. Absorbance reagents were added to the bioreactor lysate to remove protein impurities. The lysates were clarified using a filtration system. For downstream purification, HiTrap Capto AVB chromatography resin (Cytiva, Marlborough, MA, USA) was used for rAAV particle recovery. The HiTrap Capto AVB chromatography resin scale was 515 ml, and 67.8 kg of clarified rAAV2 was loaded. Elution was achieved using an elution buffer (20 mM acetic acid and 100 mM NaCl, pH 3.5), yielding 402 g of the product. Subsequently, 187 g of the affinity eluate was loaded onto an anion-exchange (AEX) column and the particles were recovered.
Particle DNA visualizationFirst, 100 µl of samples containing rAAV particles were collected at various bioprocessing steps. Benzonase (10 U) was added to degrade free DNA or RNA contaminants. To extract the DNA associated with rAAV particles, rAAV capsid shells were disrupted using the phenol/chloroform extraction method. The extracted DNA was then concentrated using an Amicon Ultra-0.5 centrifugal filter with a 100 kDa molecular weight cutoff (Millipore, cat#UFC510096) to remove salts. The concentrated DNA was purified using 1.8× AMPure XP beads (Beckman Coulter, Brea, CA, USA cat#A63880). Finally, the purified DNA was eluted in 30 µl of double-distilled water. DNA extraction ensured the coverage of short fragments, such as free ITR fragments, using an Amicon-30 kDa filter unit with confirmed recovery of 100 nt oligos, and a 1.8× AMPure XP bead ratio with partial recovery of 200 bp DNA. To visualize and measure the size of purified particle DNAs, denaturation was performed at 75°C for 5 min with a 1:1 mixture of sample DNA and a denaturing reagent (Agilent Technologies, Santa Clara, CA, USA, cat# 5067-5580). Denatured DNA was analyzed using a High-Sensitivity RNA ScreenTape on an Agilent TapeStation system (Agilent Technologies) and automatically quantified using TapeStation Analysis Software 3.2 (Agilent Technologies).
ddPCR quantification of particle DNAAll primers and probes were custom-synthesized and purified by high-performance liquid chromatography (Eurofins Genomics K.K). The primer and probe sequences are as follows: Primer-F: 5′-GGAACCCCTAGTGATGGAGTT-3′, Primer-R: 5′-CGGCCTCAGTGAGCGA-3′, Probe: [FAM]CACTCCCTCTCTGCGCGCTCG [BHQ1]. The ddPCR reaction mixture contained 10 µl of ddPCR Supermix for probes (Bio-Rad Laboratories, Hercules, CA, USA, cat#186-3010), 2 µl of primers (with a final concentration of each primer at 0.9 µM), 1 µl of probe (final concentration 0.25 µM), and 1 µl of the template DNA diluted in TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) containing 0.05% FP-68, in a final volume of 20 µl. Each DNA template was tested in triplicates at two dilutions. The plates were transferred to a QX200 Automated Droplet Generator (Bio-Rad Laboratories). A 96-well plate containing generated droplets was transferred to a C1000 Touch Thermal Cycler (Bio-Rad Laboratories) for amplification. The cycling conditions were as follows: 10 min at 95°C, followed by 40 cycles of a two-step thermal profile comprising 30 sec at 94°C and 60 sec at 60°C. The plate was then transferred to a QX200 droplet reader (Bio-Rad Laboratories), and the data were analyzed using QuantaSoft software (version 1.7.4.0917; Bio-Rad Laboratories). The threshold separating the negative and positive droplets was manually set just above or below the clusters of negative and positive droplets, respectively.
Analysis of the rAAV genome is crucial for monitoring the yield and purity from upstream to downstream manufacturing procedures. In this study, HEK293-derived floating VPC2.0 cells were thawed, expanded, and used to produce rAAV. Plasmid transfection was conducted in a 50-L bioreactor using FectoVIR-AAV (Fig. 1A), with production starting at approximately 50 kg. A distinct band corresponding to the 2.6-kb rAAV2-ZsGreen1 genome was observed immediately post-transfection (Fig. 1B). The rAAV genome is mixed with a large amount of cellular DNA and cell debris in these cell culture crudes during upstream processing. Hence, the pretreatment of these crude samples is an important step in rAAV quantification using ddPCR and automated electrophoresis. rAAV2 DNA extracts were prepared from 100 µl VPC2.0 cell crudes on days 1, 2, and 3 post-transfection, treated with benzonase and extracted using phenol-chloroform, and finally denatured and analyzed on TapeStation (Fig. 1B). The 2.6 kb rAAV2-ZsGreen1 DNA was not detected on day 1 but was visible on days 2 and 3. Benzonase treatment digested cellular DNA impurities into smear bands (<0.5 kb) (Fig. 1B), and rAAV genomic DNA was efficiently extracted from the sample using phenol-chloroform extraction, which isolates the genome from the capsid. On day 3, the cells were harvested and lysed, and the cell lysates were clarified using tangential flow filtration. In these lysate and filtration samples, the 2.6-kb rAAV2-ZsGreen1 genome was present, demonstrating the efficiency of rAAV genome extraction and cellular debris removal. This simple extraction of the rAAV genome successfully allowed clear detection of the 2.6-kb single-stranded DNA using TapeStation (Fig. 1B).
Schematic representation of a 50-L recombinant adeno-associated virus (rAAV2)-ZsGreen1 production process using viral production cells 2.0 (VPC2.0) cells. (A) Upstream processing includes cell culture and transfection, solubilization, and clarification, followed by purification involving affinity chromatography and two continuous anion-exchange chromatography steps. The liquid volume or weight was marked, and samples were collected at each point during production and purification. Measurement of rAAV particle genomic DNA was conducted using the automated electrophoresis system, TapeStation. (B) Upstream processing samples, lane 1: 1-kb dsDNA ladder; lanes 2–4: samples from transfection day 1 to 3; lanes 5–6: lysate samples, including the solubilized and benzonase-treated samples; lanes 7–8: sample after two filtrations using tangential flow filtration (TFF). (C) Affinity column samples: lane 1:1-kb dsDNA ladder; lanes 2–6: loading sample, flow-through, column washing, elution, and wash-out collections. (D) Anion exchange samples of the 2nd column: lane 1: 1-kb dsDNA ladder; lanes 2–7: loading sample, flow-through, column washing, empty particle, full particle elution, and wash-out collections. For this, 100 µl of samples were subjected to a particle DNA preparation step, including Benzonase treatment, phenol-chloroform extraction, and finally AMPure XP beads clean-up. DNA extract was dissolved in 30 µl of double distilled water and samples were run on HS (high sensitive) RNA ScreenTape, under the customized stronger denaturing condition, with a 1:1 ratio of denature loading buffer to sample, incubated at 72°C for 5 min. Specifically, a highly condensed affinity column elution was run at its original concentration to visualize the truncated genomic segments. Quantification was performed using a 10-fold diluted sample. The arrow highlighted the 2.6-kb band corresponding to the full-size rAAV2-ZsGreen1 genome.
Purification involved a two-step chromatographic process. Affinity chromatography selectively enriched well-formed viral particles with or without encapsulated DNA. Automated electrophoresis revealed a 2.6-kb genome in the elution peak, along with short smear bands. No 2.6-kb DNA was detected in the pass-through or wash samples from affinity column chromatography. After affinity column purification, the rAAV fraction contained empty capsids and lacked rAAV genomic DNA. AEX chromatography further separated particles based on the increasing charge relative to the packed particle DNA content [17]. The empty fraction did not show the presence of the rAAV genome, whereas the full capsid fraction revealed an intensive 2.6-kb band. In affinity column purification, the loaded rAAV was 8.6E+14 copies (1.2 g of rAAV full-length genomic DNA in 0.4 kg), eluted rAAV was 5.0E+14 copies (0.71 g of rAAV full-length genomic DNA in 0.4 kg), and the AEX collection was 4.2E+14 copies (0.59 g of rAAV full-length genomic DNA in 2.1 kg). The recoveries from affinity and AEX purification were 58% and 49%, respectively. These results indicate that the amount and integrity of the encapsulated intact rAAV genome can be monitored using automated electrophoresis. The pretreatment of rAAV samples to extract the rAAV genome was simple and robust.
Quantifying rAAV particles using automated electrophoresis and ddPCRThrough vector production and purification, rAAV genome copy numbers were determined in the same samples using ddPCR targeting the ITR region (Fig. 2). The amount of the rAAV genome was measured using automated electrophoresis based on band intensity and compared with ddPCR measurements. In the transfected cells on day 3, the ratio was 0.7-fold, likely because of the high presence of free ITRs and partial particles in the collections. However, in the clarified samples, the ratio increased by 0.8-fold, which is consistent with the abundance of ITRs in a mixture of empty, partial, and full particles, exceeding that of the full-length genome. During the purification process, 58% and 49% recovery rates were determined by genome band intensity on the TapeStation for the affinity and AEX columns, respectively. In contrast, 40% and 31% were determined by ITR-ddPCR analysis. This indicates the effectiveness of the well-formed capsid and filled particle recovery following the purification procedure. After purification, the rAAV genome declined more/greater in ITR-ddPCR measurements than in genome band intensity measurements, suggesting that ddPCR artifacts rely on ITR abundance. ITRs are more abundant than other regions because of their role in packaging initiation, as supported by deep sequencing data [18, 19]. The ITR was captured using ddPCR, leading to an overestimation of the rAAV yield. TapeStation detects the target genome-size band, minimizing measurement bias toward ITR. These results suggest that automated electrophoresis is a valuable supplementary method to ddPCR for rAAV quantification. It offers reliable insights into particle DNA integrity, owing to its ability to detect full-length or partially full-length genomes, providing a comprehensive view, in addition to the targeted ddPCR approach.
Particle DNA quantification using TapeStation and droplet digital polymerase chain reaction (ddPCR). For automated electrophoresis (TapeStation) AE, purified particle DNA was measured using the HS RNA ScreenTape. For ddPCR, genome copies were measured by targeting the inverted terminal repeats (ITRs). Error bars represent the standard deviation from three independent measurements. Measured values of DNA mass were converted into a copy number of 7 × 108copies/ng of DNA. The yield of 50-L recombinant adeno-associated virus (rAAV) production was calculated by multiplying by the liquid volume shown in Fig. 1A. The y-axis shows the yield in copy number, presenting the rAAV titer units.
Our 50-L production system with transient transfection and suspension cultivation of VPC2.0 cells achieved a yield exceeding 1.0E+15 rAAV particles with intact genomes. This demonstrates the potential of this approach for large-scale rAAV production, with the production reaching up to 3.0E+13 viral particles per L. The usual expectation is 1.0E+4 particles per cell in a transfection-production system. In the bioreactor, the cell density could be maintained at 3.0E+6 per ml, and particle production could reach up to 3.0E+13 per L. Maintenance of consistency and quality in rAAV industrial production is crucial for effective gene therapy applications. Several factors, including cell media, cell line stability, cultivation conditions, and purification procedures can introduce lot-to-lot variability and affect particle homogeneity. In this study, we performed a simple and concise assay to assess the particle genome amount and integrity, through upstream and downstream production processes.
To ensure the infectious efficacy of the rAAV particles, the integrity of the rAAV genome was evaluated by automated electrophoresis after a brief sample pretreatment procedure. This method directly measures the rAAV genome, and its detection accuracy relies on a sample preparation procedure. Our previous study showed that heat treatment and denaturing electrophoresis on a TapeStation coincided with heat-treated ddPCR measurements when purified rAAV samples were handled [16]. In the present study, we observed the rAAV production streamline, while manufacturing solution conditions led to difficulties in sample preparation. Pretreatment needs to remove cellular proteins and DNA and break the virus capsids. This approach balances two aspects: preserving the natural ITR structure of rAAV genomes and minimizing single strand DNA breaks caused by heat and harsh organic reagents, including rAAV genomic (+) and (−) strand native or random annealing in solution. These factors effect on the accuracy of ddPCR measurements. TapeStation method observes the denatured DNA and detects rAAV genome non-preferentially using this appropriate sample preparation, resolving ddPCR defects. Furthermore, the manufacturing level of the rAAV genome, even the original culture crudes, with 7 × 1010 copies/ml equal to 0.1 ng/µl of the 2.6-kb genome, lies in the TapeStation measurement range [16]. rAAV manufacturing can be easily monitored during the production stages. Notably, losses during sample preparation were related to protein precipitation, liquid volume loss during phenol-chloroform extraction, and DNA-bead binding rate.
Heterogeneity of the particle genome is a significant challenge in rAAV production. Several analytical methods are available for analyzing the homogeneity of rAAV particles, including analytical ultracentrifugation (AUC), electron microscopy (EM), and PCR-based methods, which are currently considered industry standards. However, these approaches have certain drawbacks [20, 21]. Although the AUC is employed as a preparatory purification technique to fractionate empty rAAV from filled particles, it requires relatively large sample quantities, exceeding approximately 1.0E+12 viral genomes [20]. Negative-staining EM generally requires a smaller sample volume but introduces the risk of particle damage during staining and drying procedures, potentially resulting in genome release and a consequent bias toward empty capsids. Furthermore, staining artifacts can complicate the differentiation between fully packed capsids and partially filled particles in EM analysis [21]. Recently, mass photometry and charge-detection mass spectrometry have been used to characterize empty and filled rAAV particles; however, these methods are not necessarily suitable for the analysis of crude rAAV samples. PCR-based methods, which are concise and widely used to determine genome titers, do not provide information on genome integrity and can overestimate titers owing to the presence of partially truncated genomes. In this study, the automated electrophoretic profile confirmed the intact size of the rAAV genome at each step of the production and purification processes. The proposed method can be readily adapted to various rAAV production settings, including mammalian, insect, and yeast systems [22]. This versatility makes it a valuable tool for real-time monitoring of viral particle DNA across different production platforms. Moreover, by enabling the in-process testing of genomic DNA, this assay can help detect and address inconsistencies in the titer (genome copy) and integrity (genome size) of rAAV lots. Consequently, this approach may contribute to maintaining the efficacy and reliability of rAAV-based therapies.
This study was funded by the Japan Agency for Medical Research and Development (AMED; grant numbers: JP18ae0201001 and JP18ae0201002).
The authors declare no conflict of interest associated with this work.
We thank the Manufacturing Technology Association of Biologics (MAB) for providing the crude extracts and final products of the rAAV2-ZsGreen1 samples.
