2014 Volume 89 Issue 3 Pages 133-136
We developed polymorphic microsatellite markers in Allium mongolicum Regel, a desert plant widely distributed in western China. To better conserve this species, we need to investigate its genetic diversity and population genetic structure, as well as its evolutionary history. Using the combined biotin capture technique, we isolated 13 novel polymorphic microsatellite loci and evaluated their characteristics using 60 individuals from two populations of A. mongolicum. Two to fourteen alleles per locus were identified for these microsatellites. The observed and expected heterozygosities ranged from 0.132 to 0.875 and 0.447 to 0.986, respectively. These microsatellite markers can be used to assess the genetic variation and genetic structure of A. mongolicum.
Allium mongolicum Regel (Amaryllidaceae), also named wild onion or mountain onion, is a kind of xeromorphic bulbous herbaceous desert plant. This plant has a very high photosynthetic rate and is widely distributed in the grasslands, desert regions, low mountains, and droughty hillsides of northwest China (He et al., 2007; Yan et al., 2007). A. mongolicum is resistant to wind erosion, drought and low temperature, and is therefore important in preventing wind erosion as well as in maintaining and improving regional ecological environments. Apart from being a high-quality forage plant for various livestock species, its leaves are also rich in nutrients, possess a unique flavor, and are a natural green uncontaminated food (Ma et al., 2006; Liu et al., 2007; Yang et al., 2007). However, recent studies on A. mongolicum have focused only on its geographical distribution, nutritional value, morphological characteristics, seed germination characteristics, tissue culture, and artificial cultivation techniques (Ma et al., 2006; He et al., 2007; Liu et al., 2007; Yang et al., 2007); there are no published studies on its genetic diversity or population ecology. An extensive plantation program and horticultural exploitation may have disturbed the genetic background of A. mongolicum. The first step toward better conservation of this species is therefore to evaluate its genetic diversity, for which purpose informative genetic markers in A. mongolicum must be developed. Microsatellites (simple sequence repeats, SSRs), which have the advantages of high variability, codominance, and ubiquity in eukaryotic genomes, are useful molecular markers in population genetic analyses (Walter and Epperson, 2004). In this study, we developed and characterized 13 polymorphic microsatellite loci for A. mongolicum to characterize the genetic diversity and population genetic structure within and between populations of this interesting desert species.
Genomic DNA of A. mongolicum was extracted from dried leaves using a modified CTAB (cetyltrimethyl ammonium bromide) method (Doyle and Doyle, 1987). We isolated microsatellite regions from the total DNA using the enrichment procedure described by Hauswaldt and Glenn (2003). Briefly, extracted DNA (about 300 ng) was digested with the restriction enzyme RsaI (New England Biolabs, Ipswich, MA), and the fragments were ligated to SuperSNX24 linkers (Chen et al., 2011). To enrich for fragments containing microsatellite repeats, the ligation products were hybridized with a mixture of the three 5′-biotinylated oligonucleotide probes (AC)18, (AG)18 and (ATG)18 in 50 μl of hybridization solution (2×SSC, 1 μM each probe and 10 μl ligation products) under the following thermal conditions: initial denaturation at 95℃ for 5 min; quick ramping to 70℃ followed by incremental decreases (0.2℃ every 5 s) to and maintenance at 50.2℃ for 10 min; and finally incremental decreases (0.5℃ every 5 s) to 15℃. Hybridized DNA was then mixed with streptavidin-coated magnetic beads at 37℃ for 1 h. The beads were washed twice with washing solution I (2×SSC, 0.1% SDS) for 2 min at room temperature, and four times with washing solution II (1×SSC, 0.1% SDS) for 2 min at 40℃, 50℃, 45℃, and 45℃ in turn. Captured DNA was recovered by polymerase chain reaction (PCR) with the SuperSNX24 forward primer (5′-GTTTAAGGCCTAGCTAGCAGAATC-3′). The PCR products were purified with the TIANquick Mini Purification Kit (TIANGEN, Shanghai, China). We cloned these fragments enriched with microsatellite loci using the pMD18-T vector and Escherichia coli JM109 cells (TaKaRa, Tokyo, Japan), according to the manufacturer’s instructions. We amplified positive clones using M13 primers. PCR products of the expected size (300–700 bp) were sequenced on an ABI 3130xl Genetic Analyzer (PE Applied Biosystems, Foster City, CA).
A total of 38 clones were found containing repeat regions, and 24 of them were suitable for locus-specific primer design using the software Primer 5.0 (Clarke and Gorley, 2001). These primers were tested for polymorphism in 60 individuals from two geographically distant populations of A. mongolicum (Minqin: 38° 56.975′ N, 103° 40.361′ E; Yinchuan: 38° 30.935′ N, 106° 01.260′ E). Individuals separated by about 20 m were chosen randomly from each population in the year 2013. Healthy leaves were dried directly with silica gel. The PCR amplifications were performed following the work of Li et al. (2009) in 25-μl reactions containing 10–40 ng genomic DNA, 0.3 mM each dNTP, 0.3 μM each primer, 2.5 μl Taq buffer and 1 unit of Taq polymerase (TaKaRa). The PCR program consisted of one step of 4 min at 94℃ followed by 37 cycles each of 30 s at 94℃, 45 s at the annealing temperature (Table 1) and 1 min at 72℃, and a final step of 4 min at 72℃. Amplification products were resolved in a 6% polyacrylamide denaturing gel using a 500 bp DNA ladder (TakaRa) as the reference and visualized by silver staining. The number of alleles per locus (NA) and the observed (HO) and expected (HE) heterozygosities were calculated using GenAlEx 6.3 (Peakall and Smouse, 2006). Linkage disequilibrium (LD) and deviation from Hardy-Weinberg equilibrium (HWE) were tested using the same software. We used MICRO-CHECKER v2.2.3 (Van Oosterhout et al., 2004), which tests the genotyping of microsatellites from diploid populations. This software aids the identification of genotyping errors due to nonamplified alleles (null alleles), short allele dominance (large allele dropout) and the scoring of stutter peaks, and also detects typographic errors.
| Locus | Sequence (5′–3′) | Repeat | Ta (℃) | Size range (bp) | GenBank Accession No. |
|---|---|---|---|---|---|
| Am01 | F: CAAGTTTCTGCTTTATTTCAT | (CA)16 | 60 | 277–329 | JX477787 |
| R: GCCCAAACTATTTCTATTATT | |||||
| Am02 | F: TTCCCATCATAGGCAATAATGTAGA | (GAT)6 | 54 | 363–386 | JX477788 |
| R: ACCCTGTTTCAGCCATTTCC | |||||
| Am03 | F: GTTGATTTTCCTGTTTGGATGGTT | (AC)30 | 58.5 | 306–367 | JX477789 |
| R: GAATAGCCGCTGGGGTGTCTCGTA | |||||
| Am04 | F: TTTCCTCGGTTATTTGGGTTGAT | (AC)17 | 57 | 285–319 | JX477790 |
| R: CTTGTGCTTGGTGTTGCTTCTGG | |||||
| Am05 | F: AGAACGAGGTGTAGTGGAT | (CA)7(GA)22 | 55 | 424–483 | JX477791 |
| R: TTTCGCCTATGATAGTAAT | |||||
| Am06 | F: ATATTCCTGAGTATGCTCCAT | (CA)9GA | 53 | 290–323 | JX477792 |
| R: CAGTGCAAAGATTTCCAAG | TA(CA)5 | ||||
| Am07 | F: ACTGAGTTCTTCTTACGATTATG | (GT)12 | 53 | 356–396 | JX477793 |
| R: ATTCAAGTTTGGACAGTCTACAT | |||||
| Am08 | F: ATGACATGGGTGGATAGGAG | (GT)16 | 55 | 383–416 | JX477794 |
| R: ATGGACATACGAGGACTGAC | |||||
| Am09 | F: TTGGTAAAGGAGAAAATGAAAC | (GT)11 | 53 | 162–185 | JX477795 |
| R: TACATTCTTCTGGGATGCTTAG | |||||
| Am10 | F: ACCCGTTATTCATGTATGTAT | (GT)12 | 53 | 260–285 | JX477796 |
| R: GAGTGTAGTGGCAATAAGAAC | |||||
| Am11 | F: TCAGTTATTTGGGTTTGTTGTC | (AC)19(AT)2 | 54 | 320–372 | JX477797 |
| R: TTGTTGCCTTCTATAAATGCTG | (AC)13 | ||||
| Am12 | F: AAACTCATTTCTGGGTGTCCT | (AC)12 | 54 | 340–365 | JX477798 |
| R: CACGGGTTCGCACTTGTAT | |||||
| Am13 | F: AGAATGACGCTTGAATGGATGC | (GT)26 | 55 | 285–333 | JX477799 |
| R: TTTGGGGTGTTATCGAGTTTTC |
Thirteen of the 24 loci were identified as polymorphic and generated consistent amplification products of the expected size range. The characteristics of these 13 novel informative microsatellite loci for A. mongolicum are listed in Table 1 and their sequences were deposited with GenBank (JX477787 to JX477799). These loci contained 2 to 14 alleles in the 60 sampled individuals, with HE and HO ranging from 0.447 to 0.986 and from 0.132 to 0.875 at each locus, respectively (Table 2). None of the 13 loci displayed significant deviation from HWE for either sampled A. mongolicum population, and no significant LD was detected between any pairs of loci.
| Minqin (38° 56.975′ N, 103° 40.361′ E) (N = 30) | Yinchuan (38° 30.935′ N, 106° 01.260′ E) (N = 30) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Locus | NA | HO | HE | PHW | Null | PSA | NA | HO | HE | PHW | Null | PSA |
| Am01 | 7 | 0.632 | 0.859 | 0.020 | < 0.01 | 0.97 | 3 | 0.135 | 0.386 | 0.347 | < 0.01 | 1.00 |
| Am02 | 13 | 0.875 | 0.897 | 0.050 | < 0.01 | 0.87 | 4 | 0.754 | 0.897 | 0.238 | < 0.01 | 0.87 |
| Am03 | 10 | 0.750 | 0.899 | 0.053 | < 0.01 | 0.93 | 3 | 0.615 | 0.986 | 0.167 | < 0.01 | 1.00 |
| Am04 | 7 | 0.682 | 0.668 | 0.480 | < 0.01 | 1.00 | 4 | 0.508 | 0.693 | 0.155 | < 0.01 | 0.87 |
| Am05 | 8 | 0.727 | 0.889 | 0.272 | < 0.01 | 1.00 | 3 | 0.278 | 0.403 | 0.235 | < 0.01 | 0.93 |
| Am06 | 6 | 0.533 | 0.770 | 0.047 | < 0.01 | 0.87 | 4 | 0.754 | 0.951 | 0.296 | < 0.01 | 0.97 |
| Am07 | 14 | 0.773 | 0.918 | 0.047 | < 0.01 | 0.77 | 7 | 0.572 | 0.739 | 0.388 | < 0.01 | 1.00 |
| Am08 | 6 | 0.688 | 0.806 | 0.177 | < 0.01 | 0.87 | 6 | 0.488 | 0.732 | 0.136 | < 0.01 | 0.90 |
| Am09 | 6 | 0.701 | 0.802 | 0.168 | < 0.01 | 0.90 | 7 | 0.593 | 0.788 | 0.247 | < 0.01 | 0.90 |
| Am10 | 4 | 0.652 | 0.704 | 0.098 | < 0.01 | 0.90 | 5 | 0.400 | 0.703 | 0.373 | < 0.01 | 0.93 |
| Am11 | 3 | 0.525 | 0.708 | 0.231 | < 0.01 | 0.93 | 3 | 0.188 | 0.461 | 0.355 | < 0.01 | 0.97 |
| Am12 | 5 | 0.684 | 0.509 | 0.242 | < 0.01 | 0.97 | 2 | 0.132 | 0.447 | 0.126 | < 0.01 | 0.87 |
| Am13 | 2 | 0.141 | 0.467 | 0.152 | < 0.01 | 0.97 | 5 | 0.698 | 0.702 | 0.256 | < 0.01 | 0.87 |
| Average | 7 | 0.643 | 0.761 | – | – | 0.92 | 4.3 | 0.516 | 0.710 | – | – | 0.93 |
Shown for each population are the number of alleles per locus (NA), observed heterozygosity (HO), expected heterozygosity (HE), P values for the Hardy–Weinberg equilibrium (PHW), frequency of null alleles (Null), and proportion of the 60 individuals that were successfully amplified per locus (PSA). Vouchers of the sampled populations were deposited in the Herbarium of Beifang University of Nationalities, and their accession numbers are ChenMQ-02 and ChenYC-02.
The development of SSR markers is an important step in understanding the genetic makeup of A. mongolicum. These novel polymorphic microsatellite markers are expected to be helpful in studying genetic variation within and between populations, as well as the population ecology of this desert species.
This work was supported by Fermentation Engineering and Biotechnology Key Lab of Beifang University of Nationalities of the State Ethnic Affairs Commission (SEAC) of the People’s Republic of China 2014 year, the Ningxia Higher School Scientific research project NO-2014-155, the Scientific Research Project of Ningxia Higher Education (2010JY001) and Development of Beifang University of Nationalities for the National Natural Science Foundation of China (2012QZP09).
