Fine mapping of Green a, Ga, on chromosome 27 in Bombyx mori

ABSTRACT

Some strains of silkworms produce green cocoons of varying intensities. This results from quantitative and qualitative differences in flavonoid pigments, which are influenced by the environment and genetic background. We discovered that the appearance of a faint green cocoon is regulated by a gene (G27) located on chromosome 27. Through mating experiments, we found that G27 is identical to an essential flavonoid cocoon gene, Ga. This locus has not been previously described. Furthermore, we narrowed down the Ga region to 438 kbp using molecular markers. Within this region, several predicted genes for sugar transporters form a cluster structure, suggesting that Ga is among them.

INTRODUCTION

Several strains of the silkworm, Bombyx mori L., produce green and yellow cocoons, which get their color from flavonoid and carotenoid pigments, respectively. These pigments are absorbed into the intestine of the caterpillar after ingesting mulberry leaves. They are then transferred to the middle silk glands through the hemolymph and secreted into the sericin layer of the cocoon shell. The transportation of carotenoid pigments is regulated by the Y (Yellow), C (Yellow cocoon), and F (Fresh) genes, and the underlying molecular mechanism has been established (Sakudoh et al., 2007, 2010, 2013). However, the intensity of the green color of the cocoon shell varies widely because of the flavonol content or the structure (Hirayama et al., 2009). It is regulated by a combination of genetic and environmental factors. For example, Ign-1 (Inhibited green 1) is a gene that lightens the color of the green cocoon (Fujimoto et al., 1962). This reduction in the intensity of the green color of the cocoon shell is caused by a defect in P5CR1 (pyrroline-5-carboxylate reductase 1) function (Hirayama et al., 2018). The lighter green cocoons are known as “sasa-mayu,” and they may be classified as light green, pale green, and faint green, based on their relative shade of green. The sasa-mayu is essentially regulated by the co-expression of Ga (Green a) and Gb (Green b) (Hashimoto, 1941). Recently, Gb was identified as a loss of a functional mutation of the quercetin 5-O-glucosyltransferase (Q5GT; Daimon et al., 2010); however, the molecular entity of Ga remains unknown.

Chromosome substitution lines (CSLs), consomics, are powerful tools for studying poly or plural genic traits and quantitative trait loci (Ebitani et al., 2005; Gregorová et al., 2008). In Bombyx, several traits including cocoon color have been examined using semi-consomics between B. mori and B. mandarina (Fujii et al., 2021). In the process of developing another CSL series of B. mori, we de novo discovered G27 as a gene responsible for the faint green cocoon on chromosome 27 and speculated that it is the same as Ga (Mase et al., 2011). In the present study, we identified both genes, G27 and Ga, using a complementation test. Furthermore, to clarify the gene responsible for the color change, the locus was mapped using SNP markers on chromosome 27.

RESULTS

Complementation test for Ga locus identification on chromosome 27

The G27 gene, which regulates green cocoon coloration, is located on chromosome 27 in the silkworm (Mase et al., 2011). Larvae of the chromosome substitution line (consomics), DH27, hardly accumulate flavonoid pigments on their cocoon layer, which results in a white cocoon, because the chromosome 27 pair of the green cocoon strain, “DM; Daizo (Matsumura),” is replaced by that of the white cocoon strain, “J01” (Fig. 1A). Although the cocoon shells of SM; Shouhaku (Maebashi) and B8; B8 Madara-Abura strains are white because they lack flavonoids, most of the cocoon shells of their F₁ (SMxB8) contains flavonoid pigments, yielding a faint green color known as sasa-mayu. This is the result of the co-expression of the normal Ga of SM, which is a Gb mutant, and the normal Gb of B8, which expresses abnormal Ga (Hashimoto, 1941). We mated DH27 with SM or B8 to determine whether G27 is the same as Ga, Gb, or a novel cocoon color gene. As a result, the cocoon shell of F₁ with SM (SMxDH27) became sasa-mayu-colored, although a little bit darker (pale green), whereas mating with B8 (B8xDH27) resulted in a white cocoon. In addition, F₁ between SM and J01 results in a white cocoon. This indicates that the Gb abnormality in SM was compensated for by normal Gb on chromosome 7 of DH27 derived from DM; however, the Ga abnormality of B8 could not compensate for the +^G27 on chromosome 27 of DH27 derived from J01 (Fig. 2).

Fig. 1. Genetic complementation test between G27 and Ga or Gb. (A) Images of the parental strains and their F₁-produced cocoon shells. All cocoon color categories and expected genotypes are shown in parenthesis and brackets in the photograph, respectively. DM produces green cocoons. The cocoons of the other parental strains (J01, DH27, SM, and B8) are white. SMxB8 and SMxDH27 yield sasa-mayu cocoons, whereas the cocoon color of B8xDH27 and SMxJ01 is white. (B) Flavonoid content of cocoon shells produced by the parental strains and their F₁. Different letters above the bar graph represent significant differences by Tukey’s honestly significant difference test (HSD test; n = 5, p < 0.01).

Fig. 2. Schematic representations of the genetic complementation tests (cis-trans tests) for identifying G27 with the existing sasa-mayu genes, Ga or Gb. Horizontal boxes indicate the chromosomes for each strain. Striped box: B8, White box: SM, Gray box: DM derivative; Black box: J01 derivative.

To evaluate quantitatively whether the cocoons obtained from the mating experiments using CSL and Ga or Gb mutant strains, B8 and SM, result from the accumulation of flavonoids, flavonoid pigments were extracted from each cocoon layer and the absorbance was measured at 372 nm (Fig. 1B). A high absorbance was observed for the green cocoon layer of DM, because a large amount of flavonoid pigments had accumulated, but almost no flavonoid pigment accumulated in the cocoon layer of the J01 white cocoon. The green and sasa-mayu-colored cocoons (Fig. 1A) resulted from the accumulation of flavonoids in Fig. 1B. In addition, DH27 exhibited a slight absorption, but no significant difference compared with J01. In contrast, the cocoon layer of SM and B8 showed almost no absorbance at 372 nm, but the accumulation of flavonoid pigments was observed in the F₁ sasa-mayu cocoon (SMxB8), although not as much as that in the green cocoon of DM. However, F₁ cocoons resulting from SM and DH27 showed a significantly higher 372 nm absorbance compared with that of SMxB8, although lower than that of DM. Flavonoid accumulation was not observed in F₁ cocoons resulting from B8 and DH27. No flavonoid accumulation was observed in the F₁ cocoons of SM and J01. Based on these findings, the G27-expressing green cocoon on chromosome 27 of DM is essentially the same as Ga, but not Gb.

Fine mapping of the Ga locus on chromosome 27

When segregants producing faint green cocoons in BC₁, (J01xDM)xJ01, were backcrossed again with J01, the BC₂ individuals could be separated into faint green: white = 1: 1 (Fig. 3). This segregation ratio indicated that chromosome 27 in the individuals with faint green cocoons was derived from J01 and DM in a heterozygous state (Mase et al., 2011). A faint green cocoon male harboring heterozygous chromosome 27 was crossed with a J01 female to map Ga, because genetic recombination occurs only in male silk moths (Sturtevant, 1915). A total of 1,666 offspring were segregated into faint green: white = 863: 803 (Fig. 3). Next, 81 of them (faint green: white = 45: 36) were genotyped using primer sets for 5 SNP markers (Table 1) and Ga was mapped to a region of 4.2 cM between S087A05 and T635K10 (Fig. 4A).

Fig. 3. Mating process for genetic recombination tests for the faint green cocoon gene, Ga (G27).

Table 1. Sequences of SNPs marker used in this study

SNPs marker	Left primer	Right primer
S602G15	CGACGTGACAGATCTCAAACA	TGTGACGAACTCTTTAAACGCA
T094J04	GCAAAAATTGTCGAGACACC	CAGAATCATCAAACCTACCTGGA
S087A05	TGTGTTAGCATGTTTGGCAAC	AGCATATTTTGATGTGGCGA
526-5	TCCGTTTCCAGGTATTGAGC	GTCATACGCGATCTTCAGCA
925-2-2	TACAACGGCACGGACAATAA	GCTGCCTCACCGTACTCTTC
925-4-2	GCTGCCTTAGAATGGACTCG	CCACGGTATTTTGGACTGCT
925-6-4	CGCTTGCATTGAAGTCGTAA	AGGTTCGGTCACAAAACGAC
T013O19	TTTAATTGGTTTGTTGGATGGTT	CAACATGTTCCCCCAACATA
T635K10	GCCGTCAAACTATTCAGCGT	TTACAATCCATGCGACCTTG

Fig. 4. Fine mapping of Ga on chromosome 27 using SNP markers. (A) Rough linkage mapping of Ga on chromosome 27 using the 81 offspring. (B) Genotypes of each SNP marker around the Ga candidate region (438 kbp) on chromosome 27. Segregants with A were scored as homozygous and those with H were scored as heterozygous.

Next, several site-specific primer sets in the restricted Ga region were designed based on the silkworm genome sequence in NEW KAIKObase ver. 4.3.1 (https://kaikobase.dna.affrc.go.jp) (Yang et al., 2021). They were reconfirmed as different SNPs between DM and J01 (Table 1). Each genotype of 1,432 individuals (faint green: white = 757: 675) of the 1,666 offspring was analyzed with these primer sets. From the segregation pattern obtained with each SNP marker, Ga was consequently mapped between the 925-2-2 and 925-6-4 SNP markers, and it was located so close to 925-4-2 without genetic recombination (Fig. 4B). Based on the NEW KAIKObase information, the results indicate that the candidate region of Ga is within 438 kbp on chromosome 27 (925-2-2; 9,225 kbp ~ 925-6-4; 9,663 kbp). The full-length cDNA and the genes predicted in the gene set and gene model are located between 925-2-2 and 925-6-4 in the NEW KAIKObase. They are summarized in Table 2 as candidate genes of Ga. In this region, 12 sugar transporter genes (Underlined in Table 2) were clustered in the vicinity of 925-4-2, whereas recombination with Ga did not occur.

Table 2. Predicted gene on the Ga candidate region of chromosome 27

Gene Model (2017)	FLcDNA	Gene set A (2013)	Description	Gene Expressed Organ
KWMTBOMO16104		BMgn004620	histon lysine demethylase	OV, TT, (SG, FB, MT)
KWMTBOMO16105			histon lysine demethylase	OV, TT, (SG, FB, MT)
KWMTBOMO16106			uncharacterized protein	MT, MSG, OV
KWMTBOMO16107			uncharacterized protein	TT
		BMgn013984	uncharacterized protein
		BMgn013983	uncharacterized protein
KWMTBOMO16108			blastopia polyprotein	MSG, MT, (OV, TT)
	AK378604	BMgn016058	hypothecal protein Phum	Br
KWMTBOMO16109		BMgn004621	nose resistant to fluoxetine protein 6-like	MSG, (ASG, MG, MT, OV, TT)
KWMTBOMO16110	AK387332	BMgn004622	cathepsin L-like proteinase isoform X1	OV, TT, MT
	AK379884	BMgn017302	sugar transporter protein	TT
KWMTBOMO16111	AK388517	BMgn017304	sugar transporter protein 3	MT
	AK387106	BMgn017303	unknown	MT
KWMTBOMO16112		BMgn004506	sugar transporter protein 2	MG, (MT, OV, TT)
KWMTBOMO16113			sugar transporter ERD6-like 15	MSG, OV, TT, (PSG)
KWMTBOMO16114			sugar transporter ERD6-like 15	PSG, MSG, (MT, TT, OV)
KWMTBOMO16115			sugar transporter ERD6-like 6 isoform X2	MSG, (PSG, ASG, OV)
KWMTBOMO16116		BMgn004507	sugar transporter protein 2	MSG, PSG, (TT)
		BMgn004538	monosaccharide-sensing protein 1
		BMgn004508	sugar transporter protein 2
KWMTBOMO16117			hypothecal protein	OV, MSG, PSG, TT
KWMTBOMO16118			monosaccharide-sensing protein 3 isoform X1	MSG, (PSG, OV, TT)
KWMTBOMO16119		BMgn004510	sugar transporter protein 2	MSG, PSG, (TT, OV, MT, ASG, FB, MG)
KWMTBOMO16120	AK383639	BMgn004511	sugar transporter protein 2	MSG, PSG, MG, OV, FB, (TT)
	AK378856	BMgn017301	unknown	Br
		BMgn004512	uncharacterized protein
KWMTBOMO16121		BMgn004537	uncharacterized protein	OV, MT, TT, (ASG, FB, MG, MSG, PSG)

Underlined are predicted sugar transporter genes. Highly expressing organs are in bold, organs with low expression are in parentheses.

OV: ovary, TT: testis, ASG: anterior silkgland, MSG: middle silkgland, PSG: posterior silkgland, FB: fat body, MT: malpighian tube, Br: brain.

DISCUSSION

In the present study, G27, which is a gene associated with faint green cocoons located on chromosome 27 (Mase et al., 2011), was identified with Ga based on a mating experiment with SM, which has normal Ga, but abnormal Gb, and B8, which has normal Gb, but abnormal Ga. These results indicate that the Ga locus has not been identified thus far because of its location on chromosome 27, where no marker gene has been identified. In addition, we were able to identify the narrower restricted region of the Ga locus in the silkworm genome by fine mapping with SNP markers on chromosome 27.

Based on a search of the NEW KAIKObase, this region includes a clustered structure of predicted sugar transporter genes. As shown in Fig. 5, flavonoid pigments from mulberry leaves ingested into the gastrointestinal tract are released to the hemolymph by Gb and secreted from the middle silk gland into a cocoon layer protein, sericin, by Ga (Fujimoto, 1963). Gb has already been identified as Q5GT and its product catalyzes the regioselective formation of quercetin 5-O-glucoside, the major constituent of cocoon flavonoids in the silkworm trunk (Daimon et al., 2010). A comparative analysis of the transcript revealed that the expression of the sugar transporter gene in addition to Q5GT was significantly different between green and white cocoon strains (Lu et al., 2016).

Fig. 5. Schematic diagram of the function of Ga, Gb, and Ign-1 genes on green cocoon formation of silkworms. The three large arrows indicate the processes in which each mutated gene may be involved. Dietary quercetins are glucosylated by Q5GT encoded by Gb in the midgut (Daimon et al., 2010) and are likely transported via the glucose transporter encoded by Ga into the silk glands (this study), resulting in a faint green sasa-mayu cocoon. Furthermore, quercetin 5-O-glucosides are converted to prolinylflavonols by a deficiency of P5CR1 encoded by Lg, which is likely to be identical to Ign-1, resulting in green cocoons (Hirayama et al., 2018).

In mammals, two mechanisms for absorbing flavonoid glucosides into small intestinal epithelial cells have been proposed: (1) active uptake of quercetin glucoside by the sodium-dependent glucose transporter (SGLT1) with subsequent deglycosylation within enterocytes by cytosolic beta-glucosidase, and (2) luminal hydrolysis of the glucoside by lactase phlorizin hydrolase and absorption of the released aglycone by passive diffusion (Gee et al., 2000; Wolffram et al., 2002; Day et al., 2003). After absorption, flavonoids undergo a metabolic conversion into different conjugated forms, such as glucuronides and sulfates, in small intestinal epithelial cells (Zhang et al., 2007; Passamonti et al., 2009). In addition, the ATP-binding cassette (ABC) superfamily, which includes organic anion transporters and multi-resistant protein 2 (MRP2), may be involved in the disposition of flavonoid glucuronides (O’Leary et al., 2003; Williamson et al., 2007; Zhang et al., 2007; Wong et al., 2012). Flavonoids competitively inhibit the uptake of sugar by GLUT2, a sugar transporter (Kwon et al., 2007). In the present study, many sugar transporter genes were identified in the Ga region, but not ABC superfamily transporter genes. Therefore, it is possible that sugar transporters are also involved in the disposition of flavonoid glucosides in insects. Identifying Ga will enable a comparison of the flavonoid molecular dynamics between mammals and insects.

Gb expresses Q5GT in the midgut cells (Daimon et al., 2010), whereas Ga is thought to function by permeating silk glands with flavonoid pigments (Fujimoto, 1963). Based on RNA sequencing data in the NEW KAIKObase, many of the predicted sugar transporter genes in the cluster representing the Ga region (KWMTBOMO16113, 16114, 16115, 16116, 16118, 16119, and 16120) are primarily expressed in the middle silk gland. From this data, Ga is likely to be a sugar transporter gene. As mentioned above, we proposed a transportation process involving flavonoid molecules in silkworm larvae based on these results (Fig. 5). However, there are many unknown or uncharacterized protein-genes in the region that we identified, which suggests other novel mechanisms for flavonoid transportation and accumulation into the middle silk gland. In future studies, we will compare the expression profiles and structural variation of Ga candidate genes between several green and white cocoon strains to further narrow down the Ga region, identify the responsible gene, and elucidate the flavonoid dynamics of silkworm larvae.

The sasa-mayu color results from flavonol glucosides, whereas the green pigment in DM cocoons comes from prolinylflavonols produced by a functional deficiency of P5CR1 (Fig. 5; Hirayama et al., 2006, 2018). However, the flavonoid content of SMxB8 and SMxDH27 cocoons, which exhibit a sasa-mayu color, was significantly lower compared with that of DM (Fig. 1B). Furthermore, the flavonoid content of SMxDH27 was significantly higher compared with that of SMxB8 cocoons (p < 0.01). In contrast, the SMxJ01 cocoon did not appear sasa-mayu, despite the predicted genotypes Gb/+^Gb and Ga/+^G27. These results suggest that some genes that regulate the quantity of flavonoid accumulation in the silk glands are located on chromosomes other than chromosome 27. In the future, we expect that the molecular dynamics of flavonoids in insects will be elucidated by clarifying not only Ga, but the other genes involved in green cocoon production.

MATERIALS AND METHODS

Silkworm strains

A Chinese silkworm strain producing a green cocoon, Daizo (Matsumura); DM (ANPJ No.10137), and a Japanese white cocoon race, J01 (breeding stock), were used for this study. Two mutant strains Shouhaku (Maebashi); SM (ANPJ No.10044; +^Gb/+^Gb, Ga/Ga), and B8 Madara-Abura; B8 (ANPJ No.10342; Gb/Gb, +^Ga/+^Ga) were also used. DM, SM, and B8 were obtained from the National Agriculture and Food Research Organization (NARO) Genebank. J01 was obtained from NARO’s breeding section. The CSL of chromosome 27, DH27, was obtained from successive backcrossing of DM to DMxJ01 female moths and sib-mating. The chromosome 27 of J01 was distinguished from DM by size polymorphism of the PCR product during the backcrossing process and by three SNP markers in the F₂ population. The DH27 larvae produce white cocoons because the DM chromosome 27 pair was substituted with J01 chromosome 27. The larvae of these strains were reared on an artificial diet containing mulberry leaf powder (Nihon Nosan Kogyo, Yokohama, Japan) at 25 ℃.

Complementation test to identify G27 with Ga

F₁ larva crossed between SM (+^Gb/+^Gb, Ga/Ga) and B8 (Gb/Gb, +^Ga/+^Ga) produce a faint green cocoon (sasa-mayu) as mentioned previously (Hashimoto, 1941). A DH27 moth was crossed with SM or B8 to identify G27 with Ga (Fig. 2). F₁ was grown and cocooned by the standard protocol at 25 ℃.

Estimation of the flavonol quantity in the cocoon shell

The extraction and measurement of flavonoids were done as described previously (Hirayama and Okada, 2014). Cocoon shells (40 mg) produced by the larvae were collected after pupation and then cut into small pieces. Flavonoids were extracted from the cocoon shells by 70% MeOH-H₂O at 60 ℃ for 2 h. After centrifugation, the supernatant was diluted with distilled water and the absorbance was measured at 365 nm using a UV-VIS photospectrometer (UV-2500PC, Shimadzu, Japan) to obtain a rough estimate of the amount of flavonoids.

Segregating the population for Ga fine mapping

An F₁ (J01xDM) female was backcrossed with a J01 male, and the BC₁ female segregants producing faint green cocoons were again backcrossed with J01 (Fig. 3). Furthermore, the BC₂ male segregants producing faint green cocoons were crossed with J01 female moths, and 1,666 offspring were obtained from 11 egg colonies. A total of 81 offspring were sacrificed for rough linkage mapping of Ga and finally, 1,432 offspring, including the 81, were used for fine mapping to narrow down region of the Ga candidate gene.

Preparation for genomic DNA and genotyping by SNP markers

Genomic DNA from both parental races and F₁ individuals was isolated from the whole moth bodies after mating or egg-laying, as described in a previous report (Nguu et al., 2005). For mapping, genomic DNA from individual segregants was extracted from a part of the frozen pupae using DNAzol (Invitrogen Japan K.K., Tokyo, Japan) based on the manufacturer’s protocol after distinguishing individuals by cocoon color, which was either faint green or white. For the linkage mapping of Ga, chromosome 27 specific primer sets were designed based on the sequence data obtained from NEW KAIKObase ver. 4.3.1, in addition to the SNP markers already available in the database (Table 1). The mapping procedure was performed as described previously with a few modifications (Yamamoto et al., 2006, 2008; Ito et al., 2016; Osanai-Futahashi et al., 2016). PCR amplification was done using Ex Taq (TaKaRa Bio Inc., Otsu, Shiga, Japan) as follows: initial denaturation at 94 ℃ for 2 min, followed by 35 cycles of denaturation at 94 ℃ for 15 s, annealing at 60 ℃ for 15 s, and extension at 72 ℃ for 1 or 3 min, with a final extension step at 72 ℃ for 4 min. The PCR amplicon was cleaned using ExoSAP-IT (ABI, Santa Clara, CA, USA) at 37 ℃ for 30 min and at 80 ℃ for 20 min, followed by sequencing for the detection of SNPs. Genomic DNA from the 1,432 segregants was amplified with primer sets corresponding to the SNPs exhibiting differences between the parental races and polymorphisms in the segregants were determined. Full-length cDNA and the predicted genes in the region were narrowed down by linkage analysis and annotated using the NEW KAIKObase.

ACKNOWLEDGMENTS

This work was supported by the research project for the Practical use of Biotechnology in National Institute of Agrobiological Sciences.

REFERENCES

•  Daimon,  T.,  Hirayama,  C.,  Kanai,  M.,  Ruike,  Y.,  Meng,  Y.,  Kosegawa,  E.,  Nakamura,  M.,  Tsujimoto,  G.,  Katsuma,  S., and  Shimada,  T. (2010) The silkworm Green b locus encodes a quercetin 5-O-glucosyltransferase that produces green cocoons with UV shielding properties. Proc. Natl. Acad. Sci. USA 107, 11471–11476.
•  Day,  A. J.,  Gee,  J. M.,  DuPont,  M. S.,  Johnson,  I. T., and  Williamson,  G. (2003) Absorption of quercetin-3-glucoside and quercetin-40-glucoside in the rat small intestine: the role of lactase phlorizin hydrolase and the sodium-dependent glucose transporter. Biochem. Pharmacol. 65, 1199–1206.
•  Ebitani,  T.,  Takeuchi,  Y.,  Nonoue,  Y.,  Yamamoto,  T.,  Takeuchi,  K., and  Yano,  M. (2005) Construction and evaluation of chromosome segment substitution lines carrying overlapping chromosome segments of indica rice cultivar ‘Kasalath’ in a genetic background of japonica elite cultivar ‘Koshihikari’. Breed. Sci. 55, 65–73.
•  Fujii,  T.,  Kiuchi,  T.,  Daimon,  T.,  Ito,  K.,  Katsuma,  S.,  Shimada,  T.,  Yamamoto,  K., and  Banno,  Y. (2021) Development of interspecific semiconsomic strains between the domesticated silkworm, Bombyx mori and the wild silkworm, B. mandarina. J. Insect Biotechnol. Sericol. 90, 33–40.
•  Fujimoto,  N. (1963) On the physiological functions of the genes concerning the formation and the translocation of the pigments of green cocoon in silkworm larvae. J. Seric. Sci. Jpn. 32, 338–342 (in Japanese).
•  Fujimoto,  N.,  Yoshitake,  N., and  Yamashita,  O. (1962) On the green inhibitor-1 in the silkworm, Bombyx mori. J. Seric. Sci. Jpn. 31, 239–244 (in Japanese).
•  Gee,  J. M.,  DuPont,  M. S.,  Day,  A. J.,  Plumb,  G. W.,  Williamson,  G., and  Johnson,  I. T. (2000) Intestinal transport of quercetin glycosides in rats involves both deglycosylation and interaction with the hexose transport pathway. J. Nutr. 130, 2765–2771.
•  Gregorová,  S.,  Divina,  P.,  Storchova,  R.,  Trachtulec,  Z.,  Fotopulosova,  V.,  Svenson,  K. L.,  Donahue,  L. R.,  Paigen,  B., and  Forejt,  J. (2008) Mouse consomic strains: exploiting genetic divergence between Mus m. musculus and Mus m. domesticus subspecies. Genome Res. 18, 509–515.
•  Hashimoto,  H. (1941) Linkage studies in the silkworm. IV. Inheritance of the green cocoons. Bull. Sericul Exp. Sta. 10, 347–358 (in Japanese).
•  Hirayama,  C.,  Kosegawa,  E.,  Tamura,  Y., and  Nakamura,  M. (2009) Analysis of flavonoids in the cocoon layer of the silkworm regional races by LC-MS. Sanshi-Konchu Biotec 78, 57–63 (in Japanese).
•  Hirayama,  C.,  Mase,  K.,  Iizuka,  T.,  Takasu,  Y.,  Okada,  E., and  Yamamoto,  K. (2018) Deficiency of a pyrroline-5-carboxylate reductase produces the yellowish green cocoon ‘Ryokuken’ of the silkworm, Bombyx mori. Heredity 120, 422–436.
•  Hirayama,  C., and  Okada,  E. (2014) Simple spectrophotometric analysis of flavonoids from the cocoon shell of the silkworm, Bombyx mori. J. Silk Sci. Technol. Jpn. 22, 65–70 (in Japanese).
•  Hirayama,  C.,  Ono,  H.,  Tamura,  Y., and  Nakamura,  M. (2006) C-prolinylquercetins from the yellow cocoon shell of the silkworm Bombyx mori. Phytochemistry 67, 579–583.
•  Ito,  K.,  Katsuma,  S.,  Kuwazaki,  S.,  Jouraku,  A.,  Fujimoto,  T.,  Sahara,  K.,  Yasukochi,  Y.,  Yamamoto,  K.,  Tabunoki,  H.,  Yokoyama,  T.,  Kadono-Okuda,  K., and  Shimada,  T. (2016) Mapping and recombination analysis of two moth colour mutations, Black moth and Wild wing spot, in the silkworm Bombyx mori. Heredity 116, 52–59.
•  Kwon,  O.,  Eck,  P.,  Chen,  S.,  Corpe,  C. P.,  Lee,  J. H.,  Kruhlak,  M., and  Levine,  M. (2007) Inhibition of the intestinal glucose transporter GLUT2 by flavonoids. FASEB J. 21, 366–377.
•  Lu,  Y. R.,  He,  S. Z.,  Tong,  X. L.,  Han,  M. J.,  Li,  C. L.,  Li,  Z. Q., and  Dai,  F. Y. (2016) Microarray analysis of New Green Cocoon associated genes in silkworm, Bombyx mori. Insect Sci. 23, 386–395.
•  Mase,  K.,  Hirayama,  C.,  Okada,  E.,  Iizuka,  T.,  Kadono-Okuda,  K.,  Narukawa,  J., and  Yamamoto,  K. (2011) Reinstatement of the 27th linkage group in the classical linkage map of Bombyx mori by molecular linkage analysis of faint-green cocoon gene. J. Insect Biotechnol. Sericol. 80, 71–77.
•  Nguu,  E. K.,  Kadono-Okuda,  K.,  Mase,  K.,  Kosegawa,  E., and  Hara,  W. (2005) Molecular linkage map for the silkworm, Bombyx mori, based on Restriction Fragment Length Polymorphism of cDNA clones. J. Insect Biotechnol. Sericol. 74, 5–13.
•  O’Leary,  K. A.,  Day,  A. J.,  Needs,  P. W.,  Mellon,  F. A.,  O’Brien,  N. M., and  Williamson,  G. (2003) Metabolism of quercetin-7- and quercetin-3-glucuronides by an in vitro hepatic model: the role of human beta-glucuronidase, sulfotransferase, catechol-O-methyltransferase and multi-resistant protein 2 (MRP2) in flavonoid metabolism. Biochem. Pharmacol. 65, 479–491.
•  Osanai-Futahashi,  M.,  Tatematsu,  K.,  Futahashi,  R.,  Narukawa,  J.,  Takasu,  Y.,  Kayukawa,  T.,  Shinoda,  T.,  Ishige,  T.,  Yajima,  S.,  Tamura,  T.,  Yamamoto,  K., and  Sezutsu,  H. (2016) Positional cloning of a Bombyx pink-eyed white egg locus reveals the major role of cardinal in ommochrome synthesis. Heredity 116, 135–145.
•  Passamonti,  S.,  Terdoslavich,  M.,  Franca,  R.,  Vanzo,  A.,  Tramer,  F.,  Braidot,  E.,  Petrussa,  E., and  Vianello,  A. (2009) Bioavailability of flavonoids: a review of their membrane transport and the function of bilitranslocase in animal and plant organisms. Curr. Drug Metab. 10, 369–394.
•  Sakudoh,  T.,  Iizuka,  T.,  Narukawa,  J.,  Sezutsu,  H.,  Kobayashi,  I.,  Kuwazaki,  S.,  Banno,  Y.,  Kitamura,  A.,  Sugiyama,  H.,  Takada,  N.,  Hirofumi Fujimoto,  H.,  Kadono-Okuda,  K.,  Mita,  K.,  Tamura,  T.,  Yamamoto,  K., and  Tsuchida,  K. (2010) A CD36-related transmembrane protein is coordinated with an intracellular lipid-binding protein in selective carotenoid transport for cocoon coloration. J. Biol. Chem. 285, 7739–7751.
•  Sakudoh,  T.,  Kuwazaki,  S.,  Iizuka,  T.,  Narukawa,  J.,  Yamamoto,  K.,  Uchino,  K.,  Sezutsu,  H.,  Banno,  Y., and  Tsuchida,  K. (2013) CD36 homolog divergence is responsible for the selectivity of carotenoid species migration to the silk gland of the silkworm Bombyx mori. J. Lipid Res. 54, 482–495.
•  Sakudoh,  T.,  Sezutsu,  H.,  Nakashima,  T.,  Kobayashi,  I.,  Fujimoto,  H.,  Uchino,  K.,  Banno,  Y.,  Iwano,  H.,  Maekawa,  H.,  Tamura,  T.,  Kataoka,  H., and  Tsuchida,  K. (2007) Carotenoid silk coloration is controlled by a carotenoid-binding protein, a product of the Yellow blood gene. Proc. Natl. Acad. Sci. USA 104, 8941–8946.
•  Sturtevant,  A. H. (1915) No crossing over in the female of the silkworm moth. Am. Nat. 49, 42–44.
•  Williamson,  G.,  Aeberli,  I.,  Miguet,  L.,  Zhang,  Z.,  Sanchez,  M. B.,  Crespy,  V.,  Barron,  D.,  Needs,  P.,  Kroon,  P. A.,  Glavinas,  H.,  Krajcsi,  P., and  Grigorov,  M. (2007) Interaction of positional isomers of quercetin glucuronides with the transporter ABCC2 (cMOAT, MRP2). Drug Metab. Dispos. 35, 1262–1268.
•  Wolffram,  S.,  Blöck,  M., and  Ader,  P. (2002) Quercetin-3-glucoside is transported by the glucose carrier SGLT1 across the brush border membrane of rat small intestine. J. Nutr. 132, 630–635.
•  Wong,  C. C.,  Akiyama,  Y.,  Abe,  T.,  Lippiat,  J. D.,  Orfila,  C., and  Williamson,  G. (2012) Carrier-mediated transport of quercetin conjugates: involvement of organic anion transporters and organic anion transporting polypeptides. Biochem. Pharmacol. 84, 564–570.
•  Yamamoto,  K.,  Narukawa,  J.,  Kadono-Okuda,  K.,  Nohata,  J.,  Sasanuma,  M.,  Suetsugu,  Y.,  Banno,  Y.,  Fujii,  H.,  Goldsmith,  M. R., and  Mita,  K. (2006) Construction of a single nucleotide polymorphism linkage map for the Silkworm, Bombyx mori, based on bacterial artificial chromosome end sequences. Genetics 173, 151–161.
•  Yamamoto,  K.,  Nohata,  J.,  Kadono-Okuda,  K.,  Narukawa,  J.,  Sasanuma,  M.,  Sasanuma,  S.-i.,  Minami,  H.,  Shimomura,  M.,  Suetsugu,  Y.,  Banno,  Y.,  Osoegawa,  K., Pieter J de Jong, P. J., Marian R Goldsmith, M. R., and Mita, K. (2008) A BAC-based integrated linkage map of the silkworm Bombyx mori. Genome Biol. 9, R21.
•  Yang,  C. C.,  Yokoi,  K.,  Yamamoto,  K., and  Jouraku,  A. (2021) An update of KAIKObase, the silkworm genome database. Database (Oxford) 2021, baaa099.
•  Zhang,  L.,  Zuo,  Z., and  Lin,  G. (2007) Intestinal and hepatic glucuronidation of flavonoids. Mol. Pharm. 4, 833–845.