2021 Volume 96 Issue 4 Pages 199-203
Many plant and animal species exhibit geographic parthenogenesis, wherein unisexual (= parthenogenetic) lineages are more common in their marginal habitats such as high latitude or altitudes than their closely related bisexual counterparts. The Japanese stick insect, Phraortes elongatus (Thunberg) (Insecta: Phasmatodea), is known as a geographically parthenogenetic species due to the existence of both bisexual and unisexual populations. Here, we developed microsatellite markers to infer the genetic variation among populations of P. elongatus. Totally, 13 primer pairs were developed for the species, and they were tested on 47 samples collected from both a bisexual population and a unisexual population. All 13 loci were polymorphic in the bisexual population, whereas no loci were polymorphic in the unisexual population. The loss of variation in the unisexual population implies automixis with terminal fusion or gamete duplication as the mode of parthenogenesis. The markers developed in this study will be helpful for further comprehensive analysis of the genetic diversity and gene flow between bisexual and parthenogenetic lineages of P. elongatus.
Sexual reproduction is a widespread strategy among multicellular organisms; on the other hand, there are many species with alternative modes of reproduction, such as parthenogenesis (Bell, 1982). Parthenogenetic reproduction is frequently observed in stick insects (Insecta; Phasmatodea) (Bedford, 1978), and some species exhibit geographic parthenogenesis, wherein unisexual (= parthenogenetic) lineages are more common in their marginal habitats, such as high latitudes or altitudes, than their closely related bisexual counterparts (Vandel, 1928; Hörandl, 2009; Morgan-Richards et al., 2010). Stick insects have long contributed to our understanding of the evolutionary and ecological consequences of asexual reproduction (Tinti and Scali, 1996; Scali, 2009; Schwander and Crespi, 2009; Schwander et al., 2013; Bast et al., 2018); however, the number of species with genetic data is limited. Investigation of parthenogenesis in various phasmid species with genetic data should provide comprehensive insights into the establishment, maintenance and distribution of parthenogenetic lineages. Moreover, the resultant phylogeographical patterns may validate the hypothesis of long-distance dispersal via bird predation, which was recently proposed based on experiments in the parthenogenetic and wingless stick insect, Ramulus mikado (Rehn) (Suetsugu et al., 2018). It has been predicted that such passive dispersal would expand distribution and enhance gene flow, especially in less mobile species such as stick insects (Suetsugu et al., 2018).
The Japanese stick insect, Phraortes elongatus (Thunberg), is known as a geographically parthenogenetic species, due to the existence of both bisexual and unisexual populations. Niwa (2000) reported that no males were observed in some P. elongatus populations in high-latitude or high-altitude areas (unisexual populations), while bisexual populations have been found in low-latitude or low-altitude regions. The author presented preliminary data implying that both types of females in bisexual and unisexual populations can reproduce by parthenogenesis, although the parthenogenetic ability in the bisexual females was much lower than that in unisexual females (Niwa, 2000). Generally, low-altitude habitats are continuous, whereas high-altitude habitats are often discontinuous. It would be interesting to understand the evolution and the distribution expansion of parthenogenetic lineages in this species. In this study, we developed microsatellite markers to analyze genetic diversity and genetic structure, which may differ between both types of populations in P. elongatus.
Individuals of P. elongatus are wingless and highly cryptic (Fig. 1A, 1B); they are bright green during early nymphal periods, while some females become brownish in late stages. At most locations, females of different colors are found together. Adult males are always green with red lateral lines along their body. Adults and late-stage nymphs can be sexed based on the morphology of abdominal terminal segments, wherein the males possess prominent “claspers”. Their exoskeleton is smooth and lacks sharp spines. During our field survey, P. elongatus was frequently found on the leaves of Rosaceae such as Rosa and Cerasus species, Fagaceae such as Quercus species, and the Polygonaceae species Fallopia japonica (Houtt.). In this study, we used individuals collected from 2015 to 2018 (Fig. 1C). Almost all collected individuals were the late stage of nymph or adult, while in the Shokawa population, all stick insects were the early stage of nymphs. They were reared on leaves of Cerasus sp. until they could be sexed. Based on the result of our field survey (data not shown) and information from the previous study (Niwa, 2000), we classified each population into bisexual (= mixed-sex) or unisexual (= maleless) populations.
Geographic parthenogenesis in the Japanese stick insect, Phraortes elongatus. (A) Photo of a first-instar individual of P. elongatus (white arrow). Nymphs were found in rose bushes in early summer. (B) Images of adults of P. elongatus. (C) Map showing the collection sites of samples used in this study. The map was drawn by maptools in R software (version 3.6.2; http://cran.r-project.org/) with data provided by National Land Numerical Information, Ministry of Land, Infrastructure, Transport and Tourism, Japan (https://nlftp.mlit.go.jp/index.html).
Genomic DNA was extracted from a P. elongatus sample using a Gentra Puregene Tissue kit (QIAGEN) following the manufacturer’s protocol. DNA fragment libraries were constructed using the Ion Xpress Plus Fragment Library Kit (Thermo Fisher Scientific), amplified using the Ion PGM Template OT2 400 Kit (Thermo Fisher Scientific), and then sequenced using the Ion PGM Sequencing 400 Kit (Thermo Fisher Scientific) and an Ion 318 Chip v2 (Thermo Fisher Scientific). After filtering for identical reads, 858,947 were identified. These sequences were screened for potential microsatellite loci using MSATCOMMANDER (Faircloth, 2008). Primers were designed for all sequences containing more than ten dinucleotide or eight trinucleotide tandem repeats using Primer3 software (Rozen and Skaletsky, 2000) with the default settings.
A total of 102 primer pairs were obtained for screening using 16 samples collected from Southern Kyushu to Eastern Honshu in Japan (Fig. 1C). PCR amplification was performed in 5-μl reactions using the QIAGEN Multiplex PCR Kit and a protocol for fluorescent dye-labeled primers (Blacket et al., 2012). Each reaction contained the following components: 10 ng of genomic DNA, 2.5 μl of Multiplex PCR Master Mix, 0.01 μM forward primer, 0.2 μM reverse primer, and 0.1 μM fluorescently labeled primer. Amplifications used the following setting: 95 ℃ for 15 min; 30 cycles at 94 ℃ for 30 s, 57 ℃ for 1.5 min and 72 ℃ for 1 min; and an extension at 60 ℃ for 30 min. Product sizes were determined using an ABI PRISM 3130 Genetic Analyzer and GeneMapper software (Applied Biosystems).
For the 13 markers (Table 1) showing a clear peak pattern in the screening, the genetic variation was evaluated using 47 individuals from two populations of P. elongatus in Japan. The first population was collected from Kongosan, where males have been observed (bisexual population), in Nara Prefecture (Gose city, N34.44, E135.69, elevation 414.5 m). In this population, 17 males and 12 females were used for analysis. The 18 individuals as the second population were collected from Shokawa, where no males have been observed (unisexual population), in Gifu Prefecture (N35.98, E136.98, elevation 955.6 m) (Fig. 1C). In this analysis, we employed forward primers to which fluorescent dyes were added as shown in Table 1. Each reaction contained the following components: 10 ng of genomic DNA, 2.5 μl of Multiplex PCR Master Mix, 0.2 μM forward and reverse primer. Amplifications used the following setting: 95 ℃ for 15 min; 30 cycles at 94 ℃ for 30 s, 57 ℃ for 1.5 min and 72 ℃ for 1 min; and an extension at 60 ℃ for 30 min. Product sizes were determined using an ABI PRISM 3130 Genetic Analyzer and GeneMapper software (Applied Biosystems). We calculated observed heterozygosity (HO) and expected heterozygosity (HE) for each microsatellite locus and F’ST (Weir and Cockerham, 1984; Meirmans and Hedrick, 2011) between the two populations using GenAlEx 6.5 (Peakall and Smouse, 2012). Calculation of inbreeding coefficients (FIS) and tests of deviation from Hardy–Weinberg equilibrium for polymorphic loci and linkage disequilibrium were performed by FSTAT version 2.9.3 (Goudet, 1995). Note that prior to the genotypic analysis, we conducted flow cytometric analysis because parthenogenetic lineages are often accompanied by polyploidy in stick insects (Ghiselli et al., 2007; Scali, 2009). We found no significant difference in the genome size between females in bisexual populations and those in unisexual populations. Males exhibited a genome size similar to (but slightly smaller than) these females, and were confirmed to be diploid by an analysis for sperm cells (haploid cells) (Nozaki et al., unpublished data). Therefore, it is reasonable to consider all individuals as diploid.
| Locus | Primer sequences (5′–3′) | Ta (℃) | Fluorescent label | Repeat motif | Target size (bp) | DDBJ accession no. |
|---|---|---|---|---|---|---|
| Pe006 | F: TCAAGGTCAGCACGAAGCC | 57 | NED | (TG)14 | 278 | LC623823 |
| R: GAAGGTGGTTGGCCTGAAG | ||||||
| Pe009 | F: AAGATGGCCGGGCAAATTC | 57 | FAM | (AG)10 | 318 | LC623824 |
| R: TCCCAGGCTCCATCACTTG | ||||||
| Pe013 | F: GAGAAGTTCGATCACCGACAG | 57 | NED | (AG)15 | 225 | LC623825 |
| R: GGTGTCGATATTGCCGTGC | ||||||
| Pe016 | F: ACGAACCGTTTATCTACCACG | 57 | FAM | (AG)10 | 216 | LC623826 |
| R: TGTGGAAAGAGGTCTAGCCG | ||||||
| Pe019 | F: TTGCACCCAACAGGAGACC | 57 | FAM | (GT)11 | 299 | LC623827 |
| R: ACGCTTCATCGACTTTCGC | ||||||
| Pe022 | F: AAGCGGACCAAGTTAGGCG | 57 | VIC | (AC)11 | 150 | LC623828 |
| R: TGGTAGTCTGGTTAGCCACC | ||||||
| Pe024 | F: CACATACTACACGGCCAAGG | 57 | PET | (CT)10 | 212 | LC623829 |
| R: TCGTGGCAGTAGGGATTGG | ||||||
| Pe047 | F: ACATTGTGACGTTCGCCAG | 57 | FAM | (GT)10 | 151 | LC623830 |
| R: ATCGCGACTCTCTAAGCCC | ||||||
| Pe057 | F: TCAGGGATGCTCCACATCG | 57 | PET | (GA)10 | 302 | LC623831 |
| R: CCGCAGCGATATTCGTGTC | ||||||
| Pe061 | F: CCTGTTTCATGGGAGCTCTG | 57 | FAM | (TC)11 | 226 | LC623832 |
| R: ATGCTAGGAACCTCGGGTG | ||||||
| Pe081 | F: ATTGTGAGCACTCCAGTTTAAG | 57 | VIC | (AC)12 | 205 | LC623833 |
| R: TGCCGTGTATTAAAGGGTCAAAG | ||||||
| Pe090 | F: GGGCTGTGTTGTAAGTAGCC | 57 | NED | (CA)10 | 151 | LC623834 |
| R: TGGTGCTGGAACACTGAGG | ||||||
| Pe096 | F: AACTGCTGATCTTTCAAACCC | 57 | PET | (TG)15 | 260 | LC623835 |
| R: ACAGTCAGACGTGCGTTC |
Ta = annealing temperature.
In the Kongosan population, a bisexual population, we found that the ranges of HO and HE were 0.00–0.79 (mean = 0.40) and 0.00–0.77 (mean = 0.44), respectively (Table 2). Two loci, Pe081 and Pe090, showed significant deviations from Hardy–Weinberg equilibrium (P < 0.05, after Bonferroni correction), suggesting the existence of null alleles in these loci. In the Shokawa population, wherein no male individual was observed (unisexual population), all loci showed single alleles. The values of HO and HE in the polymorphic loci were all zero (Table 2). While alleles were shared between the two populations (Table 2), the genetic differentiation was high between them (F’ST = 0.543), probably due to the loss of allelic variation in the Shokawa population.
| Locus | Kongosan (bisexual population) N = 29 (males and females) | Shokawa (unisexual population) N = 18 (all females) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| A | HO | HE | FIS | Size range | A | HO | HE | FIS | Size range | |
| Pe006 | 4 | 0.62 | 0.54 | −0.139 | 262–274 | 1 | 0.00 | 0.00 | NA | 262 |
| Pe009 | 6 | 0.62 | 0.71 | 0.144 | 312–324 | 1 | 0.00 | 0.00 | NA | 314 |
| Pe013 | 7 | 0.66 | 0.72 | 0.109 | 214–226 | 1 | 0.00 | 0.00 | NA | 222 |
| Pe016 | 3 | 0.17 | 0.16 | −0.061 | 205–215 | 1 | 0.00 | 0.00 | NA | 213 |
| Pe019 | 1 | 0.00 | 0.00 | NA | 292 | 1 | 0.00 | 0.00 | NA | 292 |
| Pe022 | 3 | 0.21 | 0.19 | −0.07 | 141–145 | 1 | 0.00 | 0.00 | NA | 141 |
| Pe024 | 8 | 0.79 | 0.77 | −0.017 | 216–230 | 1 | 0.00 | 0.00 | NA | 222 |
| Pe047 | 4 | 0.62 | 0.58 | −0.045 | 152–158 | 1 | 0.00 | 0.00 | NA | 152 |
| Pe057 | 6 | 0.24 | 0.22 | −0.062 | 297–307 | 1 | 0.00 | 0.00 | NA | 297 |
| Pe061 | 2 | 0.03 | 0.03 | 0.000 | 218–220 | 1 | 0.00 | 0.00 | NA | 218 |
| Pe081 | 4 | 0.28 | 0.47 | 0.428* | 185–205 | 1 | 0.00 | 0.00 | NA | 185 |
| Pe090 | 5 | 0.41 | 0.71 | 0.434* | 139–147 | 1 | 0.00 | 0.00 | NA | 141 |
| Pe096 | 3 | 0.59 | 0.59 | 0.031 | 252–256 | 1 | 0.00 | 0.00 | NA | 256 |
N, number of individuals analyzed; A, number of alleles; HO, observed heterozygosity; HE, expected heterozygosity; FIS, inbreeding coefficient (* indicates that the value deviates significantly from Hardy–Weinberg equilibrium); NA, not available because the locus was monomorphic.
The complete loss of heterozygosity in the Shokawa population suggests that P. elongatus parthenogenesis is accomplished by automixis with terminal fusion, or gamete duplication. This is because offspring produced by parthenogenesis with terminal fusion or gamete duplication exhibit the loss of microsatellite heterozygosity, while parthenogens produced by automixis through central fusion or apomixis can maintain the same degree of heterozygosity as their mothers (Schwander and Crespi, 2009; Matsuura, 2017; Alavi et al., 2018). To date, in the facultatively parthenogenetic species of the stick insect order Phasmatodea, terminal fusion and gamete duplication have been reported in Extatosoma tiaratum (Macleay) (Alavi et al., 2018) and Bacillus rossius (Rossi) (Pijnacker, 1969), respectively. Determination of P. elongatus parthenogenesis mechanisms will require cytological observations or detailed mother–offspring microsatellite analysis focusing on recombination, wherein the markers presented in the current study will be an essential tool. The effect of sex-manipulating bacteria, such as Wolbachia and Spiroplasma, might also be considered in future studies, although it is unlikely to arise in stick insects (Pérez-Ruiz et al., 2015).
Overall, we successfully developed 13 microsatellite markers for P. elongatus, and these markers were sufficient for population genetic analysis of this species. Our markers will enable more comprehensive phylogeographic analysis, focusing on the genetic diversity and gene flow within and between bisexual and unisexual populations, which should advance our understanding of passive dispersal of stick insects (Suetsugu et al., 2018). Together with a previous analysis of other stick insects in Japan (Kômoto et al., 2011), including R. mikado, which is an obligate parthenogenetic species and inhabits sympatrically with P. elongatus (Suetsugu and Nozaki, 2020), population genetics in P. elongatus will provide valuable insight into the evolution and distribution of parthenogenetic lineages.
We thank Professor K. Matsuura of Kyoto University for the experimental space, and S. Dobata, Y. Namba, H. Ohira, Y. Mashimo, R. Shina and Y. Nakazawa for their assistance in the field study and DNA analysis. We also thank T. Nawa of Nawa Insect Museum for habitat information for stick insects in Japan. We also appreciate the editors and anonymous reviewers for their helpful suggestions on the manuscript. This work was financially supported by the Japan Society for the Promotion of Science to K. Suetsugu (Challenging Exploratory Research No. 18K19215) and T. N. (Research Fellowship for Young Scientists No. 19J01756). This work was also supported by Competitive Research Funds for Fukushima University Faculty.
