Breeding Science
Online ISSN : 1347-3735
Print ISSN : 1344-7610
ISSN-L : 1344-7610
Notes
A rapid and reliable PCR-restriction fragment length polymorphism (RFLP) marker for the identification of Amaranthus cruentus species
Young-Jun Park, Tomotaro Nishikawa, Kenichi Matsushima, Mineo Minami, Kazuhiro Nemoto
Author information
JOURNAL FREE ACCESS FULL-TEXT HTML

2014 Volume 64 Issue 4 Pages 422-426

Details
Abstract

A rapid and reliable PCR-restriction fragment length polymorphism (RFLP) marker was developed to identify the Amaranthus cruentus species by comparing sequences of the starch branching enzyme (SBE) locus among the three cultivated grain amaranths. We determined the partial SBE genomic sequence in 72 accessions collected from diverse locations around the world by direct sequence analysis. Then, we aligned the gene sequences and searched for restriction enzyme cleavage sites specific to each species for use in the PCR-RFLP analysis. The result indicated that MseI would recognize the sequence 5′-T/TAA-3′ in intron 11 from A. cruentus SBE. A restriction analysis of the amplified 278-bp portion of the SBE gene using the MseI restriction enzyme resulted in species-specific RFLP patterns among A. cruentus, Amaranthus caudatus and Amaranthus hypochondriacus. Two different bands, 174-bp and 104-bp, were generated in A. cruentus, while A. caudatus and A. hypochondriacus remained undigested (278-bp). Thus, we propose that the PCR-RFLP analysis of the amaranth SBE gene provides a sensitive, rapid, simple and useful technique for identifying the A. cruentus species among the cultivated grain amaranths.

Introduction

The genus Amaranthus contains over 60 species that grow in many areas of the world. Amaranthus are drought-resistant C4 photosynthetic plants that can grow well in saline, alkaline, acidic, or poor soil (Saunders and Becker 1984). This genus, which is used in Central and South America, is an ancient crop that was already under cultivation 5,000 to 7,000 years ago (Sauer 1967). The ancient amaranth grains still used today include three species, Amaranthus caudatus, Amaranthus cruentus and Amaranthus hypochondriacus. Recently, grain amaranths have gained agronomic popularity because of the high protein content of the leaves and seeds and the high level of the essential amino acid, lysine, in the protein. Among the three cultivated species, A. cruentus is widely distributed and typically used, as both a seed and a vegetable, throughout the world. This crop is one of the New World super grains and is gaining favor among health-conscious consumers in many countries, including the USA and Japan (Park and Nishikawa 2012a). In particular, the economic value of A. cruentus as a popular market vegetable rank high, and it is a widespread traditional vegetable ranks in all of tropical Africa (Maundu et al. 2009).

The correct identification of the cultivated amaranth species is essential for crop conservation and quality control. It is also necessary for the efficient use of plant genetic resource collections. Presently, many Amaranthus species are identified based on characteristic morphological features. However, distinguishing species based on morphological traits is a time-consuming operation. In addition, many Amaranthus species exhibit similar morphological characteristics during the vegetative stage (Wetzel et al. 1999). In particular, the three cultivated grain species are very difficult to distinguish because their seeds show similar color variations, including white, tan, gold and pink (Park and Nishikawa 2012b). Recently, many researchers have reviewed the genetic relationships among species in the genus Amaranthus (Chan and Sun 1997, Costea et al. 2006, Das 2012, Mallory et al. 2008, Transue et al. 1994, Xu and Sun 2001). However, their interest was only in the origin and interrelationships of different species belonging to the same family or the genus. In our previous study, molecular techniques based on PCR-restriction fragment length polymorphism (RFLP) were developed to identify two cultivated grain species, A. caudatus and A. hypochondriacus (Park and Nishikawa 2012b). However, molecular techniques that can identify the species A. cruentus have not yet been reported.

The objective of this study was to develop a PCR-RFLP-based technique using the starch branching enzyme (SBE) gene to identify the economically important A. cruentus. The sequence polymorphisms in this single copy gene may be able to help identify A. cruentus among cultivated species because the non-coding regions provide phylogenetically informative characteristics with high levels of variation. Therefore, we evaluated this approach as a simple, reliable and rapid way to distinguish A. cruentus from other cultivated grain amaranths.

Materials and Methods

Plant materials

A total of 72 accessions from three species of grain amaranths were used (Table 1). All accessions were obtained from collections at the United States Department of Agriculture (USDA), USA and Shinshu University, Japan. The samples in these collections originated in the Americas (Argentina, Bolivia, Brazil, Chile, Guatemala, Mexico, Peru, Puerto Rico and the United States), Africa (Ghana, Nigeria, Uganda, Zaire and Zambia) and Asia (Afghanistan, Bhutan, China, India, Nepal, Pakistan and Sri Lanka).

Table 1 Summary of sampled the cultivated grain amaranth accessions and their polymorphism in species-specific sites from the SBE locus
Species No. Accession no. Origin T-C polymorphism in intron 11 of the SBE locus
A. cruentus cr1 Ames 22000 Guatemala T
cr2 Ames 22004 Guatemala T
cr3 Ames 5676 Guatemala T
cr4 PI 511715 Guatemala T
cr5 PI 511718 Guatemala T
cr6 Ames 5165 United States T
cr7 Ames 5318 United States T
cr8 Ames 5677 United States T
cr9 Ames 5480 Mexico T
cr10 Ames 15189 Mexico T
cr11 PI 451710 Mexico T
cr12 PI 490662 Mexico T
cr14 PI 511726 Mexico T
cr15 PI 576481 Mexico T
cr16 PI 604558 Mexico T
cr17 PI 511713 Peru T
cr18 Ames 1977 India T
cr19 Ames 2037 India T
cr20 PI 566897 India T
cr21 PI 576448 Nigeria T
cr22 Ames 1968 Ghana T
cr23 Ames 5369 Zaire T
cr24 PI 494774 Zambia T
A. caudatus ca1 Ames 15176 Argentina C
ca2 Ames 15177 Argentina C
ca3 Ames 15179 Argentina C
ca4 PI 481607 Bhutan C
ca5 PI 490604 Bolivia C
ca7 PI 490607 Bolivia C
ca8 PI 568139 Bolivia C
ca10 PI 568153 Borivia C
ca11 PI 166107 India C
ca12 PI 175039 India C
ca13 Ames 10176 Pakistan C
ca15 PI 490614 Peru C
ca16 PI 490621 Peru C
ca17 PI 490626 Peru C
ca18 PI 490639 Peru C
ca19 PI 511683 Peru C
ca20 PI 511693 Peru C
ca21 PI 511705 Peru C
ca23 IB 85-3291a Nepal C
A. hypochondriacus hy1 Ames 5436 Mexico C
hy2 Ames 5467 Mexico C
hy5 Ames 5132 Mexico C
hy8 PI 477917 Mexico C
hy9 PI 604576 Mexico C
hy10 PI 490755 Mexico C
hy11 PI 604560 Mexico C
hy12 PI 604794 Mexico C
hy13 Ames 5158 Puerto Rico C
hy14 Ames 5689 Brazil C
hy15 Ames 5355 Chile C
hy16 Ames 21766 China C
hy17 PI 542595 China C
hy18 PI 590991 China C
hy19 PI 337611 Uganda C
hy20 Ames 1972 Nigeria C
hy21 Ames 1975 Nigeria C
hy22 PI 558499 United States C
hy23 PI 274279 India C
hy24 85-10-10-3-15a India C
hy25 Almoraa India C
hy26 85-10-27-3-5a India C
hy27 Ac#00406a Sri Lanka C
hy28 PI 540446 Pakistan C
hy29 Ames 5609 Afghanistan C
hy30 BU 95007a Bhutan C
hy31 Ames 5660 Zambia C
hy32 TMN-638a Nepal C
hy33 TMN-647a Nepal C
hy34 SU87-871478a Nepal C
a  The collection in Shinshu University, Japan.

Genomic DNA extraction and PCR amplification

Genomic DNA was extracted from young leaves using the CTAB method (Murray and Thompson 1980) or the DNeasy Plant Mini kit (Qiagen, Hilden, Germany). The quality and concentration of the DNA were evaluated by viewing samples in agarose gels and by a ND-1000 Nanodrop spectrophotometer (Nanodrop Technologies). A fragment of the SBE genomic DNA was amplified by using gene-specific primers, which have been designed previously (Table 2). PCR reactions were conducted in 50 μl volumes containing 2 μl of total DNA, 5 μl of 10× PCR buffer, 4 μl of 2.5 mM dNTP mixture, 10 pmol of each primers and 0.5 μl of EX Taq polymerase. Amplification conditions were as follows: 30 cycles of 98°C for 10 s, 58°C for 30 s and 72°C for 1 min. The PCR products were purified using MultiScreen PCRμ96 plates (Millipore), according to the manufacturer’s instructions. The size of the PCR products was assessed by electrophoresis. The agarose gels were stained with ethidium bromide and visualized under UV light.

Table 2 Primer sequences and annealing temperatures used for amplification of fragments from SBE locus
Fragment Primer pairs Forward and reverse PCR primer sequences (5′→3′) Amplified region Expeceted length Annealing temperature
1 SBEg-F3/SBEg-R3 F: TGCAGCACCGTATGACGGAGTATACT
R: ATACCGGAAACATCTTCTGCGACTACC
partial exon 5–partial exon 6 853 58°C
2 SBEg-F4/SBEg-R4 F: ATGGGGTGACATCCATGCTATATCATCA
R: CCACCCATGGCCATTGTAATTAAATGA
partial exon 6–partial exon 8 924 58°C
3 SBEg-F5/SBEg-R5 F: AGTTGAGAGGGGAATTGCTCTTCATAA
R: TGCACATTTTGTAACTCCAACCATTGCC
partial exon 7–partial exon 9 594 58°C
4 SBEg-F6/SBEg-R6 F: AGGCTACCTTAACTTCATGGGAAATGA
R: TCCAACAAATTCATGGCACCGTTGAATA
partial exon 8–partial exon 10 1,134 58°C
5 SBEg-F7/SBE-R2 F: ATGGAATCTTCCTGATACAGATCACCT
R: TGGAAGTTGAAGACAAACACCAAGTC
partial exon 9–partial exon 11 1,124 58°C
6 SBEg-F8/SBEg-R8 F: ATTGTGAGCAGTGCAAATGAAGTAGACA
R: ACGAATTGGGACGATTGTTGAAATTTGT
partial exon 10–partial exon 13 936 58°C
7 SBEg-F9a/SBE-R3 F: TGATGCATTGATGTTCGGTGGAAAAGGA
R: TCACACCGAGAAAAGGAAACCG
partial exon 12–exon 14 1,181 58°C

Selection of restriction enzymes and PCR-RFLP analysis

Based on the DNA sequence information obtained in this study, we surveyed the restriction sites of the SBE locus extensively using Geneious Pro 7.1.5 (Biomatters Ltd.). The restriction enzymes with digestion sites that were conserved within a species and variable among other species in a given sequence were selected. The intron 11 of the SBE gene was used for the identification of A. cruentus. A fragment from the SBE gene of 278 bp (position 3,536 to 3,240) containing an MseI restriction site was amplified by PCR using the primers crsbe-F: 5′-AGCGAATTGCGACGAATTATGTTACAT-3′ and crsbe-R: 5′-TTCCTTTTCCACCGAACATCAATGCAT-3′. PCR conditions were as follows: 30 cycles of 98°C for 10 s, 55°C for 30 s and 72°C for 30 s. PCR products were digested with the MseI (RspRSII) restriction enzymes (Takara) in a total volume of 20 μl at 60°C for 1 h based on the manufacturer’s instructions, with some modifications. The digested fragments were separated in 2% agarose gels by electrophoresis in TBE buffer for approximately 45 min and visualized by staining with ethidium bromide.

Sequence analyses

The DNA sequences of the amplified products were determined in both directions using the BigDye Terminator Cycle Sequencing Kit (version 3.1, Applied Biosystems) on an ABI 3130xl Genetic Analyzer (Applied Biosystems). The sequencing primer (3.2 pmol) and dye terminator ready-reaction sequencing premix (8 μl) were added to each template. Following a denaturation step at 96°C for 2 min, the dye terminator reaction was performed for 25 cycles of 96°C for 15 s, 50°C for 1 s and 60°C for 4 min. A multiple sequence alignment and analyses of the deduced amino acid and nucleotide sequences were performed using ClustalW 2.1 as a module of Geneious Pro 7.0.5 (Biomatters). Polymorphic site candidates were identified using CodonCode Aligner 4.2.5 (CodonCode Co., Dedham, MA, USA).

Results and Discussion

Previous analyses of the genetic relationships in the genus Amaranthus have used several techniques, including the chromosome number and hybrid fertility (Gupta and Gudu 1991, Pal and Khoshoo 1974), isozymes (Chan and Sun 1997, Hauptli and Jain 1984), random amplified polymorphic DNAs (Chan and Sun 1997, Das 2012, Transue et al. 1994), restriction-site variation of chloroplasts and nuclear DNAs (Lanoue et al. 1996), DNA fingerprints (Sun et al. 1999), amplified fragment-length polymorphisms and inter-sequence simple repeats (Xu and Sun 2001), micromorphology (Costea et al. 2006), microsatellite markers (Mallory et al. 2008) and protein markers (Džunková et al. 2011). However, most of these studies focused on genetic diversity and/or evolutionary relationships among the cultivated species and their wild ancestors. We therefore wanted to provide a rapid molecular technique to distinguish among the cultivated grain species that are typically widely used around the world. Recently, molecular techniques, based on PCR-RFLP marker analysis, were developed for the identification of two cultivated species, A. caudatus and A. hypochondriacus (Park and Nishikawa 2012b). This was the first study using molecular techniques to identify species among the cultivated grain amaranths within the genus Amaranthus. The use of molecular techniques for species identification is very uncommon for this crop and a rapid molecular technique to identify the A. cruentus species is required.

In this study, we first developed a PCR-RFLP marker, which was able to identify the A. cruentus species, by comparing SBE locus sequences among the grain amaranth species. We determined the partial SBE genomic sequence in 72 accessions of the cultivated grain amaranths by direct sequence analysis. The alignments of the 72 SBE sequences produced a matrix of 7,453 bp. Comparisons of the aligned SBE sequences revealed several substitutions and insertions/deletions. On the basis of DNA sequence data, the digestion patterns were predicted for various restriction enzymes using Geneious Pro 7.0.5 software. Finally, the MseI enzyme was selected to achieve the best species-specific pattern for identification of A. cruentus. The sequence data for the SBE locus in all A. cruentus accessions contained 5′-T/TAA-3′ in intron 11, while the other two species, A. caudatus and A. hypochondriacus contained 5′-TCAA-3′ in intron 11 (Fig. 1). This result indicated that the SBE gene is highly conserved and, consequently, a good molecular marker for diagnostic studies. Thus, the comparative analysis of SBE sequences from 72 amaranth accessions provided the basis for the design of diagnostic primers having the potential for the species-specific identification of A. cruentus by the PCR-RFLP method. In this study, we designated this one-base substitution as the “T-C polymorphism” (Table 1).

Fig. 1

Partial sequence alignment of the SBE locus from A. cruentus, A. caudatus and A. hypochondriacus. Solid black box shows the species-specific restriction cleavage site for the enzyme Mse I. Major SNP, T-C polymorphism is underlined. Shaded area is partial exon 12.

Next, we examined the genetic variation in intron 11 of the SBE locus from 72 accessions using the PCR-RFLP method (Fig. 2). The primer set crsbe-F/crsbe-R successfully amplified a control region using DNA extracts from all samples. This PCR product, located from 3,240-bp (intron 11) to 3,536-bp (exon 12), was approximately 278 bp (Fig. 2a). After restriction enzyme digestion, the results indicated that PCR-RFLP was a suitable tool for identifying A. cruentus accessions. As shown in Fig. 2b, digestion of the control region in A. cruentus by MseI produced two fragments, 174 bp and 104 bp, whereas A. caudatus and A. hypochondriacus produced the original PCR fragment of approximately 278 bp. This result indicated that the fragment of A. cruentus species contained an MseI site, while the fragments of the other two amaranths had no MseI sites. Thus, our results clearly showed that this PCR-RFLP method was highly reliable for identifying A. cruentus from among the cultivated grain amaranths. Finally, the PCR-RFLP method developed here will save a significant amount of time and reagents when identifying the A. cruentus species within the cultivated grain amaranths.

Fig. 2

PCR-RFLP method to identify A. cruentus. a. A single 278-bp fragment was amplified from three cultivated grain species of Amaranthus using primers specific for the SBE locus (see Materials and Methods for details). Markers represent a 100-pb DNA ladder. b. Schematic and result of PCR-RFLP for identifying A. cruentus using intron 11 of the SBE locus. Restriction profiles of PCR amplification of intron 11 of SBE followed by digestion with Mse I. Restriction enzyme cleavage site is shown in bold, and one-base substitution, T-C polymorphism is underlined. Markers represent a100-bp DNA ladder.

Literature Cited
 
© 2014 by JAPANESE SOCIETY OF BREEDING
feedback
Top