2026 年 51 巻 1 号 p. 215-226
Mitochondrial dysfunction and cellular senescence are key features of brain aging and neurodegenerative diseases. Cuprizone (CPZ), a mitochondrial toxin, induces oxidative stress, abnormal lipid metabolism, and iron accumulation in neurons and oligodendrocytes. Here, we investigated whether metformin (MFN), an AMPK activator with a known safety profile, can protect against CPZ-induced mitochondrial and senescence-like changes. Using confocal and transmission electron microscopy, we observed mitochondrial enlargement, increased reactive oxygen species (ROS) production, iron accumulation, and lipofuscin formation in CPZ-treated primary neuronal cultures. Next, we assessed the impact of MFN on mitochondrial changes and increase in lipid-radicals in cells exposed to CPZ. The treatment of MFN resulted in decreased abnormal mega-mitochondrial morphology, decreased levels of mitochondrial reactive oxygen species (mitoROS), and decreased iron accumulation within mitochondria. Moreover, MFN treatment prevented the typically observed increases in lipofuscin and lipid radicals in CPZ-affected cells. Analysis of gene expression in primary neuronal cells treated with CPZ showed differences in mitochondria-related genes linked to lipid peroxidation, oxidative stress, and cellular senescence. These findings suggest that MFN mitigates mitochondrial dysfunction and senescence-associated alterations, highlighting its therapeutic potential in aging-related neurodegeneration.
Key words: mitochondria, CPZ, MFN, oxidative stress, lipofuscin

Graphical Abstract
Brain aging and neurodegeneration are strongly linked to mitochondrial dysfunction, oxidative stress, and the accumulation of senescence-like phenotypes. Cuprizone (CPZ), a copper-chelating agent and mitochondrial complex IV inhibitor, is widely used as a demyelination model and induces mitochondrial stress in neurons and oligodendrocytes. (Luo et al., 2020; Varhaug et al., 2020). Although studies have reported changes in cellular metabolism, specifically in the mitochondrial TCA cycle, neurons do not exhibit immediate cell mortality when exposed to CPZ, despite demonstrating heightened vulnerability to oxidative stress (Luo et al., 2020; Martinez-Pinilla et al., 2021). Similarly, Taraboletti and colleagues (2017) demonstrated that CPZ induces metabolic disturbances related to mitochondrial function in the oligodendroglial cell line MO3.13, suggesting increased susceptibility to reactive oxygen species (ROS) (Taraboletti et al., 2017). Significantly, human neural cell lines (SH-SY5Y/HOG co-cultures) treated with CPZ displayed reversible alterations in mitochondrial function without resulting in cell death (Martinez-Pinilla et al., 2021).
Recent studies have emphasized the importance of mitochondrial dynamic function and structural alterations in neurons and glial cells in response to cellular stress. Atypical alterations in mitochondrial structure are associated with senescent cells that exhibit pro-survival pathways leading to enhanced resistance against cell death (Soto-Gamez et al., 2019). The current understanding of senescence includes various features, such as resistance to cell death, with ROS playing a significant role in senescence across different cell types (Soto-Gamez et al., 2019). Emerging research indicates a strong correlation between mitoROS, mitochondrial impairment, and senescence (Chiao et al., 2020). Senescent cells commonly exhibit enlarged mitochondrial morphology. The process of mitochondrial fusion involves the merging of two individual mitochondria to create an elongated structure, facilitating the dynamic restoration of mitochondria that are reversibly damaged. On the other hand, mitochondrial fission is characterized by the division of irreparably damaged mitochondria into smaller, rounded structures that are subject to elimination via mitophagy. Megamitochondria in senescent cells have been observed to serve a protective role during periods of stress. Parandavar and colleagues showed a rise of senescent glial cells exhibiting heightened β-galactosidase (β-Gal) signals in the CPZ model compared to the control group (Parandavar et al., 2024). However, the authors did not assess mitochondrial morphological changes in senescence-positive cells. We hypothesized that studying mitochondrial remodeling by CPZ could provide valuable insights into the regenerative mechanisms by which mitochondria defend against cell death. Therefore, we examined alterations in mitochondrial morphology in neurons and oligodendrocytes treated with low concentrations of CPZ through the use of light and electron microscopy.
Metformin (MFN), a derivative of biguanide known for its well-established safety profile, has been utilized for the treatment of mitochondrial dysfunction and enhancement of senescent cell function by activating AMPK. MFN-induced activation of AMPK leads to the phosphorylation of different target proteins related to mitochondrial biogenesis (PCG-1α), dynamics (Drp1, MFF), and activation (Herzig and Shaw, 2018). Despite these known mechanisms, the role of MFN in mitochondria of CPZ treated neuronal cells remains to be fully elucidated. Here, we investigated how CPZ alters mitochondrial morphology and function in primary neurons and oligodendrocytes, and whether MFN protects against these changes. We used confocal microscopy, electron microscopy, and transcriptomic analysis to elucidate mechanisms by which MFN alleviates mitochondrial oxidative stress and senescence-associated alterations including mitochondrial morphology, aberrant lipid, and iron accumulation in neuronal cells.
Primary cortical neurons were cultured from embryonic day 18 Sprague–Dawley fetal rats. Briefly, the brain cortical tissue was dissected in Hanks’ Balanced Salt Solution (#14185052, Gibco, Grand Island, NY, USA) containing 10 mM HEPES (pH 7.4) and dissociated with 0.125% trypsin (#15090046, Gibco) for 15 min at 37°C. Cells were seeded on a pre-coated coverslip or 6-well plate with 100 μg/mL poly-D-lysine (#P6407, Sigma-Aldrich, St. Louis, MO, USA) and 10 μg/mL laminin (#354232, Corning, Lowell, MA, USA). The neuronal cells were incubated in a Neurobasal medium (#21103-049, Gibco), 0.5 mM glutamine, 25 μM glutamate, and supplemented with SM1 components (#05711, Stemcell, Vancouver, Canada) for 14–16 days in vitro. The medium was replaced for three to four days with fresh medium.
Live cell imaging using confocal microscopyCells were grown on a pre-coated coverslips to 60–70% confluence. To visualize the accumulation of iron, cells were stained with 5 μM Far-red Labile Fe2+ (SCT037, Sigma-Aldrich) for 20 min and to investigate the structural changes of the mitochondria, stained with 200 nM of Mitotracker-Green (Invitrogen, Carlsbad, CA, USA, M7514) for 20 min and signal was observed under confocal microscopy. To visualize the lipid radical and lysosome, stained with 1 μM LipiRadical Green (Funakoshi, Tokyo, Japan, FDB-0042) for 30 min and 100 nM Lysotracker Blue DND-22 (L7525, Thermo Fisher Scientific, Waltham, MA, USA) for 15 min. To analyze the formation of mitochondrial ROS, 5 μ M MitoSOX Red (Invitrogen, M36008) for 20 min. Lipofuscin was analyzed by measuring strong autofluorescence (Ex: 360–405 nm; Em: 540–650 nm). The fluorescent images were acquired using a confocal microscope A1 Rsi/Ti-E (Nikon, Tokyo, Japan) with a 60X oil immersion lens. Z-stack image sequences were acquired at 0.3 μm intervals and converted with maximal intensity projection using NIS-Element AR software (Nikon). Fluorescence intensity was measured using ImageJ software.
Immunostaining for neurons and oligodendrocytesCells were harvested at DIV 14 and fixed with 4% paraformaldehyde for 1hr at room temperature. The cells were incubated with the solution of 0.1% Triton X-100 with 0.1% bovine serum albumin (A0281, Sigma, USA) for 1hr to block non-specific labeling. Then, cells were incubated with primary antibody at 4°C for overnight. Antibodies used in this study are OLIG2 (oligodendrocyte lineage cell; 1:500, IBL Japan, 18953), TOMM20 (mitochondria; 1:700, ab56783, Abcam, Cambridge, UK), and MAP2 (neuron; 1:500, PA5-17646, Thermo). The next day, cells were washed with filtered PBS and incubated with appropriate HRP conjugated with Alexa-fluor 488 and Alexa-fluor 594 dyes (Invitrogen) for 1hr at room temperature. After that, cells were observed under the confocal microscope A1 Rsi/Ti-E (Nikon, Tokyo, Japan) with a 60X oil-immersion lens. Z-stack image sequences were acquired at 0.2 μm intervals and converted with maximal intensity projection using NIS-Element AR software (Nikon). Fluorescence intensity was measured using ImageJ software version 1.51j8.
Electron microscopy analysisTransmission electron microscopy (TEM) was used for ultrastructural analysis. Cells in each group were grown on pre-coated coverslips. The samples were immediately fixed with 2.5% glutaraldehyde-mixed 2% paraformaldehyde solution for 1 hr, followed by post-fixation in 2% of osmium tetroxide (OsO4) with 1.5% ferrocyanide for 1 hr at 4°C. Then, cells were incubated in room temperature with filtered 1% thiocarbohydrazide solution for 20 min, after that, 2% OsO4 solution at room temperature for 30 min. The cells were stained in 2% uranyl acetate for overnight at 4°C and dehydrated with a graded ethanol series. The samples were then embedded in epoxy medium (EMS, Hatfield, PA, USA). Embedded samples were sectioned (70 nm) with an ultra-microtome (Leica Microsystems, Wetzlar, Germany), and the sections were then viewed on a Tecnai 20 TEM (Thermo Fisher Scientific) at 120 kV. Images were captured with a US1000X-P camera 200. The images acquired were stitched together using Photomontage software (Thermo Fisher Scientific).
mRNA sequencingTotal RNAs were extracted from primary cortical neurons treated with vehicle CTL, CPZ, or CPZ plus MFN using Trizol reagent (Invitrogen). RNA integrity was analyzed using an Agilent Bioanalyzer. The RNA integrity was assessed using Agilent 2100, and samples with RNA integrity number (RIN) >7 were selected for sequencing Poly(A) mRNA isolation from total RNA and subsequent fragmentation were performed using the Illumina TruSeq RNA Sample Prep Kit v2, according to the manufacturer’s instructions. The adaptor ligated libraries were prepared and sequenced using an Illumina NovaSeq 6000 platform (Macrogen, Seoul, South Korea). For each condition, mRNA-sequencing was performed with four biological replicates obtained from independent rats. Raw sequencing reads were aligned to the Rattus norvegicus reference genome (Rnor_6.0) using STAR software (v2.7) with default parameters (Dobin et al., 2013). After the alignment, the numbers of reads mapped to the gene features (GTF file of Rnor_6.0.90) were counted using HTseq software (Anders et al., 2015). Normalization of read counts was performed using the TMM (Trimmed Mean of M-values) method in the edgeR package (Robinson and Oshlack, 2010). Differentially expressed genes (DEGs) were identified using the DESeq2 package v1.38 (Love et al., 2014) with a false discovery rate (FDR) <0.1. Functional enrichment analysis was performed using DAVID software (Sherman et al., 2022). Gene Ontology Biological Processes (GOBPs) with p-values <0.1 were considered significantly enriched.
Quantification of mRNA expression in each group using qPCRmRNA quantification was determined by quantitative real-time reverse-transcription PCR (RT-qPCR). Cells were harvested at DIV 14 and RNA extraction was performed using RNeasy Micro Kit (74004, QIAGEN, Venlo, Netherlands) following the QIAGEN protocol. To determine RNA quantity, measured by the Nanodrop (Thermo Scientific), and first-strand cDNA was synthesized by PrimeScriptTM RT 1st Strand cDNA Synthesis Mix (6215A, Takara Bio, Kusatsu, Japan). RT-qPCR was performed using Power SYBRTM Green PCR Master Mix (4367659, Applied Biosystems, Waltham, MA, USA) and ABI 7500 fast real-time PCR detection system (Life Technologies) according to the manufacturer’s recommendations. Expression of relative genes was confirmed using the 2–ΔΔCt method (Table 1).
A list of lipid metabolism/homeostasis and mitochondrion organization genes used for mRNA expression analysis in cells
| Primer | Sequence (5'->3') | |
|---|---|---|
| Alox15 | F | GCAACTGGAAGGATGGCACAATC |
| R | TCGCTGGTCTACAGGGAGGTC | |
| Eral1 | F | CCCAAGTTCCTCACCTTGAA |
| R | AATAAAATGCCAGGCAGTGG | |
| Slc25a34 | F | CAGGGCATCAGAACTTGGTT |
| R | TCTGGTGGAAGTGATGACCA | |
| Plin2 | F | AAGTGAGGACGCCATCAGAC |
| R | ACTACATGCCAGACGCTCCT | |
| Gsk3a | F | GCCCAACGTGTCCTACATCT |
| R | TTGGCGTCCCTAGTACCTTG | |
| NOX4 | F | GGTTAAACACCTCTGTCTGCTTG |
| R | AGAAGCTCTGCTCAAACACAATC | |
| CD38 | F | GAAAGGGAAGCCTACCACGAA |
| R | GCCGGAGGATTTGAGTATAGATCA | |
| GAPDH | F | CATCAAGAAGGTGGTGAAGCA |
| R | CTGTTGAAGTCACAGGAGACA |
F = forward, R = reverse.
All experiments were performed in triplicate, and statistical analyses were performed through GraphPad Prism software. Results are presented as the mean + standard deviation (SD) of the triplicates. Comparisons of each group were made using a one-way variance analysis (ANOVA) followed by Tukey’s multiple comparisons test. A p-value <0.05 was considered significant. (*p<0.05, **p<0.01, ***p<0.001 and ****p<0.0001).
To investigate the effects of CPZ and MFN on the mitochondrial structure in primary rat oligodendrocytes and neurons, we employed live-cell imaging using light microscopy. In oligodendrocytes and neurons, mitochondria were distinguished with the use of specific markers (Olig2 for oligodendrocyte lineage cells, MAP2 for neurons, and TOM20 for mitochondria) to facilitate the measurement of mitochondria per cell size in each cell type through confocal microscopy. Changes in the size of mitochondria were analyzed in cells treated with CPZ alone and in co-treated with MFN (Fig. 1A). The mitochondrial size in oligodendrocytes increased to 135.11 μm2 when treated with CPZ compared with control (CTL) group and changed to 104.45 μm2 when co-treated with CPZ and MFN, compared to the CTL group size of 94.53 μm2. Furthermore, the increase in mitochondrial size in neurons treated with CPZ was measured at 132.47 μm2, consistent with the findings observed in oligodendrocytes. Co-treatment of CPZ and MFN showed it to 112.95 μm2, which is similar to the 108.52 μm2 in the CTL group (Fig. 1B). TEM images also revealed mitochondrial swelling in both oligodendrocytes and neurons (Fig. 1C). The results of the mitochondrial size measurements in oligodendrocytes and neurons indicated that the CPZ-treated group exhibited an increase in size (0.434 μm2 and 0.463 μm2, respectively) compared to the CTL group (0.235 μm2). However, the group co-treated with CPZ and MFN demonstrated size changes to 0.249 μm2 and 0.21 μm2, respectively (Fig. 1D). These results indicate that CPZ increased mitochondrial size, whereas MFN restored mitochondrial size in both oligodendrocytes and neurons. In addition to changes in mitochondrial size, the ultrastructure of mitochondria in the MFN co-treated group exhibited an increased number of mitochondria-derived vesicles (MDVs). Previous studies have demonstrated that MDVs transport damaged mitochondrial components to lysosomes for degradation, thereby ultimately restoring mitochondrial function (Popov, 2022; Sugiura et al., 2014). Therefore, the production of MDVs in oligodendrocytes and neurons was quantified and compared across each group in this study (Fig. 1E). In oligodendrocytes, the CPZ group exhibited a 0.77-fold decrease, whereas the group co-treated with MFN showed a 4.8-fold increase relative to the CTL group. Moreover, compared to the CPZ group and the group co-treated with MFN, the co-treated group exhibited a significant 6.3-fold increase. Similarly, in neurons, the CPZ-treated group exhibited a 3.6-fold decrease, while the group treated with both CPZ and MFN demonstrated a 2.5-fold increase compared to the control group. The group co-treated with CPZ and MFN exhibited a 9.1-fold increase compared to the CPZ-only group (Fig. 1F). These results suggested that the mitochondrial dysfunction induced by CPZ resulted in an enlargement of the mitochondria and that MFN restored mitochondrial size by producing MDVs.

Effect of CPZ and MFN on mitochondria in the cortex primary culture’s neuron and oligodendrocyte cells
(A) Immunocytochemistry images of rat cortical neurons and oligodendrocyte cells showing representative staining for DAPI (blue), Olig2 (up, red), TOM20 (green), and MAP2 (down, red). Cultured neurons and oligodendrocytes were treated at DIV 16 with 0.2 μM CPZ and MFN for 24h. (Scale bar = 20 μm). (B) Quantification of the mitochondria area and number in the oligodendrocyte (n = 50). The mitochondria area of neurons (n = 8) was also quantified. (C) Representative TEM images of cortical neurons and oligodendrocyte cells. TEM images showed the increased size of mitochondria in CPZ-treated cells. The CPZ and MFN co-treated group restored the mitochondria size like the CTL group. (Scale bar = 1 μm). Quantification of the mitochondria area of each of the neurons and oligodendrocytes (n = 15). Data obtained from independent experiments (n = 3 replicates) are presented as the mean ± SD. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001, NS = no significant difference by one-way ANOVA, Tukey’s multiple-comparison test. (E) The effect of CPZ and MFN on mitochondria-derived vesicles in neurons and oligodendrocytes of cortical primary cultures. Representative TEM images of MDVs (Scale bar = 1 μm) and quantification of number of MDVs in neuron (n = 5) and oligodendrocyte (n = 15). Data obtained from independent experiments (n = 3 replicates) are presented as the mean ± SD. * p<0.05, ** p<0.01, *** p<0.001, NS = no significant difference by one-way ANOVA, Tukey’s multiple-comparison test.
The findings demonstrated that CPZ treatment affected mitochondrial size, and mitochondrial damage was subsequently evaluated through an assessment of mitochondrial ROS in total cell (Fig. 2A). As shown in Fig. 2B, the results indicate a 5.5-fold significant increase in mitochondrial ROS levels in the CPZ-treated group compared to the CTL group. Conversely, the co-treated CPZ and MFN group exhibited a 0.59-fold reduction in ROS levels compared to the group treated solely with CPZ. In addition to the ROS level, the mitochondrial iron level associated with mitochondrial dysfunction also exhibited changes. To compare iron accumulation in total cell, the fluorescence intensity was measured in each group following treatment of live cells with 5 μM far-red labile Fe2+ probe (Fig. 2C). As shown in Fig. 2D, the CPZ-treated group exhibited a significant increase in intracellular iron accumulation compared to the CTL group (4.24 a.u.), with levels reaching 36.12 a.u. In contrast, the group treated with both CPZ and MFN showed a comparable reduction in iron accumulation, with values (9.12 a.u.) comparable to those of the CTL group. Furthermore, consistent with previous data, the CPZ-treated group exhibited an increased mitochondrial signal intensity. Compared to the CTL group (23.88 a.u.), the CPZ group exhibited an increase in mitochondrial signal intensity (39.36 a.u.), whereas the CPZ and MFN co-treated group demonstrated a change (24.84 a.u.) comparable to that of the CTL group. These findings again confirmed that CPZ altered mitochondrial size (Fig. 2D), suggesting that CPZ treatment impairs mitochondrial function, leading to excessive production of reactive oxygen species as well as alterations in mitochondrial morphology and iron accumulation.

Effect of CPZ and MFN on mitochondrial ROS production and iron accumulation in the cortex primary culture’s cells
(A) Representative confocal image of mitochondrial ROS in the rat primary cultured cells. Cultured cells were treated at DIV 16 with 0.2 μM CPZ and MFN for 24 h and treated with 5 μM MitoSOX Red for 20 min for measuring mitochondrial ROS in live cells (white arrow: oligodendrocyte cells, yellow arrow: neurons). (Scale bar = 20 μm). (B) Quantification of the MitoSOX intensity in cortical cells. The CPZ treatment was observed to significantly increase the production of mitochondrial ROS, whereas the co-treatment of MFN reduced the production of ROS. (C) Measurement of iron signal and mitotracker signal induced by CPZ using fluorescent staining in cortical cells. To visualize the accumulation of iron in mitochondria, we stained with 5 μM Far-red Labile Fe2+ and stained with 200 nM of Mitotracker-green for 20 min (Scale bar = 20 μm). (D) Quantification of the iron and mitochondria intensity signals in cortical cells. The CPZ treatment was observed to significantly increase the accumulation of iron and level of mitochondrial intensity, whereas the co-treatment of MFN reduced the levels. Data obtained from independent experiments (n = 3 replicates) are presented as the mean ± SD. * p<0.05, ** p<0.01, *** p<0.001, NS = no significant difference by one-way ANOVA, Tukey’s multiple-comparison test. TD : transmitted light image (brightfield mode).
A previous study reported that an imbalance between ROS production and antioxidant defenses leads to oxidative stress, causing damage to cellular components including proteins and lipids (Levi et al., 2024). Therefore, assuming that CPZ-induced mitochondrial ROS and iron increase may be associated with the accumulation of oxidized proteins and lipids, leading to lipofuscin formation (Lowman and Yampolsky, 2023), we investigated the presence of lipofuscin, a hallmark of senescent cells. As shown in Fig. 3A, the treatment CPZ demonstrated an increase in lipofuscin of 4.8-fold in comparison to the CTL group, while in the group treated with MFN, an increase was shown in comparison to the CTL group, but a decrease of approximately 2-fold was indicated in comparison to the CPZ group. Lipofuscin consists of cross-linked protein and lipid residues, and iron accumulation in lysosomes can induce lipofuscin formation (Villalón-García et al., 2023). Therefore, intracellular iron, lysosome, and lipid radical levels were measured and analyzed using fluorescent staining (Fig. 3B). Lysosomal signal intensity remained unchanged among groups, but CPZ increased Fe2+ accumulation (9.1 a.u. vs 2.54 a.u. in CTL) and lipid radicals (4.8 a.u. vs 1.52 a.u.), both of which were reduced by MFN co-treatment (3.43 a.u. and 2.36 a.u., respectively). In addition, As shown in Supple Fig. 1 quantitative analysis was performed to assess the overlap of lipid radical and Fe2+ intensities within lysosomes. The results demonstrated that CPZ treatment significantly increased lipid radical and Fe2+ intensities (9.10 a.u. and 8.46 a.u., respectively), whereas co-treatment with CPZ and MFN markedly reduced both signals (3.12 a.u. and 4.61 a.u., respectively) compared to the CTL group (2.09 a.u. and 3.50 a.u.). Furthermore, TEM images showed CPZ caused an abnormal increase in lipid droplets and altered lysosomal morphology in neurons and oligodendrocytes, which were alleviated by MFN co-treatment (Fig. 3C). Together, these findings demonstrate that CPZ induces lipofuscin accumulation and lysosomal lipid overload associated with oxidative stress, and that MFN mitigates these effects, likely through restoration of mitochondrial function.

CPZ and MFN changed lipofuscin and lipi-radical in rat primary cultured cells
(A) Representative confocal images of lipofuscin in cortical neuron. Cultured neurons and oligodendrocytes were treated at DIV 16 with 0.2 μM CPZ and MFN for 24 hr, then lipofuscin was measured by autofluorescence (Scale bar = 20 μm). The CPZ-treated group exhibited a markedly elevated level of lipofuscin, whereas the MFN co-treated group demonstrated a reduction in this substance in the neurons (N>9). (B) The staining of lipi-radical, lysosome, and iron showed changes induced by CPZ and MET co-treatment. Lipid radicals (green), lysosomes (blue), and iron (red) in living cells were stained with fluorescent dyes and observed using a confocal microscope (Scale bar = 20 μm). Treatment of CPZ and MFN demonstrated no changes to the lysosome in neurons and oligodendrocytes. As with the previous results, iron accumulation was increased with CPZ and decreased with MFN. Lipid levels also increased as lipofuscin levels elevated with CPZ, while MFN co-treatment resulted in decreased lipid production (N>33). (C) Representative TEM images of lysosome and lipid accumulation in cortical neuron and oligodendrocytes. To examine structural abnormalities of lysosomes and lipid-related organelles in the CTL, CPZ, and MFN groups. No significant differences were observed in the number of lysosomes among the three groups. However, in the CPZ group, both neurons and oligodendrocytes exhibited an increased number of lipid droplets. In addition, morphologically abnormal lysosomes were confirmed. L: lysosome, LD: lipid droplet, LP: lipofuscin. Data obtained from independent experiments (n = 3 replicates) are presented as the mean ± SD. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001, NS = no significant difference by one-way ANOVA, Tukey’s multiple-comparison test. TD: transmitted light image (brightfield mode), L: lysosome, LD: lipid droplet, AL: abnormal lipid, LP: lipofuscin.
To investigate the effects of MFN on oxidative stress and the abnormal accumulation of lipids and iron in CPZ-treated cells, we performed transctiptomic profiling using RNA sequencing on primary cortical neurons under three conditions: CTL, treated with CPZ, and co-treated with CPZ and MFN. By comparing gene expression profiles, we identified 533 differentially expressed genes (DEGs), including 270 upregulated and 263 downregulated genes, in CPZ-treated cells compared to CTLs (Fig. 4A and Supplementary Table S1). Gene Ontology (GO) enrichment analysis showed that upregulated genes in CPZ-treated neurons were associated with pathways related to the metal ion homeostasis, response to ROS, inflammatory response, glial cell activation/differentiation, and senescence (Fig. 4B). By contrast, downregulated genes were mainly associated with pathways involved in lipid metabolism/homeostasis, cellular component biogenesis, cell proliferation, and growth (Fig. 4C). To identify molecular signatures restored by MFN, we compared the gene expression profiles between neurons treated with CPZ alone versus CPZ and MFN. Among the 533 DEGs altered by CPZ, 113 genes (21.2%) were restored by MFN treatment (Fig. 4D and Supplementary Table S1). These genes were significantly associated with pathways related to lipid metabolism/homeostasis and mitochondrion organization (Fig. 4E). To confirm the findings of the RNA sequencing, quantitative RT-PCR was conducted, validating the restoration of genes associated with lipid metabolism/homeostasis and the organization of the mitochondria (Fig. 4F). In particular, co-treatment of MFN with CPZ led to the restoration of gene expression for Alox15 and Plin2, which play roles in lipid metabolism and homeostasis. Furthermore, the genes Nox4, Eral1, Gsk3α, and Slc25a34, which are associated with the organization of the mitochondria were restored. The upregulation of Alox15 and NOX4 in response to CPZ was significant, with a 1.37- and 1.42-fold increase, respectively. These genes are associated with oxidative stress and ferroptosis. These findings indicate that CPZ affects lipid metabolism, mitochondria, and increases oxidative stress. However, the negative impact of CPZ can be partially reduced by MFN. Furthermore, the treatment of CPZ resulted in a decrease in the expression of genes associated with mitochondrion organization, including Eral1, Gsk3a, and Slc25a34, by 0.82-, 0.71-, and 0.58-fold, respectively. Conversely, the group co-treated with CPZ and MFN displayed a restoration in mRNA expression levels by 0.99-, 1.18-, and 1.26-fold change. The findings suggest that CPZ influences mitochondrial dysfunction, lipid metabolism, and oxidative stress, subsequently influencing inflammation and ROS production, and MFN intervention may mitigate the effects induced by CPZ.

MFN reverses CPZ-induced transcriptional alterations in primary cortical neurons
(A) Volcano plot showing differentially expressed genes (DEGs) in CPZ-treated cells compared to CTLs. The X- and Y-axes present the log2-fold-change and –log10(p-value), respectively. Red and green dots represent upregulated and downregulated genes, respectively. Gray dots represent genes without significant differences in expression. (B, C) GOBPs represented by the upregulated (B) and downregulated (C) genes. (D) Venn diagram showing the overlap of DEGs between two comparisons: CPZ versus CTL and CPZ + MFN versus CPZ) (E) Heatmap of MFN-rescued DEGs involved in lipid metabolism/homeostasis and mitochondrion organization. The color bar represents the z-score gradient. (F) Relative mRNA levels of the indicated genes in primary cortical cells under CTL, CPZ-treated, and CPZ and MFN co-treated conditions. mRNA levels were normalized to GAPDH. Data obtained from independent experiments (n = 3) are presented as the mean ± SD. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001, NS = no significant difference by one-way ANOVA, Tukey’s multiple-comparison test.
CPZ-induced neuronal disorder is closely associated with mitochondrial dysfunction and oxidative stress. Previous studies have shown that CPZ disrupts cytochrome c oxidase (complex IV) activity, thereby impairing mitochondrial respiration and promoting reactive oxygen species (ROS) generation (Matsushima and Morell, 2001; Jhelum et al., 2020). In addition, CPZ exposure alters cellular iron homeostasis by increasing transferrin receptor 1 (TfR1) expression and reducing ferritin levels, which may contribute to the accumulation of ferrous iron (Fe2+) and subsequent oxidative stress (Varga et al., 2018). Although MFN has been shown to mitigate oxidative injury and improve mitochondrial function in several contexts, including radiation-induced damage (Yuen et al., 2021) and CPZ-induced demyelination (Houshmand et al., 2019; Abdi et al., 2021), the precise mechanisms underlying MFN-mediated protection against CPZ-induced mitochondrial alterations remain to be elucidated.
Our comparative analysis of mitochondrial morphology revealed abnormally large mitochondria in CPZ-treated oligodendrocytes and neurons, which were ameliorated by MFN co-treatment (Fig. 1A–D). Consistent with earlier studies, CPZ treatment has been reported to cause mitochondrial enlargement in oligodendrocytes, a feature indicative of mitochondrial stress (Cammer, 1999; Pasquini et al., 2007). Megamitochondria formation, though associated with impaired mitochondrial function, is often considered an adaptive response to pathological conditions such as cellular senescence (Wakabayashi, 2002). Notably, MFN treatment promoted mitochondrial fission and reduced megamitochondria formation (Fig. 1C). Electron microscopy further revealed mitochondria-derived vesicles (MDVs), notably in MFN-treated cells. MDVs are known to maintain mitochondrial quality by removing damaged components during oxidative stress and mediating inter-organelle communication (Popov, 2022). The elevated MDV formation in MFN-treated groups suggests a less severe oxidative environment compared to CPZ-only treatment. Consistent with this, CPZ treatment induced marked mitochondrial ROS and Fe2+ accumulation in cells, which were mitigated by MFN (Fig. 2). This mitochondrial oxidative stress and impaired fission contribute to increased lipofuscin formation, a hallmark of senescence (König et al., 2017). The concurrent accumulation of lipofuscin and lipid radicals (Fig. 3) reflects lipid dyshomeostasis commonly observed in neurological disorders (Alecu and Bennett, 2019). Our previous work also demonstrated that lysosomes containing excess iron signals had also accumulation of lipid radicals in cells with neurological disorder (Lee et al., 2021, 2024). Where we observed lipid radical and cholesterol signals in the lysosome, lipofuscin was also superimposed through correlative light and electron microscopy method (Lee et al., 2024). In this study, MFN treatment attenuated lipid radical accumulation associated with lysosomes in CPZ-treated cells, consistent with its role in reducing oxidative and lipid stress. These findings align with Pandur et al. (2019), who reported that CPZ-induced iron metabolism disturbances disrupt lipid and myelin synthesis homeostasis (Pandur et al., 2019).
RNA analysis revealed significantly altered expression of several senescence-associated genes, particularly those involved in oxidative stress and mitochondrial function, in CPZ-treated cells (Fig. 4). ALOX15, a gene involved in lipid peroxidation and iron-dependent ROS generation, was upregulated by CPZ and reversed by MFN. Inhibition of ALOX15 has been shown to mitigate oxidative injury in myocardial, cerebral ischemia-reperfusion injury, and chronic kidney disease models (Takahashi et al., 2021; Lei et al., 2024), highlighting its role in senescence-related mitochondrial dysfunction. CPZ also reduced CD38 expression relating NAD+ metabolism, while MFN showed a partial restorative effect. PLIN2, a protein associated with lipid droplets that plays a critical role in lipid storage and metabolism, was downregulated by CPZ but significantly increased with MFN treatment (p<0.01), suggesting recovery of lipid metabolic balance. Consistent with this, previous work demonstrated that down-regulation of PLIN2 in primary human dermal fibroblasts induces mitochondrial dysfunction and cellular senescence (Chiariello et al., 2024). Furthermore, NOX4, a key ROS-producing enzyme and marker of senescence, was elevated by CPZ (p<0.05), consistent with mitochondrial impairment and ATP production decline (Park et al., 2021). Among mitochondrial function–related genes, ERAL1 expression was significantly reduced by CPZ, but maintained with MFN. ERAL1 depletion is known to impair mitochondrial translation (Uchiumi et al., 2010), reduce membrane potential, and increase ROS in human HeLa cells. Similarly, GSK3α, a regulator of mitochondrial biogenesis and energy metabolism, decreased after CPZ exposure but was restored by MFN, suggesting improved mitochondrial homeostasis. This restoration is notable, as GSK3α plays a key role in mitochondrial biogenesis, dynamics, and the regulation of the mitochondrial permeability transition pore, thereby contributing to the protective effects of MFN on mitochondrial function and cellular metabolism. Although CPZ/MFN co-treatment restored Gsk3a mRNA expression, this transcriptional change should not be interpreted as direct evidence of increased GSK3α activity, because GSK3α kinase activity is strongly regulated by inhibitory Ser21 phosphorylation. Future studies examining total GSK3α, phospho-GSK3α Ser21, and the effects of GSK3α inhibition will be necessary to define whether GSK3α contributes causally to MFN-mediated recovery.
SLC25a34, a potential dicarboxylate carrier involved in mitochondrial dynamics, signaling, and metabolic pathways such as de novo fatty acid synthesis and the malate–aspartate shuttle (Kunji et al., 2020), was downregulated by CPZ but preserved with MFN. Notably, a recent study by Nairita Roy and colleagues (2022) reported that decreased SLC25a34 expression leads to excessive lipid droplet accumulation accompanied by elevated expression of key fatty acid metabolism genes (Cpt1A, Srebf1, Acly), supporting its critical role in maintaining lipid metabolic homeostasis (Roy et al., 2022). Overall, these results indicate that MFN mitigates mitochondrial stress and senescence-associated transcriptional changes, promoting mitochondrial metabolic stability. In conclusion, our findings demonstrate that MFN protects against CPZ-induced mitochondrial dysfunction and senescence-like changes in primary neuronal cells. CPZ induced megamitochondria formation, increased mitoROS, Fe2+ accumulation, and enhanced lipofuscin and lipid radical deposition, consistent with aging-associated neuronal alterations. MFN restored mitochondrial morphology, enhanced MDVs formation, reduced oxidative stress, and restored expression of genes involved in lipid homeostasis and mitochondrial function. These results provide mechanistic insights into MFN’s neuroprotective actions and suggest it as a candidate therapeutic agent for aging-related neurodegenerative conditions characterized by mitochondrial dysfunction and senescence.
This research was supported by KBRI basic research program through Korea Brain Research Institute funded by Ministry of Science and ICT (26-BR-01-03) and the National Research Foundation of Korea (NRF, RS-2026-25488224). This research was also supported by 2025 Research Grant from Kangwon National University (202504710001) and Global-Learning & Academic research institution for Master’s·PhD students, and Postdocs (G-LAMP) Program of the NRF funded by the Ministry of Education (RS-2023-00301850).
Conflict of Interest StatementThe authors declare that there are no conflicts of interest.
Data Availability StatementThe raw data supporting the conclusions of this article will be made available by the authors, upon request.
Author Contributions StatementConceptualization: YK, HJ, SC, JYM
Funding acquisition: JYM
Investigation: YK, HJ, SK, SC
Project administration: SC, JYM
Supervision: SC, JYM
Writing-original draft: YK, HJ, SC, JYM
Writing-review & editing: all authors
Ethics Approval and Consent to ParticipateThe animal study was approved by IACUC; Korea Brain Research Institute. The study was conducted in accordance with the local legislation and institutional requirements.
Patient Consent for PublicationNot applicable.
TEM and confocal microscopy were supported by the Brain Research Core Facilities at Korea Brain Research Institute, and we especially thank Dr. Sanghoon Lee for technical assistance with TEM imaging.
control
CPZcuprizone
MFNmetformin
mitoROSmitochondrial reactive oxygen species
ROSreactive oxygen species
TEMTransmission electron microscopy
MDVsmitochondria-derived vesicles
DEGsdifferentially expressed genes
GOGene Ontology
TfR1transferrin receptor 1
β-Galβ-galactosidase
CD38CD38 molecules
Plin2perilipin 2
NOX4NADPH oxidase 4
Eral1Era-like 12S mitochondrial rRNA chaperone 1
Gsk3aglycogen synthase kinase 3 alpha
Slc25a34solute carrier family 25, member 34