Transcriptional Activation of Mouse Major Satellite Regions during Neuronal Differentiation

Abstract

Recent studies have revealed various biological functions for repetitive sequences, which make up about half of the human genome. One such sequence, major satellites, which are tandem repetitive sequences adjacent to the centromere, have been shown to be a kinetochore component that plays a role in the formation and function of the pericentric heterochromatin necessary for mitosis. However, it is unknown whether these regions also play a role in post-mitotic cells. Here, we show that, during neuronal differentiation, the heterochromatin domains that include major satellite regions become both enriched with the active histone modification lysine-4 trimethylation of histone H3, and more sensitive to nuclease, both of which suggest increased activation of this area. Further supporting this notion, we also found that transcription from major satellite regions is significantly increased during neuronal differentiation both in vitro and in vivo. These results together suggest that the structural and transcriptional state of major satellite regions changes dramatically during neuronal differentiation, implying that this region might play a role in differentiating neurons.

Introduction

In the last decade, the genome sequencing of several model organisms revealed that mammals have a highly complex genome organization, largely resulting from the accumulation of repetitive elements and noncoding sequences (Lander et al., 2001; Waterston et al., 2002). In the mouse genome, repetitive elements account for a large portion of the DNA content (about 45%), whereas only 2∼5% encodes proteins. As a result, most mammalian genes are disrupted with long, intervening, often repetitive sequences. Although historically referred to as “junk DNA”, recent reports have uncovered biological functions of such repetitive sequences. For instance, previous reports have shown somatic retrotransposition of long interspersed elements (LINE) and short interspersed elements (SINE) in mouse and human brains and have suggested that these retrotranspositions alter the expression levels of nearby genes and contribute to neuronal mosaicism (Baillie et al., 2011; Muotri et al., 2005). ID element, a type of SINE, has indeed been found to be included in the introns of genes whose mRNAs are localized to the dendrites, and to function as a common dendritic target (Buckley et al., 2011). Mammalian specific SINE elements have also been implicated as enhancers for neighboring genes that function in mammalian specific brain development (Sasaki et al., 2008).

Pericentric and centric satellite repeats, types of tandem repeat sequence found in the heterochromatin of both mouse and human genomes, are required for the formation of mitotic spindles and faithful chromatin segregation (Amor et al., 2004; Probst et al., 2009). In the mouse genome, major (pericentric) and minor (centric) satellites, both of which are generally transcriptionally inactive due to enrichment with repressive histone and DNA modifications and repressive transcription factors (Lehnertz et al., 2003; Lewis et al., 1992; Manuelidis, 1981; Martens et al., 2005; Skene et al., 2010). However, recent papers have shown that major satellite regions are transcribed and that their transcripts play an important role in early embryogenesis and in genomic instability during tumorigenesis (Probst et al., 2010; Santenard et al., 2010; Zhu et al., 2011). Increased transcription of major satellites has also been observed in cancer cells, suggesting a positive correlation between derepression of major satellites and tumor formation (Ting et al., 2011; Zhu et al., 2011). Unlike the crucial roles of major satellite regions in mitotic cells, the roles of these regions in post-mitotic cells, if any, have not been demonstrated. However, previous evidence suggests a possible role for major satellite regions during neuronal differentiation. DNA-fluorescence in situ hybridization (DNA-FISH) analysis indicated that the number, localization, and size of major satellite foci change during development of post-mitotic Purkinje neurons or rod photoreceptors (Solovei et al., 2004, 2009). Furthermore, long-term potentiation-inducing stimuli were shown to decrease the number of major satellite foci in post-mitotic hippocampal neurons (Billia et al., 1992), and transcripts from major satellite regions have been detected in the developing neocortex (Rudert et al., 1995). However, it is not known if such changes are accompanied by changes in chromatin state and transcriptional activity, which would more strongly support the notion that major satellite regions have some function in neuronal differentiation.

Here, we show marked chromatin-level changes in major satellite regions during neuronal differentiation in the developing mouse neocortex. Major satellite regions became more sensitive to nuclease and transcriptionally active during neuronal differentiation, suggesting their role in post-mitotic neurons.

Materials and Methods

Antibodies

Antibodies for immunofluorescence analysis included mouse antibodies to βIII-tubulin (TuJ1, Covance) and to Nestin (BD Biosciences); goat antibodies to Dcx (Santa Cruz Biotechnology) and to Sox2 (Santa Cruz Biotechnology); and rabbit antibodies to H3K4Me3 (#1, active motif, the information of immunogen is not open; #2, abcam, the immunogen is a modified peptide derived from the residues 1–100 of human histone H3) and to H3K9Me3 (abcam). Alexa-labeled secondary antibodies and Hoechst 33342 (for nuclear staining) were obtained from Molecular Probes.

Primary cell cultures

Primary NPCs were prepared from the dorsal cerebral cortex of ICR mouse embryos at E11.5 (E1 was defined as 12 hours after detection of the vaginal plug). Dissected cortices were transferred to artificial cerebrospinal fluid (aCSF: 124 mM NaCl, 5 mM KCl, 0.1 mM CaCl₂, 26 mM NaHCO₃, 1.3 mM MgCl₂, 10 mM glucose) containing 0.05% trypsin (Sigma) and incubated for 10 minutes on ice to remove the overlying epidermal ectoderm. The cortices were then transferred to aCSF containing 0.1% trypsin, DNase I (0.1 mg/ml) (Roche), and hyaluronidase (0.67 mg/ml) (Sigma) and incubated at 37°C for 10 minutes. After the addition of an equal volume of aCSF containing trypsin inhibitor (0.7 mg/ml) (Sigma), the neuroepithelium was transferred to DMEM-F12 (1:1) and mechanically dissociated into single cells. The dissociated cells were cultured in DMEM-F12 (1:1) (Sigma) supplemented with B27 (Invitrogen), FGF2 (20 ng/ml; Invitrogen), and EGF (20 ng/ml; Upstate Biotechnology). After 3 days, they were dissociated with trypsin and plated in poly-D-lysine coated dishes.

DNA-FISH

Cells were fixed with 4% PFA for 15 min. They were then permeabilized with 0.5% saponin, 0.5% Triton X-100 and 10 μg/ml RNase for 15 min and treated with 0.1 N HCl for 10 min. Cells were denatured for 10 min at 75°C in 50% formamide with 2 × SSC. Hybridization was performed overnight at 37°C with digoxigenin (DIG)-labeled probes and detected with FITC-conjugated anti-DIG antibody (Roche). The probe for DNA-FISH was generated by nick translation of major satellite DNA with the DIG-Nick Translation Kit (Roche). The major satellite DNA was amplified by PCR from mouse genomic DNA with following primers; GCGAGAAAACTGAAAATCAC and TCAAGTCGTCAAGTGGATG.

Immunocytofluorescence analysis

For immunostaining, cells were fixed with 2% formaldehyde in PBS for 20 min at room temperature, permeabilized with 0.2% Triton X-100 in PBS for 10 min, incubated first with primary antibodies overnight at 4°C and then with secondary antibodies for 30 min at room temperature, and mounted in Mowiol (Calbiochem). In the quantification analysis, we judged “enriched in chromocenters” when more than half of the chromocenters visualized with Hoechst were associated with immunostaining signals of H3KxMex clearly stronger than those at the euchromatin regions. Other staining patterns were categorized as “diffused in nuclei”.

MvaI digestion analysis

4–5×10⁵ cells were suspended in 100 ml buffer A [0.32 M sucrose, 15 mM HEPES-NaOH (pH 7.9), 60 mM KCl, 2 mM EDTA, 0.5 mM EGTA, 0.5% bovine serum albumin, 0.5 mM spermidine, 0.15 mM spermine, and 0.5 mM dithiothreitol], layered on a cushion of 100 ml buffer A containing 30% sucrose, and centrifuged at 3000×g for 5 min at 4°C. The nuclear pellet was suspended in 100 ml buffer M [20 mM Tris-HCl (pH 7.5), 70 mM NaCl, 20 mM MgCl₂, 3 mM CaCl₂, 0.5 mM spermidine, 0.15 mM spermine, and 0.5 mM dithiothreitol] with 10× K buffer (Takara), and digested with MvaI (Takara) at 37°C for 5 min. The reaction was terminated with EDTA, and the digested DNA fragments were purified with phenol-chloroform, and analyzed with agarose gel electrophoresis with ethidium bromide staining. Total DNA was prepared from chromatin fractions by sonication. ImageJ software (NIH) was used for band quantification of digested DNA.

Separation of VZ-IMZ from CP

Neocortices of E16.5 mouse embryos were manually dissected and separated into the apical (VZ-IMZ) and basal (CP) regions based on their transparency with a light microscope. To confirm the dissection, the cells were plated onto dishes for 30 min, fixed, and immunostained with antibodies recognizing markers for each layer marker. Nestin-, Sox2-, Tbr2- and Ki67-positive cells were enriched in the VZ to IMZ cells compared to cells prepared from total neocortex (data not shown). In contrast, Map2- and Ctip2-positive cells were enriched in the CP cells (data not shown).

Quantitative RT-qPCR analysis

Total RNA isolated from primary cultures with the use of RNeasy (Qiagen) was subjected to reverse transcription (RT) with Rever-Tra Ace qPCR RT Kit (Toyobo). The resulting cDNA was subjected to real-time PCR analysis in a Roche LightCycler with SYBR Premix Ex Taq (Takara). The amount of target RNA was normalized with GAPDH mRNA. The sense and antisense primers, respectively, were as follows: GAPDH, 5′-CTGAACGGGAAGCTCAC-3′ and 5′-GTCATCATACTTGGCAGGT-3′; major satellite, 5′-GCGAGAAAACTGAAAATCAC-3′ and 5′-TCAAGTCGTCAAGTGGATG-3′; and βIII-tubulin, 5′-GAAGTTCGTGCGATCCC-3′ and 5′-CCCTCTTCTCAAGATCCTCTCTA-3′.

Statistical analysis

Quantitative data are presented as means±SD. Values were compared with the paired (Fig. 2, Fig. 3) or unpaired (Fig. 1) Student’s t test, with a P value of <0.05 being considered statistically significant. *P<0.05, **P<0.01. Representative data are from experiments that were repeated a total of at least three times with similar results. The number of experiments in each figures were follows;

• Fig. 1A, n=3; 1B-G, n=3.
• Fig. 2B, n=6.
• Fig. 3A, n=4; 3B, n=3.

Fig. 1.

H3K4Me3 becomes localized to chromocenters during neuronal differentiaiton. (A) DNA-FISH was performed with primary mouse cells. The fixed cells were hybridized with a DIG-labeled DNA probe recognizing major satellite sequences. They were then immunostained with an antibody recognizing DIG (green) and counterstained with Hoechst (blue). Scale bar, 10 μm. (B–G) Primary NPCs were prepared from 3-day sphere cultures [3 days in vitro (3 DIV)] of neocortical cells from E11.5 ICR mice. The NPCs were plated in poly-D-lysine-coated dishes and incubated with FGF2 for 1 day. After that, the cells were cultured for three days, half with FGF2 and half without it. The cells were immunostained with the indicated antibodies and counterstained with Hoechst. Representative images are shown (B, D, F). Arrows indicate Sox2- or Nestin-positive NPCs, and arrowheads indicate βIII-tubulin- or Dcx-positive neurons. Quantifications of the localization of histone modifications were shown (C, E, G). Although the H3K9Me3 signals seem weak in NPCs in (F), the levels of H3K9Me3 signals were similar between NPCs and differentiating neurons when immunocytochemistry was performed after autoclaving the samples (data not shown). Scale bars, 10 μm. All quantitative data are means±SD values.

Fig. 2.

Major satellite regions become sensitive to nuclease during neuronal differentiation. (A) A schematic representation of a typical mouse acrocentric chromosome is shown. Major satellite regions are located adjacent to the centromere and consist of 234 bp repetitive sequences. One unit of major satellite repeats has a single MvaI cleavage site. (B, C) Isolated nuclei from FGF2 (+) or FGF2 (–) cells were treated with the indicated MvaI concentrations. The digested DNA was analyzed using agarose gel electrophoresis and ethidium bromide detection (B). DNA fragments of 3 units of major satellite repeats were quantified and shown as mean±SD values (C).

Fig. 3

Transcription from major satellite regions increases during neuronal differentiation. (A) RNA isolated from FGF2 (+) or FGF2 (–) cultures was reverse transcribed, and the cDNA was analyzed using qPCR with primers for major satellite regions and βIII-tubulin. (B) The VZ-IMZ or CP regions were manually dissected from the E16.5 mouse neocortex, and the isolated cells were analyzed with RT-qPCR. We also found that the level of major satellite RNA per that of total RNA increases during neuronal differentiation (data not shown). All quantitative data are means±SD values.

Results

Histone H3 lysine-4 trimethylation becomes localized to chromocenters during neuronal differentiation

Because of the previous observation that the number, location and size of major satellite foci change during neuronal development, we asked whether neuronal differentiation is also accompanied by changes in the chromatin state of these regions (Billia et al., 1992; Solovei et al., 2004, 2009). We used immunostaining to examine histone modifications, a reflection of chromatin state, in major satellite regions during neuronal differentiation. To identify the changes occurring during neuronal differentiation, we compared undifferentiated neural precursor cells (NPCs) to differentiating neurons. Neocortical neuroepithelial cells were isolated at embryonic day (E) 11.5, cultured as neurospheres for 3 days in vitro in the presence of fibroblast growth factor (FGF) 2 and epidermal growth factor (EGF), and then plated as a monolayer culture. To obtain both NPCs and differentiating neurons, all cells were cultured with FGF2 for one day, and for the following 3 days, half were cultured with FGF2 and half without. Previous reports have shown that FGF2 maintains the undifferentiated state of neocortical NPCs (Johe et al., 1996), so FGF2 (+) cultures contain more undifferentiated NPCs, whereas FGF2 (–) cultures contain more differentiating neurons.

Immunostaining these cultures with an antibody against histone H3 lysine-4 trimethylation (H3K4Me3), a modification associated with active transcription, revealed dynamic changes in H3K4Me3 localization relative to major satellite regions during neuronal differentiation. Because major satellite regions are mainly localized to chromocenters (Fig. 1A), which are identifiable by Hoechst staining, we used these regions to identify the major satellite regions’ location. We found that in the FGF2 (+) condition, NPCs (positive for Sox2 or Nestin) showed H3K4Me3 distributed diffusely throughout the nucleus (Fig. 1B, C), which is consistent with previous reports of euchromatic localization for H3K4Me3 (Solovei et al., 2009). Conversely, in FGF2 (–) cultures, we observed neurons (positive for βIII-tubulin or Doublecortin (Dcx)) showing H3K4Me3 localized to the chromocenters (Fig. 1B, C). Although, to our knowledge, there is no previous report showing H3K4Me3 localized to chromocenters, we confirmed this result with two different antibodies for H3K4Me3 (Fig. 1D, E). Interestingly, FGF2 (+) cultures produced some βIII-tubulin- or Dcx-positive neurons in addition to the NPCs, and these neurons also showed H3K4Me3 localized to the chromocenters (Fig. 1B–E), suggesting that this localization is due to neuronal differentiation rather than the absence of FGF2 per se.

We also immunostained for H3K9Me3, a repressive histone modification previously observed in major satellite regions (Lehnertz et al., 2003), and found it was localized to chromocenters in both Sox2- or Nestin-positive NPCs and βIII-tubulin- or Dcx-positive neurons (Fig. 1F, G). This result suggests that the active histone modification H3K4Me3 becomes co-localized with the repressive histone modification H3K9Me3 at chromocenters, at least at an immunostaining level, during neuronal differentiation.

Major satellite regions become sensitive to nuclease

Since localization of the active H3K4Me3 modification at chromocenters during neuronal differentiation implies structural changes of these regions, we next examined the chromatin condensation state in major satellite regions using biochemical nuclease digestion analysis. Nuclei isolated from the FGF2 (+) or FGF2 (–) cultures were digested with the restriction enzyme MvaI. Each unit of a major satellite repeat has a single MvaI recognition site (CCA/TGG) (Fig. 2A), so we could detect digested major satellite regions with agarose electrophoresis as ladders with bands in multiples of 234 bp. We observed significantly more laddered bands in the FGF2 (–) culture, than those from the FGF2 (+) culture (∼2-fold increase in the amount of 3-unit-band) (Fig. 2B, C), suggesting that the major satellite regions of differentiated neurons are more sensitive to nuclease, and therefore more decondensed, than those of undifferentiated NPCs. Previous reports have shown that genomic regions that are sensitive to nuclease are enriched with active loci, such as actively transcribed gene regions and regulatory elements (Boyle et al., 2008; Gargiulo et al., 2009). Therefore, this result suggests that major satellite regions become more transcriptionally active during neuronal differentiation, which is consistent with our finding of an increase in H3K4Me3 modification at these regions.

Transcription in major satellite regions is activated during neuronal differentiation

We next asked whether the observed localization of H3K4Me3 to chromocenters and the increase in nuclease sensitivity of multiple satellite regions are actually accompanied by an increase in transcription. RT-qPCR with primers for the major satellite regions revealed that the amount of RNA transcribed from these regions was over three-fold higher in the FGF2 (–) culture than in the FGF2 (+) culture (Fig. 3A), suggesting that neuronal differentiation is in fact accompanied by an increase in transcription of major satellite regions. Importantly, when we performed the reverse transcription step using only oligo-dT primers, we found they produced major satellite region cDNA, suggesting that transcripts from major satellite regions have poly (A) RNA and are therefore transcribed by RNA polymerase II as previously reported (Lehnertz et al., 2003; Lu and Gilbert, 2007; Rudert et al., 1995). In contrast, the levels of transcripts of SINE and the long terminal repeat (LTR) transposon intracesternal A-particle (IAP) did not markedly change during neuronal differentiation (data not shown).

We next examined whether the observed in vitro increase in transcription of major satellite regions during neuronal differentiation also occurs in vivo. We manually dissected E16.5 neocortical slices and separated the area where NPCs and immature neurons reside, namely the ventricular zone (VZ), subventricular zone (SVZ) and intermediate zone (IMZ), from the cortical plate (CP), which mostly contains neurons. We extracted RNA from each of these two areas and quantified the amount of major satellite region RNA in each. The CP yielded significantly more RNA from major satellite regions than the combined VZ, SVZ and IMZ (Fig. 3B), suggesting that, like in vitro, transcription of major satellite regions also increases during neuronal differentiation in vivo.

Discussion

Major satellite regions have been reported to be required for proper chromosome segregation in mitotic cells (Probst et al., 2009). Although it has been previously shown that the localization, number, and size of major satellite regions change during neural development (Billia et al., 1992; Solovei et al., 2004, 2009), we now show the first evidence that these changes are accompanied by a change in the chromatin state and transcriptional activity of this region. The major satellite regions are traditionally considered to be “silent” regions located within the heterochromatin and marked by repressive histone modifications. However, our results suggest that, at least in the neural system, they are instead “dynamic” regions that are “activated” during neuronal differentiation, when they become decondensed, modified by the “active” histone mark H3K4Me3, and more highly transcribed. Although a similar decondensation of the chromatin state and transcriptional activation in major satellite regions has been observed in embryonic stem cells (Efroni et al., 2008; Meshorer et al., 2006), this is the first report to show “activation” of the major satellite regions in a physiological context.

What is the significance of the “activation” of major satellite regions during neuronal differentiation? The roles of transcripts from major satellite regions have been so far demonstrated only in association with mitosis or mitosis-related genome instability (Probst et al., 2010; Santenard et al., 2010; Zhu et al., 2011). Although we cannot exclude the possibility that transcripts from major satellite regions are transcriptional “noise”, these transcripts may have some functions even in postmitotic cells, given that they have been shown to interact with key chromatin regulators such as HP1α (Maison et al., 2011). Modulation of these transcripts would be necessary to clarify their physiological roles in differentiating neurons.

Another key question is how transcription of major satellite regions is regulated in response to neuronal differentiation. While there are few reports of transcriptional activators of major satellite regions in mouse cells, several molecules, including HP1α/β, KDM2A, ADNP, HR6B, Suv39h1/2 and BRCA1, have been reported to repress transcription of these regions (Lehnertz et al., 2003; Mosch et al., 2011; Mulugeta Achame et al., 2010; Zhu et al., 2011). Our preliminary results suggest that the expression levels of Suv39h1/2 and BRCA1 decrease during neuronal differentiation (unpublished data by Y.K. and Y.G.). We believe that it is unlikely that reduction of the H3K9 methylases Suv39h1 and 2 accounts for the transcriptional activation of major satellite regions, since we did not detect a difference in H3K9Me3 staining at chromocenters between NPCs and differentiating neurons (Fig. 1F, G). However, previous reports show that BRCA1 is specifically expressed in NPCs in the developing neocortex, and contributes to their survival (Pulvers and Huttner, 2009), so it is therefore possible that the reduction of BRCA1 during neuronal differentiation induces transcriptional activation of major satellite regions.

While there are no reports of transcriptional activators of major satellite regions in mouse cells, HSF1 and Ikaros in human cells have been reported to activate the transcription of gamma satellite regions (Eymery et al., 2009b; Kim et al., 2009), which are a human analogue of major satellite regions (Eymery et al., 2009a). It is unlikely, however, that HSF1 or Ikaros activates transcription of major satellite regions in mouse cells, since HSF1 and Ikaros are sequence specific transcription factors, and the sequences of major and gamma satellite regions are very different. However, it is possible that major satellite regions have their own similar sequence-specific transcription factors that activate their transcription during neuronal differentiation. It is also possible that molecules involved in H3K4Me3 are involved in the activation of these regions, given that H3K4Me3 increases at chromocenters during neuronal differentiation. Indeed, Jarid1C, an H3K4Me3 demethylase (Iwase et al., 2007), was reduced during neuronal differentiation (unpublished data by Y.K. and Y.G.), suggesting that the increase of H3K4Me3 due to the decrease of the Jardi1C demethyase may activate major satellite regions.

Taken together, our observations demonstrate dynamic changes in major satellite regions during neuronal differentiation. Further investigation on functions of their transcripts and structural regulations of their genomic regions should shed light on the physiological roles of major satellite regions in post-mitotic neurons.

Acknowledgment

We thank Dr. T. Takizawa for DNA-FISH protocol; Ms. K. Tyssowski for editing the manuscript; members of the Gotoh laboratory for helpful discussion. This work was supported by Grants-in-Aid for Scientific Research (A) from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan, Innovative Areas “Neural Diversity and Neocortical Organization” of MEXT, by Core Research for Evolutional Science and Technology (CREST) of the Japan Science and Technology Agency, by the Japan Society for the Promotion of Science, and in part by the Global COE Program “Integrative Life Science Based on the Study of Biosignaling Mechanisms” of MEXT.

References

•  Amor,  D.J.,  Kalitsis,  P.,  Sumer,  H., and  Choo,  K.H. 2004. Building the centromere: from foundation proteins to 3D organization. Trends Cell Biol., 14: 359–368.
•  Baillie,  J.K.,  Barnett,  M.W.,  Upton,  K.R.,  Gerhardt,  D.J.,  Richmond,  T.A.,  De Sapio,  F.,  Brennan,  P.M.,  Rizzu,  P.,  Smith,  S.,  Fell,  M., et al. 2011. Somatic retrotransposition alters the genetic landscape of the human brain. Nature, 479: 534–537.
•  Billia,  F.,  Baskys,  A.,  Carlen,  P.L., and  De Boni,  U. 1992. Rearrangement of centromeric satellite DNA in hippocampal neurons exhibiting long-term potentiation. Brain Res. Mol. Brain Res., 14: 101–108.
•  Boyle,  A.P.,  Davis,  S.,  Shulha,  H.P.,  Meltzer,  P.,  Margulies,  E.H.,  Weng,  Z.,  Furey,  T.S., and  Crawford,  G.E. 2008. High-resolution mapping and characterization of open chromatin across the genome. Cell, 132: 311–322.
•  Buckley,  P.T.,  Lee,  M.T.,  Sul,  J.Y.,  Miyashiro,  K.Y.,  Bell,  T.J.,  Fisher,  S.A.,  Kim,  J., and  Eberwine,  J. 2011. Cytoplasmic intron sequence-retaining transcripts can be dendritically targeted via ID element retrotransposons. Neuron, 69: 877–884.
•  Efroni,  S.,  Duttagupta,  R.,  Cheng,  J.,  Dehghani,  H.,  Hoeppner,  D.J.,  Dash,  C.,  Bazett-Jones,  D.P.,  Le Grice,  S.,  McKay,  R.D.,  Buetow,  K.H., et al. 2008. Global transcription in pluripotent embryonic stem cells. Cell Stem Cell, 2: 437–447.
•  Eymery,  A.,  Callanan,  M., and  Vourc’h,  C. 2009a. The secret message of heterochromatin: new insights into the mechanisms and function of centromeric and pericentric repeat sequence transcription. Int. J. Dev. Biol., 53: 259–268.
•  Eymery,  A.,  Horard,  B.,  El Atifi-Borel,  M.,  Fourel,  G.,  Berger,  F.,  Vitte,  A.L.,  Van den Broeck,  A.,  Brambilla,  E.,  Fournier,  A.,  Callanan,  M., et al. 2009b. A transcriptomic analysis of human centromeric and pericentric sequences in normal and tumor cells. Nucleic Acids Res., 37: 6340–6354.
•  Gargiulo,  G.,  Levy,  S.,  Bucci,  G.,  Romanenghi,  M.,  Fornasari,  L.,  Beeson,  K.Y.,  Goldberg,  S.M.,  Cesaroni,  M.,  Ballarini,  M.,  Santoro,  F., et al. 2009. NA-Seq: a discovery tool for the analysis of chromatin structure and dynamics during differentiation. Dev. Cell, 16: 466–481.
•  Iwase,  S.,  Lan,  F.,  Bayliss,  P.,  de la Torre-Ubieta,  L.,  Huarte,  M.,  Qi,  H.H.,  Whetstine,  J.R.,  Bonni,  A.,  Roberts,  T.M., and  Shi,  Y. 2007. The X-linked mental retardation gene SMCX/JARID1C defines a family of histone H3 lysine 4 demethylases. Cell, 128: 1077–1088.
•  Johe,  K.K.,  Hazel,  T.G.,  Muller,  T.,  Dugich-Djordjevic,  M.M., and  McKay,  R.D. 1996. Single factors direct the differentiation of stem cells from the fetal and adult central nervous system. Genes Dev., 10: 3129–3140.
•  Kim,  J.H.,  Ebersole,  T.,  Kouprina,  N.,  Noskov,  V.N.,  Ohzeki,  J.,  Masumoto,  H.,  Mravinac,  B.,  Sullivan,  B.A.,  Pavlicek,  A.,  Dovat,  S., et al. 2009. Human gamma-satellite DNA maintains open chromatin structure and protects a transgene from epigenetic silencing. Genome Res., 19: 533–544.
•  Lander,  E.S.,  Linton,  L.M.,  Birren,  B.,  Nusbaum,  C.,  Zody,  M.C.,  Baldwin,  J.,  Devon,  K.,  Dewar,  K.,  Doyle,  M.,  FitzHugh,  W., et al. 2001. Initial sequencing and analysis of the human genome. Nature, 409: 860–921.
•  Lehnertz,  B.,  Ueda,  Y.,  Derijck,  A.A.,  Braunschweig,  U.,  Perez-Burgos,  L.,  Kubicek,  S.,  Chen,  T.,  Li,  E.,  Jenuwein,  T., and  Peters,  A.H. 2003. Suv39h-mediated histone H3 lysine 9 methylation directs DNA methylation to major satellite repeats at pericentric heterochromatin. Curr. Biol., 13: 1192–1200.
•  Lewis,  J.D.,  Meehan,  R.R.,  Henzel,  W.J.,  Maurer-Fogy,  I.,  Jeppesen,  P.,  Klein,  F., and  Bird,  A. 1992. Purification, sequence, and cellular localization of a novel chromosomal protein that binds to methylated DNA. Cell, 69: 905–914.
•  Lu,  J. and  Gilbert,  D.M. 2007. Proliferation-dependent and cell cycle regulated transcription of mouse pericentric heterochromatin. J. Cell Biol., 179: 411–421.
•  Maison,  C.,  Bailly,  D.,  Roche,  D.,  Montes de Oca,  R.,  Probst,  A.V.,  Vassias,  I.,  Dingli,  F.,  Lombard,  B.,  Loew,  D.,  Quivy,  J.P., et al. 2011. SUMOylation promotes de novo targeting of HP1α to pericentric heterochromatin. Nat. Genet., 43: 220–227.
•  Manuelidis,  L. 1981. Consensus sequence of mouse satellite DNA indicates it is derived from tandem 116 basepair repeats. FEBS Lett., 129: 25–28.
•  Martens,  J.H.,  O’Sullivan,  R.J.,  Braunschweig,  U.,  Opravil,  S.,  Radolf,  M.,  Steinlein,  P., and  Jenuwein,  T. 2005. The profile of repeat-associated histone lysine methylation states in the mouse epigenome. EMBO J., 24: 800–812.
•  Meshorer,  E.,  Yellajoshula,  D.,  George,  E.,  Scambler,  P.J.,  Brown,  D.T., and  Misteli,  T. 2006. Hyperdynamic plasticity of chromatin proteins in pluripotent embryonic stem cells. Dev. Cell, 10: 105–116.
•  Mosch,  K.,  Franz,  H.,  Soeroes,  S.,  Singh,  P.B., and  Fischle,  W. 2011. HP1 recruits activity-dependent neuroprotective protein to H3K9me3 marked pericentromeric heterochromatin for silencing of major satellite repeats. PLoS One, 6: e15894.
•  Mulugeta Achame,  E.,  Wassenaar,  E.,  Hoogerbrugge,  J.W.,  Sleddens-Linkels,  E.,  Ooms,  M.,  Sun,  Z.W.,  van IJcken,  W.F.,  Grootegoed,  J.A., and  Baarends,  W.M. 2010. The ubiquitin-conjugating enzyme HR6B is required for maintenance of X chromosome silencing in mouse spermatocytes and spermatids. BMC Genomics, 11: 367.
•  Muotri,  A.R.,  Chu,  V.T.,  Marchetto,  M.C.,  Deng,  W.,  Moran,  J.V., and  Gage,  F.H. 2005. Somatic mosaicism in neuronal precursor cells mediated by L1 retrotransposition. Nature, 435: 903–910.
•  Probst,  A.V.,  Dunleavy,  E., and  Almouzni,  G. 2009. Epigenetic inheritance during the cell cycle. Nat. Rev. Mol. Cell Biol., 10: 192–206.
•  Probst,  A.V.,  Okamoto,  I.,  Casanova,  M.,  El Marjou,  F.,  Le Baccon,  P., and  Almouzni,  G. 2010. A strand-specific burst in transcription of pericentric satellites is required for chromocenter formation and early mouse development. Dev. Cell, 19: 625–638.
•  Pulvers,  J.N. and  Huttner,  W.B. 2009. Brca1 is required for embryonic development of the mouse cerebral cortex to normal size by preventing apoptosis of early neural progenitors. Development, 136: 1859–1868.
•  Rudert,  F.,  Bronner,  S.,  Garnier,  J.M., and  Dollé,  P. 1995. Transcripts from opposite strands of gamma satellite DNA are differentially expressed during mouse development. Mamm. Genome, 6: 76–83.
•  Santenard,  A.,  Ziegler-Birling,  C.,  Koch,  M.,  Tora,  L.,  Bannister,  A.J., and  Torres-Padilla,  M.E. 2010. Heterochromatin formation in the mouse embryo requires critical residues of the histone variant H3.3. Nat. Cell Biol., 12: 853–862.
•  Sasaki,  T.,  Nishihara,  H.,  Hirakawa,  M.,  Fujimura,  K.,  Tanaka,  M.,  Kokubo,  N.,  Kimura-Yoshida,  C.,  Matsuo,  I.,  Sumiyama,  K.,  Saitou,  N., et al. 2008. Possible involvement of SINEs in mammalian-specific brain formation. Proc. Natl. Acad. Sci. USA, 105: 4220–4225.
•  Skene,  P.J.,  Illingworth,  R.S.,  Webb,  S.,  Kerr,  A.R.,  James,  K.D.,  Turner,  D.J.,  Andrews,  R., and  Bird,  A.P. 2010. Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state. Mol. Cell, 37: 457–468.
•  Solovei,  I.,  Grandi,  N.,  Knoth,  R.,  Volk,  B., and  Cremer,  T. 2004. Positional changes of pericentromeric heterochromatin and nucleoli in postmitotic Purkinje cells during murine cerebellum development. Cytogenetics and Genome Research, 105: 302–310.
•  Solovei,  I.,  Kreysing,  M.,  Lanctôt,  C.,  Kösem,  S.,  Peichl,  L.,  Cremer,  T.,  Guck,  J., and  Joffe,  B. 2009. Nuclear architecture of rod photoreceptor cells adapts to vision in mammalian evolution. Cell, 137: 356–368.
•  Ting,  D.T.,  Lipson,  D.,  Paul,  S.,  Brannigan,  B.W.,  Akhavanfard,  S.,  Coffman,  E.J.,  Contino,  G.,  Deshpande,  V.,  Iafrate,  A.J.,  Letovsky,  S., et al. 2011. Aberrant overexpression of satellite repeats in pancreatic and other epithelial cancers. Science, 331: 593–596.
•  Waterston,  R.H.,  Lindblad-Toh,  K.,  Birney,  E.,  Rogers,  J.,  Abril,  J.F.,  Agarwal,  P.,  Agarwala,  R.,  Ainscough,  R.,  Alexandersson,  M.,  An,  P., et al. 2002. Initial sequencing and comparative analysis of the mouse genome. Nature, 420: 520–562.
•  Zhu,  Q.,  Pao,  G.M.,  Huynh,  A.M.,  Suh,  H.,  Tonnu,  N.,  Nederlof,  P.M.,  Gage,  F.H., and  Verma,  I.M. 2011. BRCA1 tumour suppression occurs via heterochromatin-mediated silencing. Nature, 477: 179–184.