The active ingredient β-sitosterol in Ganoderma regulates CHRM2-mediated aerobic glycolysis to induce apoptosis of lung adenocarcinoma cells

ABSTRACT

β-sitosterol is a natural plant steroidal compound with anti-cancer properties against various tumors. This work explored the inhibitory effect of β-sitosterol on the progression of lung adenocarcinoma (LUAD) and further analyzed its targets. We applied network pharmacology to obtain the components and targets of Ganoderma spore powder. The biological functions of β-sitosterol and CHRM2 were studied using the homograft mouse model and a series of in vitro experiments involving quantitative reverse transcription polymerase chain reaction, western blot, CCK-8, flow cytometry, immunohistochemistry and immunofluorescence. The regulatory influence of β-sitosterol on the glycolysis pathway was validated by measuring glucose consumption and lactate production, as well as the extracellular acidification rate and oxygen consumption rate. We found that CHRM2 binds directly to β-sitosterol. In vitro, CHRM2 overexpression repressed the apoptosis rate and expression of apoptosis-related proteins in LUAD cells, and promoted glycolysis, while the addition of lonidamine attenuated the apoptosis-inhibiting effect conferred by CHRM2 overexpression. Furthermore, β-sitosterol hindered glycolysis as well as the growth of tumors in vitro and in vivo. CHRM2 overexpression reversed the effect of β-sitosterol on the biological behavior of LUAD cells. Our results emphasize that CHRM2 is a direct target of β-sitosterol in LUAD cells. β-sitosterol can repress the glycolysis pathway, exerting an anti-tumor effect. These findings provide new support for the use of β-sitosterol as a therapeutic agent for LUAD.

INTRODUCTION

Lung adenocarcinoma (LUAD) is the most commonly diagnosed type of non-small cell lung cancer (NSCLC), and is considered to be an aggressive tumor (Lian et al., 2022; Shen et al., 2022). Epidemiological data indicate that even after various treatments, the five-year survival rate of LUAD patients is less than 20% (Gao et al., 2022; Wang et al., 2022). With the gradual progression of NSCLC research, the use of traditional herbal medicine has attracted increasing attention. Traditional herbal medicine provides clinicians with optional adjuvant therapies, such as combined use with chemotherapy drugs, to alleviate adverse effects associated with chemotherapy in cancer patients. As a form of cell death, apoptosis is crucial for maintaining normal bodily functions in humans and is often a key factor in herbal anticancer treatments (Huang et al., 2022). β-sitosterol is a phytosterol widely found in plants (Huang et al., 2022). Traditional herbal medicines like Chinese Ganoderma contain large amounts of plant sterols in their medicinal components (Huang et al., 2022). Modern pharmacological research has illuminated the beneficial anti-tumor therapeutic effects of β-sitosterol-sitosterol, mainly manifested as effects such as apoptosis induction, anti-proliferation, and anti-metastasis on tumor cells (Cao et al., 2018; Chen et al., 2024). For example, β-sitosterol from Indigofera zollingeriana induces hepatocellular carcinoma cell apoptosis by activating caspase-3 and caspase-9 (Vo et al., 2020). Caspase-3, caspase-9 and Bax are classical apoptosis-associated proteins, and their expression levels tend to be positively correlated with apoptosis (Liu et al., 2021). Many studies have revealed that β-sitosterol can induce LUAD cell (A549) apoptosis, indicating that this phytosterol can serve as a safe candidate drug for treating lung cancer (Hsu et al., 2011; Rajavel et al., 2017). However, research on the role and mechanism of β-sitosterol on LUAD cell apoptosis is still incomplete.

Metabolic disorders, especially glucose metabolism disorders, are a hallmark of tumors such as NSCLC. Even in oxygen-rich conditions, cancer cells tend to reprogram most glucose metabolism reactions to glycolysis. Compared to oxidative phosphorylation, although glycolysis is not an efficient means of generating ATP, inhibiting tumor glycolysis will directly hinder cell growth and survival, and promote apoptosis (Xu et al., 2022). For example, the transcription factor Yin Yang 1 enhances aerobic glycolysis by inducing RNA-binding motif protein 14 expression to promote LUAD cell growth as well as repress apoptosis (Hu et al., 2023). Additionally, Hu et al. (2021) demonstrated that TEA domain 4 plays a crucial part as a transcription factor that can facilitate the expression of pyruvate kinase isozyme M2 (PKM2), thereby mediating glycolysis to accelerate LUAD cell viability, migration and invasion, as well as repress apoptosis. PKM2 is a pivotal regulatory enzyme in glycolysis. Previous studies uncovered that the active component of Strobilanthes crispus and its bioactive compounds (β-sitosterol, stigmasterol and lutein) possess anti-glycolysis capability in triple-negative breast cancer cells (Muhammad et al., 2023). However, whether β-sitosterol can hinder tumor progression by downregulating glycolysis is still unclear.

In this study, we selected the effective component β-sitosterol from Ganoderma spore powder. Computer modeling predicted that β-sitosterol bound directly to CHRM2. Additionally, overexpressed CHRM2 facilitated LUAD cell viability and repressed apoptosis by activating the aerobic glycolysis pathway. Based on these findings, we propose that β-sitosterol inhibits the malignant progression of LUAD by regulating the expression level of CHRM2. These results should provide a solid foundation for the development of traditional Chinese medicine (TCM) active ingredients as novel anticancer therapeutic agents.

RESULTS

Screening of effective molecules in Ganoderma spore powder and analysis of potential drug targets

Ganoderma spore powder is a TCM with a wide range of functions (Xu and Li, 2019). Recent studies have indicated the presence of antitumor activity in Ganoderma spore powder (Deng et al., 2021; Shi et al., 2021), but the specific effector molecules and target genes remain unidentified. To address this issue, we conducted a follow-up study. After screening the effective components of Ganoderma in the TCM systems pharmacology database (oral bioavailability (OB) ≥ 30% and drug likeness (DL) ≥ 0.18), a total of 61 effective molecules (Supplementary Table S1) and 17 target genes (Supplementary Table S2) were obtained.

We then explored potential targets in LUAD. The TCGA database was used to screen differentially expressed genes (DEGs) in LUAD, and a total of 2,510 DEGs (Supplementary Table S3) were obtained. These DEGs and the above target genes were utilized as input, with a confidence score threshold set to 0.7. Using the STRING database to set up a protein–protein interaction (PPI) network (Supplementary Fig. S1), we obtained a total of 1,784 nodes and 15,804 interactions (Supplementary Table S4). After taking the intersection of DEGs and the target genes, a total of four drug target-related genes were obtained (Fig. 1A). These four genes were regarded as seed genes (Supplementary Table S5) to initiate RWR (random walk with restart) analysis on the PPI network. The top 50 genes ranked by affinity (Supplementary Table S6) were selected to set up a drug–active ingredient–gene interaction network (Fig. 1B). The interaction network of the top 50 genes (Supplementary Table S7) indicated that CHRM1, CHRM2 and CHRNA2 were relatively instrumental genes. Furthermore, of all the potent small molecules, β-sitosterol has been repeatedly associated with the ability to inhibit the development of LUAD (Hsu et al., 2011; Delgado et al., 2019; Li and Hou, 2021).

Fig. 1. Compound–target network analysis of potential target genes for drugs. (A) Intersection of target genes and DEGs. DEGs are differentially expressed in LUAD tissues and normal lung tissues; target genes are 17 key target genes of Ganoderma effective small molecules identified by screening the TCM systems pharmacology database. (B) Interaction network of top 50 genes ranked by affinity and drug components (orange rhombus represents TCM, blue triangles represent active molecules, and green ellipses represent the top 50 genes). See Supplementary Table S8 for details.

CHRM2 is a potential target of β-sitosterol in Ganoderma spore powder

Next, we predicted the docking of these three proteins with β-sitosterol on the computer. Their structures are in the AlphaFold database, with the following accession numbers: CHRM1, AF-P11229-F1; CHRM2, AF-P08172-F1; and CHRNA2, AF-Q15822-F1. The results for docking of β-sitosterol to each protein are shown in Table 1. CHRM2 and β-sitosterol have the highest docking affinity, indicating that β-sitosterol binds most stably to CHRM2. This result is consistent with the previous prediction of Tang et al. (2020). The binding region of the two is displayed in Figure 2A and Figure 2B. β-sitosterol forms hydrophobic interactions (Cys124, Pro128, Leu129, Pro132, Arg216, Lys376, Pro377, Glu382) and two group hydrogen-bonding interactions (Asn58, Arg135) with residues of CHRM2. Collectively, these data indicate that CHRM2 is a potential target of β-sitosterol in Ganoderma spore powder.

Table 1. Results of molecular docking

Target	Ingredient ID	Ingredient name	Mode	Affinity (μM)	Determine clashes
					Intra clash	Inter clash
CHRM1	MOL000358	beta-sitosterol	1	136.83
CHRM2	MOL000358	beta-sitosterol	1	5.78
CHRNA2	MOL000358	beta-sitosterol	1	74.26

Note: Intra and inter clash represent destabilizing factors in the protein itself and with the ligand, respectively. Green: stable; yellow: slightly unstable.

Fig. 2. β-sitosterol binds directly to CHRM2. (A–B) 3D (A) and 2D (B) models of the binding mode between β-sitosterol and CHRM2.

CHRM2 mediates aerobic glycolysis to repress LUAD cell apoptosis

CHRM2 belongs to the G protein-coupled receptor family, is encoded on the long arm of chromosome 7, and is involved in the feedback regulation of neuronal excitability, synaptic plasticity and acetylcholine release (Gosso et al., 2006, 2007; Szczepankiewicz et al., 2009). Recently, it has been suggested that CHRM2 also plays a key role in cancer (Wang et al., 2021; Chen et al., 2022), but its mechanism of action remains unclear. To illuminate the function of CHRM2 in LUAD, we predicted the signaling pathways enriched by CHRM2-related genes using gene set enrichment analysis. The prediction results suggested that CHRM2 is associated with glycolysis and apoptosis processes (Supplementary Fig. S2). Repressing glycolysis has been shown to promote cancer cell apoptosis (Kuang et al., 2018). Therefore, to investigate whether the effect of CHRM2 on LUAD A549 cells depends on the glycolysis pathway, we designed the following experiments. CHRM2 was overexpressed in A549 cells, which were also treated with the glycolysis inhibitor lonidamine. The cells were divided into three groups: oe-NC (overexpression vector, negative control; pcDNA3.1 plasmid)+PBS, oe-CHRM2 (pcDNA3.1-CHRM2)+PBS and oe-CHRM2+lonidamine. Lonidamine, a derivative of indazole-3-carboxylic acid, can restrict glucose metabolism in cancer cells by targeting HK2, and is a classical inhibitor of glycolysis (Bhutia et al., 2016). A qRT-PCR assay showed that the level of CHRM2 mRNA was significantly increased in A549 cells overexpressing CHRM2, whereas the simultaneous addition of lonidamine had no significant effect on the expression of CHRM2 (Fig. 3A). A CCK-8 assay showed that overexpression of CHRM2 significantly enhanced cell viability compared with the control group, whereas concurrent treatment with lonidamine eliminated this effect (Fig. 3B). Flow cytometry demonstrated that the apoptosis rate in the oe-CHRM2+PBS group was considerably lower than that in the oe-NC+PBS group, and the decrease in apoptosis rate mediated by CHRM2 overexpression was abolished by treatment with lonidamine (Fig. 3C). In addition, a western blot assay showed that overexpression of CHRM2 inhibited the expression of apoptosis-related proteins (cleaved-caspase-3, cleaved-caspase-9, Bax), while the protein expression levels were restored after lonidamine treatment (Fig. 3D). This result implied that CHRM2 could inhibit apoptosis, while lonidamine treatment impaired the function of CHRM2. We next investigated the effect of CHRM2 on glycolysis, finding that glucose consumption and lactate production increased remarkably in the oe-CHRM2+PBS group, an effect that was eliminated by adding lonidamine (Fig. 3E–3F). Furthermore, CHRM2 overexpression led to a notable increase in the extracellular acidification rate (ECAR) and a notable decrease in the oxygen consumption rate (OCR), both of which effects were weakened after treatment with lonidamine (Fig. 3G–3H). In conclusion, CHRM2 represses LUAD cell apoptosis by enhancing the aerobic glycolysis pathway.

Fig. 3. CHRM2 mediates the effects of aerobic glycolysis on LUAD apoptosis. (A) qRT-PCR detection of CHRM2 expression in different groups. (B) CCK-8 detection of cell viability in each group. (C) Flow cytometry determination of apoptosis rate in different groups. Cells in the Q2-2 region, positive for both PE and FITC fluorescent labels, represent apoptotic cells. (D) Western blot detection of expression levels of apoptotic proteins (cleaved-caspase-3, cleaved-caspase-9 and Bax). (E–F) Measurement of glucose consumption (E) and lactate production (F) in culture media. (G–H) Analysis of ECAR and OCR using a Seahorse XF96 instrument. *, P < 0.05; ns, not significant.

β-sitosterol alleviates malignant progression of LUAD cells by inhibiting CHRM2 expression

To determine whether β-sitosterol affects LUAD apoptosis by targeting CHRM2, we designed the following groups based on A549 cells: DMSO+oe-NC, β-sitosterol+oe-NC, DMSO+oe-CHRM2 and β-sitosterol+oe-CHRM2. The cell viability of each group was then tested by CCK-8 assay, which revealed that compared to the control group, β-sitosterol treatment considerably repressed cell viability, while overexpression of CHRM2 reversed this decrease (Fig. 4A). Furthermore, flow cytometry uncovered that the number of apoptotic A549 cells following treatment with β-sitosterol was remarkably increased; after overexpression of CHRM2, the promoting effect of β-sitosterol on apoptosis was reversed (Fig. 4B–4C). Importantly, β-sitosterol treatment inhibited CHRM2 expression. In addition, CHRM2 overexpression reversed the promoting effect of β-sitosterol on the expression levels of the apoptotic proteins cleaved-caspase-3, cleaved-caspase-9 and Bax (Fig. 4D). We further employed assay kits to measure glucose consumption and lactate production in the culture medium, finding that glucose consumption and lactate production in the β-sitosterol+oe-NC group were lower than those in the DMSO+oe-NC group. Furthermore, both lactate production and glucose consumption returned to the levels in the control group after overexpression of CHRM2 (Fig. 4E–4F). Similarly, in A549 cells, β-sitosterol treatment reduced the extracellular acidification rate (ECAR) and elevated the oxygen consumption rate (OCR), effects that were reversed by overexpressing CHRM2 (Fig. 4G–4H). Taken together, our data suggested that β-sitosterol alleviated malignant progression of LUAD cells by inhibiting CHRM2 expression.

Fig. 4. β-sitosterol alleviates malignant progression of LUAD cells by inhibiting CHRM2 expression. (A) CCK-8 detection of cell viability in A549 cells transfected with DMSO+oe-NC, β-sitosterol+oe-NC, DMSO+oe-CHRM2 and β-sitosterol+oe-CHRM2. (B–C) Flow cytometry determination of apoptosis rate in different groups. (D) Western blot detection of expression levels of CHRM2 and apoptotic proteins (cleaved-caspase-3, cleaved-caspase-9 and Bax). (E–F) Measurement of glucose consumption and lactate production in culture medium. (G–H) Analysis of ECAR and OCR using Seahorse XF96. *, P < 0.05; ns, not significant.

β-sitosterol inhibits LUAD growth by suppressing CHRM2 expression in vivo

Mouse LUAD cells (LA795) stably transfected with oe-NC/oe-CHRM2 were subcutaneously implanted into the armpits of mice, followed by intraperitoneal injection of β-sitosterol or DMSO, thus further evaluating the influence of CHRM2-targeting β-sitosterol on LUAD cell growth rate. We observed that β-sitosterol considerably hindered tumor growth in vivo, while overexpressing CHRM2 reduced the effect of β-sitosterol on tumor growth (Fig. 5A–5C). Moreover, we measured the expression levels of CHRM2, cleaved-caspase-3 and cleaved-caspase-9 by immunohistochemistry, which showed that in the β-sitosterol treatment group, CHRM2 protein level was reduced, while cleaved-caspase-9 and cleaved-caspase-3 protein levels were elevated. In the β-sitosterol+oe-CHRM2 group, the expression of these proteins returned to the control group level (Fig. 5D). Immunofluorescence detection revealed that CD8+T cells and NK cells in the β-sitosterol+oe-NC group were more abundant than in the DMSO+oe-NC group, and the overexpression of CHRM2 reduced the level of immune cell infiltration induced by β-sitosterol (Fig. 5E–5F). Western blot detection demonstrated that β-sitosterol considerably facilitated the expression of the macrophage marker CD47 and suppressed that of the key glycolysis enzymes HK2 and PKM2, while their levels were restored to the control levels by CHRM2 overexpression (Fig. 5G). Consequently, our data suggested that β-sitosterol inhibited LUAD cell growth by suppressing CHRM2 expression in vivo.

Fig. 5. β-sitosterol inhibits LUAD growth by suppressing CHRM2 expression in vivo. (A) Tumor images (21 days after treatment). (B) Tumor growth curves. (C) Measurement and analysis of tumor weight (21 days after treatment). (D) Immunohistochemistry detection of CHRM2, cleaved-caspase-3 and cleaved-caspase-9. (E–F) Immunofluorescence analysis of CD8+T cell and NK cell infiltration. (G) Western blot detection of CD47, HK2 and PKM2. *, P < 0.05; ns, not significant.

DISCUSSION

β-sitosterol is a plant-derived nutrient, widely found in lipid-rich plant foods, that kills LUAD cells without affecting the growth and viability of normal cells (Rajavel et al., 2018). Therefore, investigating the pharmacological mechanism of β-sitosterol in Ganoderma spore powder can set a theoretical basis for molecular targeted therapy and further the development and utilization of β-sitosterol. This project suggested that β-sitosterol can promote LUAD apoptosis by repressing the aerobic glycolysis pathway by targeting CHRM2, implying that β-sitosterol targets CHRM2 and exerts a therapeutic effect in lung cancer.

CHRM2 is a pivotal gene associated with the development of various types of cancers such as bladder cancer (Zhang et al., 2021), gastric cancer (Wang et al., 2021) and colorectal cancer (Li et al., 2022b). The expression level of CHRM2 is closely related to the overall survival of patients (Wang et al., 2021; Zhang et al., 2021). However, whether CHRM2 can affect the progression of LUAD cells is not clear. This issue was answered in this study. We confirmed that overexpression of CHRM2 in A549 cells considerably reduced the apoptosis rate and expression of apoptosis-related proteins.

Reprogramming of glucose metabolism and related events provide hallmark features of cancer, such as simultaneously boosting cell proliferation and repressing apoptosis (Meng et al., 2023). Huang et al. (2021) reported that monoamine oxidase A eliminates aerobic glycolysis in LUAD cells by reducing HK2, thereby hindering tumor cell proliferation. Enzymes (hexokinase, pyruvate kinase and phosphofructokinase-1) overproduced in specific steps involved in glycolysis are potential pharmacological targets for cancer therapy (Ediriweera and Jayasena, 2023). Additionally, lonidamine, a derivative of indazole-3-carboxylic acid, was shown to restrict cancer cell glucose metabolism by targeting HK2. Previous studies have revealed that doxorubicin, lonidamine and extracellular vesicle co-delivery exhibits potential clinical significance in lung cancer treatment (Li et al., 2022a). Of interest, our study found that CHRM2 was able to activate glycolytic metabolism, proliferation and apoptosis resistance in LUAD cells. These regulatory processes were simultaneously affected by glycolytic inhibitors, implying that CHRM2 promotes the development of LUAD by activating glycolytic metabolism.

Furthermore, our network pharmacology analysis demonstrated that CHRM2 was a potential target of β-sitosterol in Ganoderma spore powder. β-sitosterol is an organic compound with various biological activities such as anti-inflammatory, immune modulation, analgesic, lipid-lowering, antioxidant, sedative, antimicrobial and anticancer properties (Babu and Jayaraman, 2020; Jiang et al., 2020). For example, Wang et al. (2017) reported that after β-sitosterol treatment, the viability and tumor growth of A549 cells in NSCLC were repressed. β-sitosterol has also been proven to accelerate A549 apoptosis by targeting p53 and mitochondria (Rajavel et al., 2018). Consistent with these previous findings, the results of our in vitro and in vivo experiments suggested that β-sitosterol induced LUAD apoptosis and immune cell infiltration, and suppressed expression of the key enzymes HK2 and PKM2 as well as tumor growth. However, this effect was counteracted by CHRM2 overexpression. Given all the above findings, we suggest that β-sitosterol affected glycolytic metabolism by regulating the expression level of CHRM2, further inhibiting the malignant progression of LUAD.

In conclusion, β-sitosterol promotes apoptosis in LUAD cells. Through in vitro cell experiments and in vivo tumor transplantation experiments, we confirmed that β-sitosterol suppresses tumor growth and immune escape. The mechanism of action may be that the repression of CHRM2 protein hinders the aerobic glycolysis pathway and boosts LUAD apoptosis. This work proffers strong evidence for the targeted treatment of LUAD by β-sitosterol targeting of CHRM2. However, this project still has its shortcomings. First, the work only utilized one cell line, A549, for analysis, necessitating further verification to confirm whether β-sitosterol targeting of CHRM2 plays a role in modulating apoptosis in other LUAD cell lines. In addition, the lowest effective concentration of β-sitosterol that can be achieved in the human body is unknown. The addition of these data will provide an important experimental basis for the clinical application of β-sitosterol.

MATERIALS AND METHODS

Prediction of Ganoderma compounds and their related target genes

Herbal components of Ganoderma were obtained from the TCM systems pharmacology database (https://old.tcmsp-e.com). The effective molecules and corresponding targets were selected (OB ≥ 30% and DL ≥ 0.18). From The Cancer Genome Atlas database, we acquired the LUAD data (normal, 59; tumor, 541). The edge package was employed to screen DEGs (|logFC| ≥ 2, P-value ≤ 0.05). A PPI network was generated using the STRING database combined with effective molecules’ target genes. An interaction relationship with a confidence score > 0.7 was selected as the basis for constructing the PPI network. The analytical procedure was described previously (Zhang et al., 2022).

Network topology analysis and enrichment analysis

Using the R package dnet, we carried out a RWR analysis on the PPI network obtained above, with the seed being the common genes in drug target genes and disease-related genes. The restart probability was set to 0.85. Employing the Laplacian method, we normalized the adjacency matrix of the network graph. After RWR analysis, we obtained the affinity scores between each gene and the seed. For subsequent functional analysis, we selected the top 50 nodes ranked by affinity scores and used Cytoscape software to construct a drug–active ingredient–gene interaction network. The clusterProfiler package was applied to carry out gene set enrichment analysis of the top 50 genes and identify substantially enriched signaling pathways, based on a previous study (Dong et al., 2021).

PPI network construction and molecular docking analysis

Using NetworkAnalyzer in Cytoscape software, we analyzed the topological features of the PPI network. The appropriate protein structures were downloaded from the UniProt database (https://www.uniprot.org/), with Chimera used to remove excess structures, ligands and surrounding water molecules, and to add hydrogen atoms to convert to a PDB file. Autodock 1.5.7 was used to predict the structure pocket. We downloaded the SDF file of small molecules from the PubChem database (https://pubchem.ncbi.nlm.nih.gov/), and finally used Autodock 1.5.7 software to dock small molecules to the protein pocket for molecular docking simulation. Pymol 4.60 software was employed to display a 3D graph showing the interaction between small molecules and surrounding residues. LigPlot software was employed to display a 2D graph showing the interaction between small molecules and surrounding residues (Misra et al., 2023).

Cell culture and transfection

A human LUAD cell line (A549) and a mouse LUAD cell line (LA795) were bought from BLUEFBIO (China). We kept these cells in DMEM-H medium containing 10% fetal bovine serum in a 5% CO₂ incubator at 37 ℃. To probe the regulatory influence of CHRM2 on aerobic glycolysis in LUAD, A549 cells were treated with 70 µM lonidamine (Sigma-Aldrich, USA) (Kleszcz and Paluszczak, 2022). When the cells reached 80% confluence, they were transfected using Lipofectamine 3000 (Invitrogen, USA). Plasmids oe-CHRM2 (pcDNA3.1-CHRM2) and oe-NC (pcDNA3.1) were obtained from GenePharma (China). Transfected cells were kept for 48 h. qRT-PCR was undertaken to assess the success of transfection. β-sitosterol was purchased from MCE (USA).

CCK-8 assay

We seeded cells in the logarithmic growth phase in a 96-well plate (2,000 cells/well). The cells were transfected after 24 h, with three parallel wells set in each group. At 0, 24, 48 and 72 h after transfection, CCK-8 reagent was added, followed by 2 h of incubation. Absorbance was assessed at 450 nm using a microplate reader.

Western blot

Protein samples were prepared with RIPA buffer (Beyotime, China) containing protease inhibitors and phosphatase inhibitors. Protein concentration was determined with a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, USA). After SDS-PAGE, the protein samples were transferred to a PVDF membrane, blocked with 5% skim milk for 2 h, and incubated overnight at 4 ℃with the following primary antibodies: rabbit anti-human or rabbit anti-mouse cleaved-caspase-3, cleaved-caspase-9, Bax, CD47 (macrophage marker), HK2, PKM2 and β-actin. After washing with TBST, goat anti-rabbit secondary antibodies labeled with horseradish peroxidase (HRP) were added and incubated for 1 h, followed by washing with TBST. Proteins were visualized using a BeyoECL Plus chemiluminescent kit (Beyotime) and bands were imaged using the ChemiScope 6000 chemiluminescence imaging system (Clinx, China). All antibodies above were bought from Cell Signaling Technology (CST) (USA).

qRT-PCR

In brief, total RNA was extracted from cells using the TRIzol reagent (Invitrogen), and its concentration and purity were assessed by a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific). Reverse transcription reactions were conducted using the BeyoRTII cDNA Synthesis Kit (Beyotime). Next, qRT-PCR assays were carried out using AceQ qPCR SYBR Green Master Mix (Vazyme, China) and a LightCycler 480 Instrument II (Roche, Switzerland). Primer sequences are listed in Table 2. The relative gene expression levels in transfected cells were calculated using the 2^-ΔΔCt method, with β-actin as an endogenous control.

Table 2. Primer sequences for qRT-PCR

Gene	Primer sequence (5’→3’)
CHRM2	F: TGGTTTCCATTAAAGTCAACCGC R: ACACCTATGATAAGGTCAGCACA
β-actin	F: CAAGAGATGGCCACGGCTGCT R: CACAGGACTCCATGCCCAGGA

Flow cytometry

Apoptosis of LUAD cells was analyzed using an ApoDETECT Annexin V-FITC Kit (Invitrogen). Cells from each group were digested with trypsin, centrifuged to collect cell pellets, and adjusted to a concentration of 3×10⁵ cells/ml. A 0.5-ml aliquot of cell suspension was mixed with 5 µl Annexin V-FITC and 10 µl propidium iodide staining solution, and then kept in the dark at room temperature for 20 min. The apoptosis rate was measured using the NovoCyte Flow Cytometer System (Agilent, USA).

Detection of glucose consumption and lactate production in cells

A glucose assay kit (Solarbio, China) and a lactate assay kit (Solarbio) were employed to measure glucose consumption and lactate production in LUAD cells after different treatments. Glucose oxidase catalyzes the oxidation of glucose to gluconic acid, producing hydrogen peroxide. Peroxidase catalyzes the oxidation of 4-aminoantipyrine coupled with phenol by hydrogen peroxide, generating a colored compound with a characteristic absorption peak at 505 nm. The glucose content in the cell culture medium was assessed. We then counted cells in each well to standardize the glucose concentration. By measuring the remaining glucose content in the cell culture medium, the glucose consumption was indirectly determined. Lactic acid is converted to pyruvic acid by lactate dehydrogenase, while NAD+ is reduced to generate NADH and H⁺. In the lactate assay, H⁺ is transferred to PMSH2 generated by PMS, reducing MTT to generate a purple substance with a characteristic absorption peak at 570 nm. The production of lactic acid in the cell culture medium was assessed. The lactic acid concentration was normalized by counting cells in each well. We employed a microplate reader (BioTek Instruments, USA) to measure the absorbance at 570 nm.

Measurement of ECAR and OCR

We used the Seahorse XF96 extracellular flux analyzer (Seahorse Bioscience, USA) to determine ECAR and OCR. We seeded 1×10⁴ cells into each well in a Seahorse XF96 cell culture microplate. When the baseline was measured, we sequentially injected glucose, 2-DG and oligomycin into each well at specified time points for ECAR measurement. For OCR detection, we sequentially injected oligomycin, antimycin A, rotenone and FCCP at specified time points. Data were processed using Seahorse XF96 Wave software.

Homograft experiments in vivo

Sixteen 6–8-week-old female C57BL6/J mice were bought from Shanghai SLAC Laboratory Animal Co. (China) and were randomly sorted into two groups, housed in SPF-level mouse rooms. We subcutaneously inoculated LA795 cells (2 × 10⁶) stably transfected with oe-NC/oe-CHRM2 into the armpits of mice (n = 6). When the tumors grew to 100 mm³, the mice were injected intraperitoneally with β-sitosterol (MCE) or DMSO. Tumor volume was tested every three days with a caliper and evaluated using the formula: a (length) × b (width)²/2. After three weeks, the mice were euthanized, and the tumor tissues were separated, weighed and stored for further experiments. All in vivo experiments were approved by the Medical and Life Science Ethics Committee of Zhejiang Shuren University.

Immunohistochemistry

The transplanted tumor tissues were fixed in 4% paraformaldehyde solution, routinely embedded in paraffin, sliced, boiled in sodium citrate buffer (pH 6.0) for antigen retrieval, washed twice with phosphate buffer, and blocked with 3% hydrogen peroxide blocking solution for 30 min. The tissues were then incubated overnight at 4 ℃ with primary antibodies (rabbit anti-mouse CHRM2, cleaved-caspase-3, cleaved-caspase-9), purchased from CST, followed by 30 min of incubation with HRP-labeled secondary antibody (goat anti-rabbit IgG; CST). Finally, after washing with PBS, staining for 5 min with DAB and rinsing with distilled water, we counterstained tissues with hematoxylin for 20 s, dehydrated them in ethanol solutions of increasing concentration (75%, 85%, 95% and 100%), cleared them in xylene and mounted them with neutral gum. Under an optical microscope, we measured the expression levels of CHRM2, cleaved-caspase-3 and cleaved-caspase-9, with brown granules indicating positive protein expression. The proportion of positive cells was quantified using ImageJ software.

Immunofluorescence

Tissue sections were fixed in 4% paraformaldehyde, incubated in 0.3% Triton X-100, blocked with 5% skim milk for 1 h, washed with PBS, and then stained overnight at 4 ℃ with primary antibodies (CD8 or NKp46) purchased from Abcam (UK). The sections were incubated with secondary antibodies (goat anti-rabbit IgG H&L; Abcam) conjugated with Alexa Fluor 488 or Alexa Fluor 594, and counterstained with DAPI for cell nuclei. Fluorescence intensity was tested using the EVOS M7000 imaging system (Thermo Fisher Scientific). The proportion of positive cells was quantified using ImageJ software.

Data analysis

Data were processed using GraphPad Prism 8 software and are presented as mean ± standard deviation. Differences were compared through Student’s t-test (two groups) or one-way analysis of variance (three groups or more). All experiments were done three times (P < 0.05 refers to statistical significance).

DECLARATIONS

Author contribution: Q. Z. conceived the study, participated in its design and interpretation, and helped to draft the manuscript. Y. P., D. Z. and X. Z. participated in the design and interpretation of the data and drafting/revising of the manuscript. Z. X., L. S. and Y. Z. performed the statistical analysis and revised the manuscript critically. All the authors read and approved the final manuscript.

Conflict of interests: The authors have no conflicts of interest to declare.

Data availability statement: The data and materials in the current study are available from the corresponding author on reasonable request.

Funding: This work was supported by grants from Zhejiang Science and Technology Program of Traditional Chinese Medicine (2022ZA149).

Ethics approval and consent to participate: Ethical approval was given by the Medical and Life Science Ethics Committee of Zhejiang Shuren University.

Consent to participate statement: No patients participated in this study.

REFERENCES

• Babu, S., and Jayaraman, S. (2020) An update on β-sitosterol: a potential herbal nutraceutical for diabetic management. Biomed. Pharmacother. 131, 110702. DOI: 10.1016/j.biopha.2020.110702
• Bhutia, Y. D., Babu, E., and Ganapathy, V. (2016) Re-programming tumour cell metabolism to treat cancer: no lone target for lonidamine. Biochem. J. 473, 1503–1506. DOI: 10.1042/BCJ20160068
• Cao, Z.-Q., Wang, X.-X., Lu, L., Xu, J.-W., Li, X.-B., Zhang, G.-R., Ma, Z.-J., Shi, A.-C., Wang, Y., and Song, Y.-J. (2018) β-sitosterol and gemcitabine exhibit synergistic anti-pancreatic cancer activity by modulating apoptosis and inhibiting epithelial-mesenchymal transition by deactivating Akt/GSK-3β signaling. Front. Pharmacol. 9, 1525. DOI: 10.3389/fphar.2018.01525
• Chen, F., Qin, T., Zhang, Y., Wei, L., Dang, Y., Liu, P., and Jin, W. (2022) Reclassification of endometrial cancer and identification of key genes based on neural-related genes. Front. Oncol. 12, 951437. DOI: 10.3389/fonc.2022.951437
• Chen, Y., Yang, Y., Wang, N., Liu, R., Wu, Q., Pei, H., and Li, W. (2024) β-Sitosterol suppresses hepatocellular carcinoma growth and metastasis via FOXM1-regulated Wnt/β-catenin pathway. J. Cell. Mol. Med. 28, e18072. DOI: 10.1111/jcmm.18072
• Delgado, Y., Torres, A., and Milian, M. (2019) Data on cytotoxic pattern of cholesterol analogs for lung adenocarcinoma cells. Data Brief 25, 104179. DOI: 10.1016/j.dib.2019.104179
• Deng, Y., Ma, J., Tang, D., and Zhang, Q. (2021) Dynamic biomarkers indicate the immunological benefits provided by Ganoderma spore powder in post-operative breast and lung cancer patients. Clin. Transl. Oncol. 23, 1481–1490. DOI: 10.1007/s12094-020-02547-9
• Dong, Y., Zhao, Q., and Wang, Y. (2021) Network pharmacology-based investigation of potential targets of astragalus membranaceous-angelica sinensis compound acting on diabetic nephropathy. Sci. Rep. 11, 19496. DOI: 10.1038/s41598-021-98925-6
• Ediriweera, M. K., and Jayasena, S. (2023) The role of reprogrammed glucose metabolism in cancer. Metabolites 13, 345. DOI: 10.3390/metabo13030345
• Gao, C., Kong, N., Zhang, F., Tang, T., Li, J., Ding, H., Sun, Z., Wu, L., and Xu, M. (2022) Risk stratification of lung adenocarcinoma using a nomogram combined with ferroptosis-related LncRNAs and subgroup analysis with immune and N6-methyladenosine modification. BMC Med. Genomics 15, 15. DOI: 10.1186/s12920-022-01164-5
• Gosso, F. M., de Geus, E. J. C., Polderman, T. J. C., Boomsma, D. I., Posthuma, D., and Heutink, P. (2007) Exploring the functional role of the CHRM2 gene in human cognition: results from a dense genotyping and brain expression study. BMC Med. Genet. 8, 66. DOI: 10.1186/1471-2350-8-66
• Gosso, M. F., van Belzen, M., de Geus, E. J. C., Polderman, J. C., Heutink, P., Boomsma, D. I., and Posthuma, D. (2006) Association between the CHRM2 gene and intelligence in a sample of 304 Dutch families. Genes Brain Behav. 5, 577–584. DOI: 10.1111/j.1601-183X.2006.00211.x
• Hsu, H.-F., Huang, K.-H., Lu, K.-J., Chiou, S.-J., Yen, J.-H., Chang, C.-C., and Houng, J.-Y. (2011) Typhonium blumei extract inhibits proliferation of human lung adenocarcinoma A549 cells via induction of cell cycle arrest and apoptosis. J. Ethnopharmacol. 135, 492–500. DOI: 10.1016/j.jep.2011.03.048
• Hu, Y., Mu, H., and Deng, Z. (2021) The transcription factor TEAD4 enhances lung adenocarcinoma progression through enhancing PKM2 mediated glycolysis. Cell Biol. Int. 45, 2063–2073. DOI: 10.1002/cbin.11654
• Hu, Y., Mu, H., and Deng, Z. (2023) RBM14 as a novel epigenetic-activated tumor oncogene is implicated in the reprogramming of glycolysis in lung cancer. World J. Surg. Oncol. 21, 132. DOI: 10.1186/s12957-023-02928-8
• Huang, J., Li, J.-X., Ma, L.-R., Xu, D.-H., Wang, P., Li, L.-Q., Yu, L.-L., Li, Y., Li, R.-Z., Zhang, H., et al. (2022) Traditional herbal medicine: a potential therapeutic approach for adjuvant treatment of non-small cell lung cancer in the future. Integr. Cancer Ther. 21, 15347354221144312. DOI: 10.1177/15347354221144312
• Huang, Y., Zhao, W., Ouyang, X., Wu, F., Tao, Y., and Shi, M. (2021) Monoamine oxidase a inhibits lung adenocarcinoma cell proliferation by abrogating aerobic glycolysis. Front. Oncol. 11, 645821. DOI: 10.3389/fonc.2021.645821
• Jiang, Y.-H., Li, X., Niu, W., Wang, D., Wu, B., and Yang, C.-H. (2020) β-Sitosterol regulated microRNAs in endothelial cells against an oxidized low-density lipoprotein. Food Funct. 11, 1881–1890. DOI: 10.1039/c9fo01976f
• Kleszcz, R., and Paluszczak, J. (2022) The wnt signaling pathway inhibitors improve the therapeutic activity of glycolysis modulators against tongue cancer cells. Int. J. Mol. Sci. 23, 1248. DOI: 10.3390/ijms23031248
• Kuang, Y., Han, X., Xu, M., and Yang, Q. (2018) Oxaloacetate induces apoptosis in HepG2 cells via inhibition of glycolysis. Cancer Med. 7, 1416–1429. DOI: 10.1002/cam4.1410
• Li, H., Xu, W., Li, F., Zeng, R., Zhang, X., Wang, X., Zhao, S., Weng, J., Li, Z., and Sun, L. (2022a) Amplification of anticancer efficacy by co-delivery of doxorubicin and lonidamine with extracellular vesicles. Drug Deliv. 29, 192–202. DOI: 10.1080/10717544.2021.2023697
• Li, J.-L., and Hou, W. (2021) Effect of “Hedyotis Diffusae Herba-Smilacis Glabrae Rhizoma” in treatment of lung adenocarcinoma based on network pharmacology. Zhongguo Zhong Yao Za Zhi 46, 6261–6270 (in Chinese). DOI: 10.19540/j.cnki.cjcmm.20210913.401
• Li, Y., Yuan, F., Lin, Z., and Pan, Y. (2022b) Construction of endogenous RNA regulatory network for colorectal cancer based on bioinformatics. Zhong Nan Da Xue Xue Bao Yi Xue Ban 47, 416–430 (in Chinese). DOI: 10.11817/j.issn.1672-7347.2022.210532
• Lian, D., Lian, L., Zeng, D., Zhang, M., Chen, M., Liu, Y., Ying, W., and Zhou, S. (2022) Identification of prognostic values of the transcription factor-CpG-gene triplets in lung adenocarcinoma: a narrative review. Medicine (Baltimore) 101, e32045. DOI: 10.1097/MD.0000000000032045
• Liu, L., Yan, M., Yang, R., Qin, X., Chen, L., Li, L., Si, J., Li, X., and Ma, K. (2021) Adiponectin attenuates lipopolysaccharide-induced apoptosis by regulating the Cx43/PI3K/AKT pathway. Front. Pharmacol. 12, 644225. DOI: 10.3389/fphar.2021.644225
• Meng, Y., Sun, J., Zhang, G., Yu, T., and Piao, H. (2023) Imaging glucose metabolism to reveal tumor progression. Front. Physiol. 14, 1103354. DOI: 10.3389/fphys.2023.1103354
• Misra, A., Chaudhary, M. K., Singh, S. P., Tripathi, D., Barik, S. K., and Srivastava, S. (2023) Docking experiments suggest that gloriosine has microtubule-targeting properties similar to colchicine. Sci. Rep. 13, 4854. DOI: 10.1038/s41598-023-31187-6
• Muhammad, S. N. H., Safuwan, N. A. M., Yaacob, N. S., and Fauzi, A. N. (2023) Regulatory mechanism on anti-glycolytic and anti-metastatic activities induced by Strobilanthes crispus in breast cancer, in vitro. Pharmaceuticals (Basel) 16, 153. DOI: 10.3390/ph16020153
• Rajavel, T., Mohankumar, R., Archunan, G., Ruckmani, K., and Devi, K. P. (2017) Beta sitosterol and Daucosterol (phytosterols identified in Grewia tiliaefolia) perturbs cell cycle and induces apoptotic cell death in A549 cells. Sci. Rep. 7, 3418. DOI: 10.1038/s41598-017-03511-4
• Rajavel, T., Packiyaraj, P., Suryanarayanan, V., Singh, S. K., Ruckmani, K., and Pandima Devi, K. (2018) β-Sitosterol targets Trx/Trx1 reductase to induce apoptosis in A549 cells via ROS mediated mitochondrial dysregulation and p53 activation. Sci. Rep. 8, 2071. DOI: 10.1038/s41598-018-20311-6
• Shen, Z., Li, X., Hu, Z., Yang, Y., Yang, Z., Li, S., Zhou, Y., Ma, J., Li, H., Liu, X., et al. (2022) Linc00996 is a favorable prognostic factor in LUAD: results from bioinformatics analysis and experimental validation. Front. Genet. 13, 932973. DOI: 10.3389/fgene.2022.932973
• Shi, Y.-J., Zheng, H.-X., Hong, Z.-P., Wang, H.-B., Wang, Y., Li, M.-Y., and Li, Z.-H. (2021) Antitumor effects of different Ganoderma lucidum spore powder in cell- and zebrafish-based bioassays. J. Integr. Med. 19, 177–184. DOI: 10.1016/j.joim.2021.01.004
• Szczepankiewicz, A., Breborowicz, A., Sobkowiak, P., Kramer, L., and Popiel, A. (2009) Association of A/T polymorphism of the CHRM2 gene with bronchodilator response to ipratropium bromide in asthmatic children. Pneumonol. Alergol. Pol. 77, 5–10. DOI:10.5603/ARM.27847
• Tang, M., Xie, X., Yi, P., Kang, J., Liao, J., Li, W., and Li, F. (2020) Integrating network pharmacology with molecular docking to unravel the active compounds and potential mechanism of simiao pill treating rheumatoid arthritis. Evid. Based Complement. Alternat. Med. 2020, 5786053. DOI: 10.1155/2020/5786053
• Vo, T. K., Ta, Q. T. H., Chu, Q. T., Nguyen, T. T., and Vo, V. G. (2020) Anti-hepatocellular-cancer activity exerted by β-sitosterol and β-sitosterol-glucoside from Indigofera zollingeriana Miq. Molecules 25, 3021. DOI: 10.3390/molecules25133021
• Wang, H., Zhou, L., Yang, Y., and Luo, B. (2021) Screening and identification of key genes in EBV-associated gastric carcinoma based on bioinformatics analysis. Pathol. Res. Pract. 222, 153439. DOI: 10.1016/j.prp.2021.153439
• Wang, X., Li, M., Hu, M., Wei, P., and Zhu, W. (2017) BAMBI overexpression together with β-sitosterol ameliorates NSCLC via inhibiting autophagy and inactivating TGF-β/Smad2/3 pathway. Oncol. Rep. 37, 3046–3054. DOI: 10.3892/or.2017.5508
• Wang, Z., Hu, F., Chang, R., Yu, X., Xu, C., Liu, Y., Wang, R., Chen, H., Liu, S., Xia, D., et al. (2022) Development and validation of a prognostic model to predictoverall survival for lung adenocarcinoma: a population-based study from the SEER database and the Chinese multicenter lung cancer database. Technol. Cancer Res. Treat. 21, 15330338221133222. DOI: 10.1177/15330338221133222
• Xu, J., and Li, P. (2019) Researches and application of Ganoderma spores powder. Adv. Exp. Med. Biol. 1181, 157–186. DOI: 10.1007/978-981-13-9867-4_6
• Xu, J.-Q., Fu, Y.-L., Zhang, J., Zhang, K.-Y., Ma, J., Tang, J.-Y., Zhang, Z.-W., and Zhou, Z.-Y. (2022) Targeting glycolysis in non-small cell lung cancer: promises and challenges. Front. Pharmacol. 13, 1037341. DOI: 10.3389/fphar.2022.1037341
• Zhang, D., Tian, J., Xia, Q., Yang, Z., and Gu, B. (2021) Significance and mechanisms analyses of RB1 mutation in bladder cancer disease progression and drug selection by bioinformatics analysis. Bladder Cancer 7, 133–142. DOI: 10.3233/BLC-200368
• Zhang, W., Tian, W., Wang, Y., Jin, X., Guo, H., Wang, Y., Tang, Y., and Yao, X. (2022) Explore the mechanism and substance basis of Mahuang FuziXixin Decoction for the treatment of lung cancer based on network pharmacology and molecular docking. Comput. Biol. Med. 151, 106293. DOI: 10.1016/j.compbiomed.2022.106293