2019 Volume 94 Issue 2 Pages 95-98
We developed microsatellite markers to compare the genetic variation between the putatively cleistogamous Gastrodia takeshimensis (Orchidaceae) and its chasmogamous sister species G. nipponica. We expected low genetic variation in G. takeshimensis in view of its hypothesized cleistogamy. Eighteen primer pairs were developed from a G. takeshimensis genomic DNA library, and their characteristics were tested for G. takeshimensis and G. nipponica. Seven loci were polymorphic in G. nipponica, whereas all loci showed no polymorphism in G. takeshimensis. Genetic diversity was thus not detected in G. takeshimensis, and it seems to have been lost by repeated selfing in the completely closed flower. The 18 markers described here will be useful for investigating the genetic variation between a cleistogamous species and its chasmogamous sister species.
Gastrodia takeshimensis Suetsugu (Orchidaceae: Epidendroideae, Gastrodieae) was recently described from Takeshima Island, Kagoshima Prefecture, Japan (Suetsugu, 2013). The genus Gastrodia is a group of mycoheterotrophic plants, which obtain carbon from their associated fungi without photosynthesis, and contains ca. 100 species (Suetsugu et al., 2018a, 2018b). The most significant character of G. takeshimensis is that only cleistogamous flowers have been observed. Suetsugu (2013) found no chasmogamous flowers, although hundreds of ramets of G. takeshimensis had been observed in the natural habitat. Complete cleistogamy is defined as the production of only cleistogamous flowers, and has been reported in several species, especially in orchids and grasses (Culley and Klooster, 2007). However, most reports of complete cleistogamy, particularly in orchid species, are based on observation of only a few individuals, often in artificial environments such as greenhouses (Culley and Klooster, 2007), which can overlook phenotypic variation within a species. Therefore, phenological observation of numerous individuals in natural conditions has been recommended to confirm complete cleistogamy (e.g., Darwin, 1877).
In addition to field observation, genetic analysis such as that with microsatellite markers can help to verify complete cleistogamous status. If self-pollination is repeated over many generations, almost all loci should evolve in a monomorphic manner. Genetic variation analysis using microsatellites may thus give us insights into cleistogamy in G. takeshimensis. Therefore, we developed microsatellite markers to evaluate the genetic variation of G. takeshimensis and compared it with the chasmogamous sister species G. nipponica (Suetsugu, 2013) to infer the current and historical existence of outbreeding in G. takeshimensis.
Genomic DNA of G. takeshimensis was extracted using the DNeasy Plant Mini Kit (Qiagen). A DNA fragment library was constructed using the Ion Xpress Plus Fragment Library Kit (Thermo Fisher Scientific), amplified using the Ion PGM Template OT2 400 Kit (Thermo Fisher Scientific), and then sequenced using the Ion PGM Sequencing 400 Kit (Thermo Fisher Scientific) and an Ion 318 Chip v2 (Thermo Fisher Scientific). After filtering for identical reads, 677,737 sequences were screened for potential microsatellite loci using MSATCOMMANDER (Faircloth, 2008). Primers were designed for all sequences containing more than ten dinucleotide or eight trinucleotide repeats using Primer3 software (Rozen and Skaletsky, 1999) with the default settings. A total of 45 primer pairs were obtained for screening. Eighteen primer pairs showing clear peak patterns were selected after an amplification trial using eight ramets from a population on Takeshima Island (Table 1).
| Locus | Primer sequences (5′-3′) | Repeat motif | Ta (℃) | Fluorescent labela | GenBank accession no. |
|---|---|---|---|---|---|
| Gtake005 | GTTGTAACCTCGCAGTCCC | (AT)11 | 57 | VIC | LC435714 |
| AGGAGTGAAGAAACCCTAAATCAC | |||||
| Gtake009 | AATAATGTCCCAACTTAAGCCC | (AG)10 | 57 | FAM | LC435715 |
| GGAGTGAGGCCCGTTCTTG | |||||
| Gtake011 | CAGCTGATCTTACAGTGCCC | (AT)10 | 57 | FAM | LC435716 |
| TGCCTTCAAATATATACGGTGC | |||||
| Gtake012 | CGACCCATTCACATAACTGCC | (TC)14 | 57 | PET | LC435717 |
| AGATTATGCTTGATAATGCTCCG | |||||
| Gtake015 | CGAATGCGGATGACCTCAC | (GA)12 | 57 | PET | LC435718 |
| AGGAAGCAGCAATCAGAAGTTTAG | |||||
| Gtake018 | CCCACTCATTTGCTTAGGTATCC | (TA)10 | 57 | FAM | LC435719 |
| TGCATCTAGAGTGTTGTGCAATC | |||||
| Gtake019 | GGAAGGGCATCACTCGAAG | (TA)10 | 57 | NED | LC435720 |
| CCAGCCTTCCCAAGTAACG | |||||
| Gtake020 | CCATTAGACAAGCCCTCCG | (AAC)9 | 57 | NED | LC435721 |
| TGAATGCATGGGCTATATTGAGG | |||||
| Gtake021 | TGCCATTTCTTTCGAGCAGG | (GAT)10 | 57 | VIC | LC435722 |
| GTGAGGCGATCTTCACAGC | |||||
| Gtake023 | GCACGATGGACCAGGAAAC | (GAT)10 | 57 | VIC | LC435723 |
| TGAACCATTTGAGATTAAGAGTAGGC | |||||
| Gtake026 | ACCTGGCTCGAGGATTTGG | (AAG)9 | 57 | PET | LC435724 |
| ACAGCGGAATGGACATTTATC | |||||
| Gtake029 | TGATCCTTAAGTGTGTCTTCATCC | (AAT)10 | 57 | VIC | LC435725 |
| CCTACAGATCCCTCTGGGC | |||||
| Gtake032 | GTGATCTGCTAGCCTCAACC | (CAT)12CAA(CAT)8 | 57 | NED | LC435726 |
| GCTGAAGCTCTTGGTGTCG | |||||
| Gtake035 | AGCTTAAGAATCAAGCATGGG | (CAT)8 | 57 | NED | LC435727 |
| TTCTCCCTTATCCGCCAGC | |||||
| Gtake037 | CGATTCTGCACAAAGTCGGC | (ACT)8 | 57 | FAM | LC435728 |
| TAATTATCCCGCCCGAAGC | |||||
| Gtake041 | AAAGCTTAGTCGGCGGTTG | (ATA)15 | 57 | FAM | LC435729 |
| CCCAAGTAGCACACCGTTC | |||||
| Gtake042 | TACGGGAAATGAGGCCCAG | (GAT)9 | 57 | PET | LC435730 |
| AGGTCCTCCCACTTTGAACC | |||||
| Gtake043 | AACCGCATGCAAGATCCAC | (ATT)8 | 57 | NED | LC435731 |
| ATAGTTGCTAATTGACCATCGG |
Ta = annealing temperature.
To test the genetic variation of the 18 selected microsatellite loci, 39 ramets from a population of G. takeshimensis on Takeshima Island and 49 ramets from a population of G. nipponica in Munakata City, Fukuoka Prefecture, Japan were used. PCR amplification with fluorescent dye-labeled primers was performed using a protocol described by Blacket et al. (2012). PCR amplification was done in 5-μl reactions using the QIAGEN Multiplex PCR Kit (QIAGEN). Each reaction contained the following components: 10 ng of genomic DNA, 2.5 μl of Multiplex PCR Master Mix, 0.01 μM forward primer, 0.2 μM reverse primer and 0.1 μM fluorescent dye-labeled primer. Amplifications used the following setting: 95 ℃ for 15 min; 33 cycles at 94 ℃ for 30 s, 57 ℃ for 1.5 min and 72 ℃ for 1 min; and an extension at 60 ℃ for 30 min. Product sizes were determined using an ABI PRISM 3130 Genetic Analyzer and GeneMapper software (Applied Biosystems). For each species, we calculated observed heterozygosity (HO), expected heterozygosity (HE) and inbreeding coefficients (FIS) using GenAlEx 6.2 (Peakall and Smouse, 2006). We also tested deviation from Hardy–Weinberg equilibrium and linkage disequilibrium among the polymorphic loci using FSTAT version 2.9.3 (Goudet, 1995).
In G. takeshimensis, no polymorphic loci were observed from the 18 microsatellite loci (Table 2). Meanwhile, in the chasmogamous G. nipponica, seven of the 18 loci were polymorphic, and 19 genotypes were detected from 49 ramets (Table 2). The two species shared their alleles in the seven loci (Table 2). The ranges of HO and HE in polymorphic loci were 0.00–0.16 (mean = 0.05) and 0.04–0.44 (mean = 0.29), respectively. All seven polymorphic loci had significant deviations from Hardy-Weinberg equilibrium (P < 0.05, after Bonferroni correction). Additionally, no significant linkage disequilibrium was observed (P < 0.05, after Bonferroni correction).
| Locus | G. takeshimensis (N = 39, G= 1) | G. nipponica (N = 49, G = 19) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| A | HO | HE | FIS | Size of alleles (bp) | A | HO | HE | FIS | Size of alleles (bp) | |
| Gtake005 | 1 | 0.00 | 0.00 | NA | 188 | 2 | 0.00 | 0.04 | 1.00 | 190–192 |
| Gtake009 | 1 | 0.00 | 0.00 | NA | 193* | 1 | 0.00 | 0.00 | NA | 193* |
| Gtake011 | 1 | 0.00 | 0.00 | NA | 187* | 1 | 0.00 | 0.00 | NA | 187* |
| Gtake012 | 1 | 0.00 | 0.00 | NA | 202 | 1 | 0.00 | 0.00 | NA | 190 |
| Gtake015 | 1 | 0.00 | 0.00 | NA | 178 | 1 | 0.00 | 0.00 | NA | 174 |
| Gtake018 | 1 | 0.00 | 0.00 | NA | 187* | 1 | 0.00 | 0.00 | NA | 187* |
| Gtake019 | 1 | 0.00 | 0.00 | NA | 206 | 4 | 0.04 | 0.36 | 0.89 | 214–222 |
| Gtake020 | 1 | 0.00 | 0.00 | NA | 170 | 1 | 0.00 | 0.00 | NA | 184 |
| Gtake021 | 1 | 0.00 | 0.00 | NA | 194 | 1 | 0.00 | 0.00 | NA | 197 |
| Gtake023 | 1 | 0.00 | 0.00 | NA | 291* | 2 | 0.04 | 0.35 | 0.88 | 279, 291* |
| Gtake026 | 1 | 0.00 | 0.00 | NA | 253 | 2 | 0.06 | 0.36 | 0.83 | 262, 265 |
| Gtake029 | 1 | 0.00 | 0.00 | NA | 279 | 1 | 0.00 | 0.00 | NA | 282 |
| Gtake032 | 1 | 0.00 | 0.00 | NA | 172 | 2 | 0.16 | 0.44 | 0.64 | 169, 175 |
| Gtake035 | 1 | 0.00 | 0.00 | NA | 271 | 1 | 0.00 | 0.00 | NA | 283 |
| Gtake037 | 1 | 0.00 | 0.00 | NA | 223 | 2 | 0.00 | 0.04 | 1.00 | 220, 223 |
| Gtake041 | 1 | 0.00 | 0.00 | NA | 300* | 2 | 0.06 | 0.43 | 0.86 | 285, 300* |
| Gtake042 | 1 | 0.00 | 0.00 | NA | 180* | 1 | 0.00 | 0.00 | NA | 180* |
| Gtake043 | 1 | 0.00 | 0.00 | NA | 174* | 1 | 0.00 | 0.00 | NA | 174* |
N, number of ramets analyzed; G, number of multilocus genotypes; A, number of alleles; HO, observed heterozygosity; HE, expected heterozygosity; FIS, inbreeding coefficient; NA, not available because locus was monomorphic.
Despite the limited number of populations examined, the allele fixation of cleistogamous G. takeshimensis suggests a completely cleistogamous status for this species. Microsatellite markers tend to show higher variation in the species for which primers are developed than in related species (Ellegren et al., 1997). In the present study, conversely, G. nipponica showed polymorphism despite the cross-amplification and no polymorphisms were observed for G. takeshimensis for which the primers were developed. Therefore, the allele fixation of the G. takeshimensis population is likely explained by repeated selfing due to complete cleistogamy.
The low HO and high FIS values of the G. nipponica population are likely explained by a high selfing rate in this population even though they have open flowers. Low HO and high FIS values can be observed for loci having null alleles. However, all seven polymorphic loci consistently showed this pattern in the G. nipponica population, and it probably reflects the genetic status rather than the effect of null alleles. Rarity of polymorphic microsatellite loci and high FIS value is also observed in a nearly fully mycoheterotrophic pyroloid, Pyrola subaphylla Maxim. (Shutoh et al., 2017a, 2017b), and it may be one of the typical genetic characteristics of fully mycoheterotrophic plants that inhabit dark understory habitats, which are usually pollinator-limited environments (e.g., Klooster and Culley, 2009; Martos et al., 2015; Suetsugu, 2015).
In this study, we developed 18 microsatellite markers for putatively cleistogamous G. takeshimensis and for chasmogamous G. nipponica. There was a lack of observed polymorphic loci only in G. takeshimensis, which also provides evidence for its cleistogamous reproduction. The 18 markers described here will be useful for investigating the genetic variation and genetic differentiation between the two species. The results obtained from microsatellite markers will give insights into the relationships between loss of genetic variation and evolution of completely cleistogamous plants.
We thank Miwako Usui for her assistance in the field study. This work was financially supported by the JSPS KAKENHI Grant Number 15K18470 (K. Suetsugu) and 18K06408 (K. Suetsugu and S. Kaneko) and the Environment Research and Technology Development Fund, Ministry of the Environment 4-1605 (Y. Isagi). This work was also supported by Competitive Research Funds for Fukushima University Faculty and a Grant-in-Aid from JSPS Research Fellowship Number 15J12267 (K. Shutoh).
