Near-isogenic lines for resistance to brown planthopper with the genetic background of Indica Group elite rice (Oryza sativa L.) variety ‘IR64’

Abstract

The brown planthopper (BPH), Nilaparvata lugens Stål, is an insect pest that severely damages rice (Oryza sativa L.) in Asia, causing huge yield loss. Use of resistant variety is a cost-effective and eco-friendly strategy for maintaining BPH populations below the economic injury level. However, current BPH populations have been changed to virulence against resistant varieties. In this study, to estimate effective combinations among eight BPH resistance genes (BPH32, BPH17-ptb, BPH20, BPH17, BPH3, BPH25, BPH26 and qBPH6), eight near-isogenic lines with the genetic background of an Indica Group rice variety ‘IR64’ (IR64-NIL) were developed using marker-assisted selection. The genome recoveries of these NILs ranged from 89.3% to 98.8% and agronomic traits of them were similar to those of ‘IR64’. In modified seed box screening test, resistance level of IR64-NILs was higher than that of ‘IR64’. In antibiosis test, high adult mortalities of BPH (from 56.0% to 97.0%) were observed among NILs, in comparison with that of ‘IR64’. Among IR64-NILs, the line carrying BPH17 showed the highest resistance level at all tests. Thus, these IR64-NILs with multiple BPH resistance genes could be valuable breeding lines for enhancing resistance levels by gene pyramiding and multiline variety.

Introduction

Rice (Oryza sativa L.) is a widely cultivated grain crop and is the staple food for over 50% of the world’s population, and more than 90% of the rice available globally is cultivated in Asia, predominantly in China, India, Bangladesh, Indonesia and Vietnam (Khush 2005, Muthayya et al. 2012). However, global rice production is severely impacted due to the direct and indirect damages caused by biotic factors, out of which a major portion of damage is attributable to insect pests (Khush 1979). Among insect pests, the brown planthopper (BPH), Nilaparvata lugens Stål (Homoptera: Delphacidae), is one of the most devastating insect pests that directly damages rice plants by sucking the phloem sap, using its stylet, from the leaf sheath of rice plants (Cheng et al. 2013). A severe level of BPH infestation in a rice field leads to the drying of the crops, and this condition is denoted as ‘hopperburn’ and is indirectly linked to the transmission of viral diseases, including Rice grassy stunt virus (RGSV) and Rice ragged stunt virus (RRSV) diseases (Cabauatan et al. 2009). Based on infestation and production loss, rice production in China is greatly damaged by BPH, and approximately 3.0 million tons of rice were lost due to a BPH outbreak between 2005 and 2008 (Hu et al. 2016). Severe yield losses also occurred due to heavy infestation by BPH in Japan and Korea, Vietnam, Central Thailand and Indonesia in 2005, 2007, 2009 and 2011, respectively (Brar et al. 2009, Catindig et al. 2009).

Chemical insecticides are commonly used to control BPH population in rice fields, which has hazardous effects on both the environment and the consumers. The indiscriminate use of insecticide promotes BPH to develop resistance to it, leading to their resurgence (Tanaka et al. 2000), apart from harming beneficial natural predators, and eventually increasing the production cost of rice. As BPH can quickly develop resistance to most insecticides, the cultivation of BPH-resistant rice varieties is another alternative for the eco-efficient control of BPH (Brar et al. 2009). Therefore, the development of effective resistant varieties using donors for BPH resistance genes is being emphasized.

The development of BPH resistant variety using host plant resistance (HPR) mechanism started during the 1960s and is still ongoing, as it is considered one of the most effective methods to maintain the BPH population below the economic injury level. Host plant resistance to insect pests can be categorized into three groups, namely antibiosis, tolerance and antixenosis (Painter 1951). Identifying these resistance types in the host plant can help elucidate the mechanism responsible for the resistance. To date, more than forty-two BPH resistance genes/quantitative trait loci (QTLs) of rice have been identified/isolated from different varieties and wild species. Among them nine resistance genes: BPH6 (Guo et al. 2018), BPH9 (Zhao et al. 2016), BPH14 (Du et al. 2009), BPH17 (Liu et al. 2015), BPH18 (Ji et al. 2016), BPH26 (Tamura et al. 2014), BPH29 (Wang et al. 2015), BPH30 (Shi et al. 2021) and BPH32 (Ren et al. 2016) have been cloned and evaluated for BPH resistance in rice. Among the three types of BPH resistance mechanisms, the antibiosis mechanism is commonly used for evaluating BPH resistance genes/QTLs. The genes BPH1, BPH2, BPH3, BPH10, BPH17, BPH20, BPH21, BPH25, BPH26, BPH30 and BPH32 confer antibiosis resistance mechanism (Cohen et al. 1997, Jena et al. 2017, Nguyen et al. 2019, Ren et al. 2016, Wang et al. 2018).

Moreover, near-isogenic lines (NILs) have been developed through the incorporation of BPH resistance genes/QTLs in elite varieties that are susceptible to BPH, using marker-assisted selection (MAS). Previously, NILs of rice with resistance genes BPH2, BPH3, BPH17, BPH20, BPH21, BPH32 and BPH17-ptb (Nguyen et al. 2019), BPH25 and BPH26 (Yara et al. 2010), BPH3 and BPH27 (Liu et al. 2016), BPH3, BPH6, BPH9, BPH10, BPH14, BPH15, BPH17, BPH18, BPH20, BPH21, BPH24, QBPH3 and QBPH4 (Xiao et al. 2016), BPH30 (Wang et al. 2018), BPH3, BPH14, BPH15, BPH18, BPH20 and BPH21 (Jiang et al. 2018). have been developed with the backgrounds of Indica and Japonica Groups. These NILs have been characterized against different BPH strains collected from Japan, the Philippines and China. In a previous study, seven NILs (BPH2, BPH3, BPH17, BPH17-ptb, BPH20, BPH21 and BPH32) with a Japonica Group variety ‘Taichung 65’ (T65) genetic background have been developed from three BPH-resistant donor varieties for the evaluation of BPH resistance level (Nguyen et al. 2019). These T65-NILs with a single resistance gene exhibited resistance against BPH populations (Hadano-1966) collected from the Kanagawa Prefecture, Japan, in 1966, but most of them were not effective against the recently migrated BPH populations with strong virulence (Koshi-2013). This is because the virulence of BPH populations have increased over the years, due to their adaptation against BPH-resistant varieties. The NILs and BPH-resistant varieties carrying a single resistance gene such as the BPH1, BPH2, BPH32, BPH20, BPH21, BPH25 and BPH26, showed less resistance against recent BPH populations (Fujii et al. 2021, Myint et al. 2012, Nguyen et al. 2019). Resistant varieties harboring a single gene are no longer effective for recent BPH populations, and varieties with accumulated resistance genes might be effective. To confirm the effects, pyramided lines with multiple resistance genes using NILs for single gene will be needed.

To develop rice lines with effective resistance genes against BPH with strong virulence, pyramiding of resistance genes is essential. In this study, we used an Indica Group variety ‘IR64’ with multiple BPH resistance genes to develop lines carrying multiple resistance genes. The ‘IR64’ variety was released by the International Rice Research Institute (IRRI), Philippines, in 1985, and has been widely cultivated in several tropical countries for high yield, early maturity and resistance to rice blast and pests (Khush and Virk 2005). ‘IR64’ has two major resistance genes, BPH1 on chromosome 12 and BPH37 on chromosome 1 (Yang et al. 2019). The objective of this study was to evaluate the effects of three genes’ accumulations, BPH1, BPH37 and additional genes, using NILs with the genetic background of ‘IR64’. The developed NILs with the genetic background of ‘IR64’ were characterized against highly virulent BPH populations collected from Japan, (Koshi-2013). These NILs with BPH resistance genes can be used to assess the effectiveness of the resistance genes and the virulence of BPH.

Materials and Methods

Plant materials

An elite Indica Group rice variety, ‘IR64’ was used as the recurrent parent to develop NILs with BPH resistance genes, whereas eight T65 NILs (T65-BPH32, T65-BPH17-ptb, T65-BPH20, T65-BPH17, T65-BPH3, T65-BPH25, T65-BPH26 and T65-qBPH6) were used as donor parents in this study (Nguyen et al. 2019, Van Mai et al. 2015, Yara et al. 2010). The donor varieties ‘IR71033-121-15’, ‘PTB33’, ‘Rathu Heenati’, ‘ADR52’ and ‘ASD7’ were used in the previous studies described above to develop NILs with a ‘T65’ genetic background. ‘IR71033-121-15’ rice variety comprises two BPH resistance genes, BPH20 and BPH21, and had been developed from the wild rice species Oryza minuta (Accession no. IRGC101141) (Rahman et al. 2009). ‘PTB33’ originated in India (Accession no. IRGC19325), and contains three resistance genes, BPH2, BPH17-ptb and BPH32 (Jairin et al. 2007a, Nguyen et al. 2021). ‘Rathu Heenati’ (Accession no. IRGC11730), originated and sourced from Sri Lanka, carries the BPH3 and BPH17 (Jairin et al. 2007b, Sun et al. 2005). ‘ADR52’ originated from India (Accession no. IRGC40638) contains the BPH25 and BPH26 (Myint et al. 2012). The ‘ASD7’ variety is native to India and contains the qBPH6 and qBPH12 (Van Mai et al. 2015).

Development of NILs for BPH resistance genes

T65-NILs (T65-BPH32, T65-BPH17-ptb, T65-BPH20, T65-BPH17, T65-BPH3, T65-BPH25, T65-BPH26 and T65-qBPH6) were crossed with ‘IR64’ to develop F₁ plants, and the F₁ plants were further backcrossed at least three times with the ‘IR64’ to develop plants in the BC₃F₁ generation (Fig. 1). At each generation of backcrossing, plants carrying BPH resistance genes from the donor parents (T65-NILs) were selected through MAS, using flanking simple sequence repeat (SSR) markers in the target BPH resistance genes. The selected BC₃F₁ plants were self-pollinated to generate BC₃F₂ plants with BPH resistance genes. Finally, eight BC₃ lines carrying BPH resistance genes were selected as pre-NILs with ‘IR64’ genetic background and were then used to evaluate BPH resistance and agronomic traits. Additionally, eight NILs carrying BPH resistance genes were selected from either the BC₄ or BC₅ progeny, and were further used for a genetic background survey.

Fig. 1.

Breeding scheme for the development of near-isogenic lines (NILs) with BPH resistance genes with an ‘IR64’ genetic background. T65-NILs (T65-BPH32, T65-BPH17-ptb, T65-BPH20, T65-BPH17, T65-BPH3, T65-BPH25, T65-BPH26 and T65-qBPH6) were used as resistant donors (Nguyen et al. 2019, Van Mai et al. 2015, Yara et al. 2010).

DNA extraction and MAS of BPH resistance genes

For MAS, approximately 2.5 cm of leaves were collected using 96 deep-well plates, and maintained for 48 h in a freeze dryer (EYELA FDU-1200, Tokyo Rikakikai Co. Limited, Japan). Dried leaves were crushed using a FastPrep crusher (MP Biomedicals, United States). Finally, total DNA was isolated using the potassium acetate method (Dellaporta et al. 1983). The polymerase chain reaction (PCR) was used to determine the genotypes with SSR markers in plants from each generation. The PCR amplification mixture (8 μL) contained 3 μL of the 2X GoTaq^® Green Master Mix (pH 8.5), 0.25 μM primer and 4 μL of the 20-times diluted DNA. PCR amplification conditions included 1 cycle at 96°C for 5 min, 35 cycles each at 96°C for 30 s, 55°C for 30 s and 72°C for 30 s, followed by a last extension cycle of 25°C for 1 min. The PCR products were separated through electrophoresis (4% agarose gel) and ethidium bromide staining in 0.5X TBE buffer for 1 h, and were further observed under ultraviolet light.

For MAS of the resistance genes on chromosome 4S, the plants with the genes BPH17, BPH17-ptb and BPH20 were selected using SSR markers RM8213, MS10 and RM16535 (Table 1). For MAS of BPH32 and BPH3 on the short arm of chromosome 6, BPH32 was selected using the SSR markers RM508 and RM19341, whereas BPH3 was selected using two flanking SSR markers, RM508 and RM588. The BPH25 and qBPH6 on chromosome 6 were screened using the SSR markers RM508 and RM586. The plants carrying BPH26 were selected using the SSR markers RM1246, RM309, RM28346 and RM28493 on chromosome 12.

Table 1. The SSR markers used for marker-assisted selection (MAS) of plants carrying BPH resistance genes from the resistance donors

Marker name	Chr.	Resistance gene(s)	Forward primer sequence (5ʹ→3ʹ)	Reverse primer sequence (5ʹ→3ʹ)	Physical position (Mbp)*	References
RM508	6	BPH3, BPH32, BPH25, qBPH6	AGAAGCCGGTTCATAGTTCATGC	ACCCGTGAACCACAAAGAACG	0.44	Temnykh et al. (2001)
RM19341	6	BPH32	GCTACAAATAGCCACCCACACC	CAACACAAGCAGAGAAGTGAAGC	1.76	IRGSP (2005)
RM588	6	BPH3	TCTTGCTGTGCTGTTAGTGTACG	GCAGGACATAAATACTAGGCATGG	1.61	Temnykh et al. (2001)
RM8213	4	BPH17, BPH17-ptb, BPH20	TGTTGGGTGGGTAAAGTAGATGC	CCCAGTGATACAAAGATGAGTTGG	4.42	McCouch et al. (2002)
MS10	4	BPH17, BPH17-ptb, BPH20	CAATACGAGAAGCCCCTCAC	CTGAAGGAACACGCGGTAGT	8.08	Rahman et al. (2009), Yang et al. (2004)
RM16535	4	BPH17, BPH17-ptb, BPH20	ACGCGGTAGTCCTCTTCAATGTCG	GGCGCCAACCCTTCCTACTACC	8.03	IRGSP (2005)
RM586	6	BPH25, qBPH6	TGCCATCTCATAAACCCACTAACC	CTGAGATACGCCAACGAGATACC	1.47	Temnykh et al. (2001)
RM1246	12	BPH26	GGCTCACCTCGTTCTCGATCC	CATAAATAAATAGGGCGCCACACC	19.16	McCouch et al. (2002)
RM28346	12	BPH26	GCCCAAAGTTAATATCGGTGTCTCC	AGCCTGCCTAGCACTCATAGACC	20.99	McCouch et al. (2002)
RM309	12	BPH26	CACGCACCTTTCTGGCTTTCAGC	AGCAACCTCCGACGGGAGAAGG	21.52	McCouch et al. (2002)
RM28493	12	BPH26	ACCGTTAGATGACACAAGCAACG	GGTTAGCAAGACTGGAGGAGACG	23.28	IRGSP (2005)

* The physical position of marker was the physical location of forward primer for each marker obtained from The Rice Annotation Project Database.

Genetic background survey of the NILs developed

For the genetic background survey of the NILs developed, the bulk DNA from three plants of each NIL was used. 384 SSR markers were used in the polymorphic test between ‘IR64’ and the donor parents (McCouch et al. 2002). Among the 384 SSR markers, 236 SSR markers distributed on 12 rice chromosomes showed polymorphism between ‘IR64’ and ‘T65’ and were further applied to detect substituted chromosomal segments from donor parents in the NILs developed. Genome recoveries of T65-NILs ranged from 85.2% to 97.0%, indicating that most of the genetic backgrounds of T65-NILs were replaced by T65 (Nguyen et al. 2019). Therefore, we used SSR markers with polymorphism between ‘IR64’ and ‘T65’ to detect substituted chromosomal segments. Additionally, we confirmed whether SSR markers around substituted chromosomal segments on IR64-NILs showed polymorphism between ‘IR64’ and T65-NILs. The whole genome of the NILs developed was graphically displayed following the concept of the graphical genotype proposed by Young and Tanksley (1989) using the GGT software, version 2.0.

BPH strains

The BPH population, Koshi-2013, was collected from Koshi city, Kumamoto Prefecture, Japan, in 2013, and was maintained on the susceptible rice variety, ‘Reiho’, at 25°C and 16 h/8 h light/dark cycles at National Agriculture and Food Research Organization (NARO). The BPH population (Koshi-2013) was acquired from NARO and was maintained on the ‘Nipponbare’ rice variety at the Saga University, to evaluate the resistance level of the NILs developed. In a recent study conducted by Fujii et al. (2021), Koshi-2013 survived in the BPH resistant varieties, ‘Mudgo’ with BPH1 and ‘ASD7’ with BPH2, while Koshi-2013 died in the BPH resistant varieties, ‘Rathu Heenati’ and ‘Balamawee’ with multiple BPH resistance genes.

Characterization of the pre-NILs developed

Modified seed box screening test (MSST)

To characterize the resistance level of pre-NILs, the modified seed box screening test (MSST) (Horgan et al. 2015) was performed at 25°C using the Koshi-2013 BPH population. To conduct this test, 30 seeds of each pre-NIL and parent line were sown in single rows in plastic trays (23.0 × 30.0 × 2.5 cm), with a 2.5 cm distance between rows of seedlings. One row of ‘Rathu Heenati’ was added as the resistant control, while three rows of ‘T65’ were sown at the center and the two edges, as the susceptible control. Seven days after sowing, the plants in the trays were thinned to 20 plants per row. One tray was infested by the second and third instar nymphs at a density of around 20 BPHs per plant. When all the plants of ‘T65’ had dried, due to BPH feeding, the damage scores (DS) of all lines/varieties were classified, following the standard evaluation system (SES) developed by the IRRI (IRRI 2014).

Antibiosis test

Antibiosis tests were performed following the protocol developed by Myint et al. (2009). Five plants of each pre-NIL and parent line (‘IR71033-121-15’, ‘PTB33’ and ‘Rathu Heenati’, ‘IR64’ and ‘T65’) were independently grown in 215 ml plastic cups. The seedlings were trimmed to a height of 15 cm on 30 days after seeding and covered with a plastic cage with insect screen windows for adequate ventilation. Each plant was infested with five thin abdomen brachypterous female BPHs. At five days after infestation (DAI), the adult mortality (ADM) which is the total number of dead brachypterous adult females, and the number of brachypterous adult females with a swollen abdomen (SA), were counted. Female BPHs were categorized into small, medium and large based on abdomen size.

Honeydew test

Measurements of the areas with honeydew deposition were conducted following the method mentioned by Heinrichs et al. (1985). The seedlings of pre-NILs and parent lines at 30 days after seeding were used for the honeydew test. Before starting the test, the plants were trimmed into one tiller. Bromocresol green treated filter papers were placed in inverted transparent plastic cups to absorb the honeydew excreted by BPH. Before infestation, BPHs were starved for 2 h in a plastic box maintaining sufficient moisture. After starving, each plant was infested with two newly emerged BPH female adults. The yellow-orange filter papers turned blue color when honeydew was absorbed, Filter papers were collected after 24 h of BPH infestation and areas with honeydew deposition were calculated using the ImageJ software.

Characterization of agronomic traits in pre-NILs

The pre-NILs with ‘IR64’ genetic background were grown in a paddy field at Saga University (Saga, Japan), in 2021, and were characterized for their agronomic traits, compared to those of ‘IR64’. At 30 days after seeding, the seedlings were transplanted as one plant per hill, while maintaining 20 cm between hills and 25 cm between rows. Each entry was transplanted as at least three rows (8 plants per row). Six agronomic traits, days to heading (DTH), culm length (CL), panicle length (PL), leaf length (LL), leaf width (LW) and panicle number (PN), were recorded for six plants in the same row. DTH accounts for the number of days from sowing until 50% of the panicles flowered. CL was measured as the distance from the soil surface to the panicle neck. PL was the distance from the tip to the panicle neck of the longest panicle. The flag LW and LL were measured from the largest and longest flag leaf of each sampled plant. PN represented the number of reproductive panicles of each plant at maturity (Nguyen et al. 2019).

Statistical analysis

The mean values of DS, ADM, SA and honeydew excreted area for the pre-NILs and their agronomic traits were compared using the one-way ANOVA. Tukey–Kramer’s and Dunnett’s test were conducted for multiple comparisons of BPH resistance and agronomic traits, respectively, using the R software, version 4.1.1.

Results

Development of NILs with an ‘IR64’ genetic background

BPH resistance genes were introgressed from the donor parents (T65-NILs) into the elite Indica Group variety ‘IR64’ through backcrossing and MAS (Fig. 1, Table 1). In this experiment, we used the T65-NILs that were previously developed, as the donor parents: T65-BPH32, T65-BPH17-ptb, T65-BPH20, T65-BPH17, T65-BPH3, T65-BPH25, T65-BPH26 and T65-qBPH6 (Nguyen et al. 2019, Van Mai et al. 2015, Yara et al. 2010). Foreground selection was performed by flanking the SSR markers for BPH resistance genes in each backcross generation. Finally, after at least three rounds of backcrossing with the ‘IR64’, eight NILs, IR64-BPH32, IR64-BPH17-ptb, IR64-BPH20, IR64-BPH17, IR64-BPH3, IR64-BPH25, IR64-BPH26 and IR64-qBPH6, were developed (Table 2).

Table 2. Development of NILs for BPH resistance genes with ‘IR64’ genetic background

NIL	Gene	Chromosome	Donor	Generation of pre-NILs	Generation of NILs	Total percent of ‘T65-NILs’ (%)
IR64-BPH32	BPH32	6	PTB33	BC3F3	BC4F3	7.9
IR64-BPH17-ptb	BPH17-ptb	4	PTB33	BC3F3	BC5F3	3.8
IR64-BPH20	BPH20	4	IR71033-121-15	BC3F3	BC5F3	3.9
IR64-BPH17	BPH17	4	Rathu Heenati	BC3F3	BC5F3	2.8
IR64-BPH3	BPH3	6	Rathu Heenati	BC3F3	BC5F3	1.2
IR64-BPH25	BPH25	6	ADR52	BC3F3	BC4F3	7.1
IR64-BPH26	BPH26	12	ADR52	BC3F3	BC4F3	10.7
IR64-qBPH6	qBPH6	6	ASD7	BC3F3	BC4F3	5.0

Genetic background survey of IR64-NILs

The genetic background of IR64-NILs (BC₄F₃ or BC₅F₃) was verified using 236 polymorphic SSR markers to estimate the substituted chromosomal segments on the IR64-NILs developed (Fig. 2A–2H, Supplemental Table 1). After estimating substituted chromosomal segments on IR64-NILs, SSR markers around substituted chromosomal segments also showed polymorphism between ‘IR64’ and T65-NILs. The total percentage of substituted segments of T65-BPH32 in IR64-BPH32 was about 7.9% (29.4 Mbp) (Fig. 2A). The IR64-BPH32 had three chromosomal segments of donor containing BPH32 on chromosomes 3, 5 and 6. The total percentage of substituted segments from the donor in the IR64-BPH17-ptb was about 3.8% (14.2 Mbp) (Fig. 2B). The IR64-BPH17-ptb had a chromosomal segment of donor containing the BPH17-ptb on chromosome 4. The total percentage of substituted donor segments in the IR64-BPH17 was about 2.8% (10.3 Mbp) (Fig. 2C). The IR64-BPH17 had a chromosomal segment of donor containing BPH17 on chromosome 4. The total percentage of substituted donor segments in the IR64-BPH20 was about 3.9% (14.4 Mbp) (Fig. 2D). The IR64-BPH20 had a chromosomal segment of donor containing BPH20 on chromosome 4. The total percentage of substituted donor segments in the IR64-BPH3 was about 1.2% (4.6 Mbp) (Fig. 2E). The IR64-BPH3 had a chromosomal segment of donor containing BPH3 on chromosome 6. The total percentage of substituted donor segments in the IR64-BPH25 was about 7.1% (26.5 Mbp) (Fig. 2F). The IR64-BPH25 had three chromosomal segments of donor containing BPH25 on chromosomes 6, 9 and 11. The total percentage of substituted donor segments in the IR64-BPH26 was about 10.7% (40.1 Mbp) (Fig. 2G). The IR64-BPH26 had five chromosomal segments of donor containing BPH26 on chromosomes 3, 5, 6, 7 and 12. The total percentage of substituted donor segments in the IR64-qBPH6 was about 5.0% (18.6 Mbp) (Fig. 2H). The IR64-qBPH6 had three chromosomal segments of donor containing qBPH6 on chromosomes 4, 6 and 7.

Fig. 2.

Graphical genotype of (A) IR64-BPH32, (B) IR64-BPH17-ptb, (C) IR64-BPH17, (D) IR64-BPH20, (E) IR64-BPH3, (F) IR64-BPH25, (G) IR64-BPH26 and (H) IR64-qBPH6. The 12 bars indicate 12 chromosomes of rice. Horizontal lines across the chromosome represent the positions of polymorphic markers. Circles indicate the approximate position of the BPH resistance genes.

Assessment of resistance levels in pre-NILs against Koshi-2013 using MSST

We assessed the resistance levels of pre-NILs against the Koshi-2013 population, using MSST (Fig. 3A). The DS of the donor parents (‘Rathu Heenati’, ‘PTB33’ and ‘IR71033-121-15’) ranged from 3.0 to 7.0, while the DS of ‘IR64’ was 7.9. The DS of donor varieties, ‘Rathu Heenati’ and ‘PTB33’ significantly showed lower values than that of ‘IR64’. The donor parent ‘Rathu Heenati’ exhibited the lowest DS (3.0), which was significantly lower than that of other donor parents and IR64-NILs as well. The DS of five IR64-NILs ranged from 4.3 to 7.3. Among the IR64-NILs, the lowest DS was observed in IR64-BPH17 (4.3). The DS of the other pre-NILs were 7.3, 6.5, 6.9 and 6.8, for IR64-BPH32, IR64-BPH17-ptb, IR64-BPH20 and IR64-BPH3, respectively. The DS of the IR64-BPH32, IR64-BPH20 and IR64-BPH3 were not significantly different among the IR64-NILs, but the DS of most of the IR64-NILs were lower than that of ‘IR64’ except for IR64-BPH32. Additionally, three IR64-NILs (IR64-BPH25, IR64-BPH26 and IR64-qBPH6) were evaluated using MSST (Fig. 3B). Among the IR64-NILs, the lowest DS was observed in IR64-BPH26 (5.8), while the DS of other pre-NILs were 7.1 for IR64-BPH25 and 7.3 for IR64-qBPH6. The DS of IR64-BPH25, IR64-BPH26 and IR64-qBPH6 were lower from that of ‘IR64’. However, the DS of IR64-BPH25 and IR64-qBPH6 were not significantly different than that of ‘IR64’. Overall, all the IR64-NILs showed lower DS than that of ‘IR64’ but only on three NILs, IR64-BPH17, IR64-BPH17-ptb and IR64-BPH26 showed significant differences compared to ‘IR64’.

Fig. 3.

Damage scores for BPH resistance genes of the eight pre-NILs against Koshi-2013, according to the MSST. (A) DS of five pre-NILs (IR64-BPH32, IR64-BPH17-ptb, IR64-BPH20, IR64-BPH17 and IR64-BPH3) for BPH resistance genes against Koshi-2013 in MSST. (B) DS of three pre-NILs (IR64-BPH25, IR64-BPH26 and IR64-qBPH6) for BPH resistance genes against Koshi-2013 in MSST. The different letters above the bar are significantly different at the p < 0.05 level as per the Tukey–Kramer’s test.

ADM and SA ratio in the Koshi-2013 BPH population on the pre-NILs

The resistance levels in the five pre-NILs were evaluated based on the ADM of the Koshi-2013 BPH population at 5 DAI, under controlled conditions (Fig. 4A). The lowest ADM, at 8.0%, was observed for the infestation of ‘T65’, while for ‘Rathu Heenati’, it was 100.0%. ‘IR64’ showed higher ADM and lower ratio of SA in compared with ‘T65’ because ‘IR64’ harbors genetic factors for resistance to BPH. The ADM for ‘Rathu Heenati’ showed statistically significant difference from that for ‘IR64’. The ADM for ‘PTB33’, ‘IR71033-121-15’ and ‘IR64’ did not vary significantly. The range of ADM for the five pre-NILs was 59.0% to 97.0%. The ADM for IR64-BPH17 and IR64-BPH3 were similar to that for ‘Rathu Heenati’. The ADM for other pre-NILs, namely IR64-BPH32, IR64-BPH17-ptb and IR64-BPH20, were 63.0%, 59.0% and 77.0%, respectively, while the ADM for ‘IR64’ was 52.0%. The ADM for all pre-NILs were higher than that for the recurrent parent ‘IR64’ but significant differences were not noticed for IR64-BPH32 and IR64-BPH17-ptb. Additionally, the resistance levels of the five pre-NILs were evaluated based on the percentage of SAs in the BPH strain, at 5 DAI (Fig. 4B). The highest percentage of SA in BPH was observed for ‘T65’ (92.0%), while it was nil for ‘Rathu Heenati’ (0.0%) because all five insects infesting it had died. The percentage of SA in the pre-NILs that were developed, ranged from 0.0% to 10.0%. The SA for all the pre-NILs failed to differ significantly from that for the ‘IR64’. However, the percentage of SA in BPHs infesting pre-NILs was lower than those infesting ‘IR64’ (16.0%). Moreover, the smaller abdomen indicates that BPH did not suck sap adequately, from the IR64-BPH3, IR64-BPH20 and IR64-BPH17.

Fig. 4.

Antibiosis level of eight pre-NILs against Koshi-2013. (A) Adult mortality (%) of Koshi-2013 as per antibiosis test 5 d after infestation on five pre-NILs (IR64-BPH32, IR64-BPH17-ptb, IR64-BPH20, IR64-BPH17 and IR64-BPH3). (B) Swollen abdomen of Koshi-2013 as per antibiosis test 5 d after infestation on five pre-NILs (IR64-BPH32, IR64-BPH17-ptb, IR64-BPH20, IR64-BPH17 and IR64-BPH3). (C) Adult mortality (%) of Koshi-2013 as per antibiosis test 5 d after infestation on three pre-NILs (IR64-BPH25, IR64-BPH26 and IR64-qBPH6). (D) Swollen abdomen of Koshi-2013 as per antibiosis test 5 d after infestation on three pre-NILs (IR64-BPH25, IR64-BPH26 and IR64-qBPH6). The different letters above the bar are significantly different at the p < 0.05 level according to the Tukey–Kramer’s test.

The resistance levels of IR64-BPH25, IR64-BPH26 and IR64-qBPH6 against BPH populations (Koshi-2013) were also assessed using antibiosis mechanism. The ADM for IR64-BPH26 was 88.0% and was not statistically different from that for ‘Rathu Heenati’ (Fig. 4C). The ADM for other pre-NILs include: 56.0% for IR64-BPH25, and IR64-qBPH6, and 48.0% for ‘IR64’. The ADM for IR64-BPH25, IR64-BPH26 and IR64-qBPH6, were higher than that for ‘IR64’, but there was no significant difference between IR64-BPH25 and IR64-qBPH6. The percentage of SA for three pre-NILs did not differ significantly from that for ‘IR64’ (20.0%) (Fig. 4D). ‘IR64’ showed higher ADM and lower ratio of swollen abdomen than ‘T65’ because ‘IR64’ harbors the genetic factor(s) of resistant to BPH, BPH1 and BPH37. Among eight NILs, ADM of IR64-BPH20, IR64-BPH17, IR64-BPH3 and IR64-BPH26 showed higher than ‘IR64’. In contrast, the other four NILs were similar with that of ‘IR64’. Results indicated that the effect of resistance genes in the other four NILs were masked by the genetic background of ‘IR64’.

Honeydew excretion by BPH feeding on pre-NILs

The reaction of the five pre-NILs were evaluated through the feeding rate of the BPH strain, based on the honeydew excretion area (Fig. 5A). We assessed the honeydew excreted area for BPH feeding in the pre-NILs. The highest honeydew excretion area (103.8 mm²) was observed on ‘T65’. The lowest excretion area (3.1 mm²) was found in ‘Rathu Heenati’. The honeydew excretion area on ‘IR64’, developed by BPH feeding, was 29.0 mm². The honeydew excretion area on the five pre-NILs ranged from 3.4 mm² to 51.1 mm². Among the pre-NILs, IR64-BPH17 had the lowest honeydew excretion area (3.4 mm²), followed by IR64-BPH3 (18.9 mm²). While the honeydew excretion area of other NILs were 51.1 mm² for IR64-BPH17-ptb, 26.3 mm² for IR64-BPH20 and 32.0 mm² for IR64-BPH32 respectively. The honeydew excretion area for IR64-BPH17 and IR64-BPH3 were lower than that of ‘IR64’, but honeydew excretion area on all of IR64-NILs were not significantly different from that of ‘IR64’. From the feeding rate results, the IR64-BPH17 is the line with the highest sucking inhibition, compared to the other pre-NILs developed.

Fig. 5.

Area (mm²) of honeydew excreted by BPH (Koshi-2013), 24 h after infestation, according to antibiosis test. (A) Honeydew excretion area on pre-NILs (IR64-BPH32, IR64-BPH17-ptb, IR64-BPH20, IR64-BPH17 and IR64-BPH3). (B) Honeydew excretion area on pre-NILs (IR64-BPH25, IR64-BPH26 and IR64-qBH6). The different letters above the bar are significantly different at the p < 0.05 level according to the Tukey–Kramer’s test.

Additionally, three pre-NILs (IR64-BPH25, IR64-BPH26 and IR64-qBPH6) were also evaluated for honeydew excretion (Fig. 5B). Among the three pre-NILs, the lowest honeydew excretion area by BPH was observed on IR64-BPH26 (23.6 mm²). The honeydew excretion area on IR64-BPH25 and IR64-qBPH6 were 31.4 mm² and 59.2 mm², respectively. The honeydew excretion area on all three pre-NILs (IR64-BPH25, IR64-BPH26 and IR64-qBPH6) were lower than that of ‘IR64’, but the difference was not statistically significant.

Characterization of agronomic traits in pre-NILs

To confirm the similarity between ‘IR64’ and the pre-NILs, six agronomic traits: DTH, CL, PL, LL, LW and PN were characterized (Table 3). The CLs and LLs of the IR64-NILs did not vary significantly from those of the ‘IR64’. In contrast, the DTH for the IR64-NILs were significantly different from that for the ‘IR64’ except for IR64-BPH32. These DTHs of four NILs were shorter than that of ‘IR64’. The PL, LW and PN of the IR64-NILs were similar to those of the ‘IR64’, with the exception of IR64-BPH32 for PL, IR64-BPH20 and IR64-BPH3 for LW, and IR64-BPH17-ptb and IR64-BPH17 for PN. Overall, the agronomic traits of the IR64-NILs were similar to those of the ‘IR64’.

Table 3. Agronomic traits of pre-NILs carrying BPH resistance genes

Entry	Agronomic traits (Mean value ± SD)
	DTH	CL (cm)	PL (cm)	LL (cm)	LW (cm)	PN
IR64-BPH32	102.5 ± 1.2	86.7 ± 3.7	23.2 ± 1.4**	28.5 ± 2.9	1.5 ± 0.1	16.6 ± 2.1
IR64-BPH17-ptb	99.6 ± 1.1***	86.5 ± 2.6	24.8 ± 1.4	30.7 ± 3.4	1.5 ± 0.1	14.3 ± 3.1*
IR64-BPH20	99.0 ± 1.3***	87.8 ± 2.6	24.0 ± 1.2	28.5 ± 2.7	1.4 ± 0.1*	16.1 ± 2.3
IR64-BPH17	99.3 ± 0.8***	87.1 ± 3.5	24.6 ± 0.9	30.8 ± 4.1	1.4 ± 0.1	14.3 ± 1.4*
IR64-BPH3	100.5 ± 1.0***	87.1 ± 2.6	23.6 ± 1.1	31.7 ± 2.7	1.3 ± 0.1**	16.6 ± 2.1
IR64	102.3 ± 0.5	87.4 ± 1.2	24.5 ± 0.6	30.7 ± 3.1	1.5 ± 0.1	16.4 ± 1.4

DTH: days to heading, CL: culm length, PL: panicle length, LL: flag leaf length, LW: flag leaf width, PN: panicle number; * p < 0.05, ** p < 0.01, *** p < 0.001 (Dunnett’s multiple comparison tests against ‘IR64’).

Discussion

BPH is the most serious insect pest for rice, resulting in huge yield loss every year (Brar et al. 2009). Cultivation of BPH resistant varieties is one of the eco-friendly ways to manage BPH, starting with the development of BPH resistant NILs with elite varieties as the genetic background. However, these rice varieties which were initially resistant to BPH, became susceptible a few years after their development. For examples, in 1970s, the rice variety ‘IR26’ with the BPH1 resistance gene, and ‘IR36’ with the BPH2 resistance gene were released as BPH resistant varieties, but they became susceptible to BPH within a few years, because of strong virulence and rapid adaptation in BPH (Cohen et al. 1997). In a recent study, it was also observed that the virulence of BPH in the varieties ‘IR26’ (BPH1), ‘Mudgo’ (BPH1) and ‘ASD7’ (BPH2) was higher than that in other varieties, like ‘Rathu Heenati’ (BPH3, BPH17) and ‘Balamawee’ (BPH27, three QTLs), that contain more than one gene for BPH resistance (Fujii et al. 2021). Therefore, to mitigate the virulence of recent migratory BPH strains, we developed eight NILs carrying BPH resistance genes on the short arm of the chromosomes 4 (BPH17, BPH17-ptb and BPH20) and 6 (BPH3, BPH32, BPH25 and qBPH6) and on the long arm of the chromosome 12 (BPH26), with an ‘IR64’ genetic background containing two resistance genes, the BPH1 on chromosome 12 and BPH37 on chromosome 1 (Yang et al. 2019). When we incorporated one resistance gene to the ‘IR64’ using MAS, the NILs contained at least three BPH resistance genes (BPH1 + BPH37 + a resistance gene), except for IR64-BPH26.

In a previous study, a BPH population collected from Japan, in 2005, showed higher virulence compared to other BPH populations: Hadano-1966, Chikugo-89 and Isahaya-99 (Myint et al. 2009) and the virulence of BPH population become stronger year by year. Additionally, the current BPH population (Koshi-2013) had stronger virulence than Hadano-1966 and NILs containing a single BPH resistance gene with a ‘T65’ genetic background were less effective against Koshi-2013 (Nguyen et al. 2019). Therefore, T65-NILs were not effective against the current virulence of BPH populations. In this study, we used Koshi-2013 BPH for the characterization of the NILs developed, and at least four IR64-NILs exhibited effective resistance against BPH through antibiosis, and upon further analysis using the MSST at the seedling stage. Therefore, IR64-NILs can be used to mitigate the strong virulence of the recently migrated BPH populations, and other BPH populations in South and Southeast Asian countries. However, due to limited space for rearing and increasing BPH population, only Koshi-2013 was used in this study to evaluate the resistance levels of IR64-NILs. To understand the effect of BPH resistance in IR64-NILs, it will be necessary to evaluate the resistance levels of IR64-NILs using different BPH populations in future studies.

BPH resistance genes in rice are usually present in clusters on the chromosomes 4, 6 and 12 (Fujita et al. 2013). Among the BPH resistance genes, the 12 genes identified on chromosome 4S were present as a cluster. The BPH17 gene was identified by Sun et al. (2005), but was later cloned and characterized by Liu et al. (2015) as BPH3. In this study, we used BPH17 designation for the development of NILs with an ‘IR64’ genetic background. Although BPH17 from ‘Rathu Heenati’ and BPH17-ptb from ‘PTB33’ have the same amino acid sequence and location on chromosome 4, based on the antibiosis and MSST, the resistance level of IR64-BPH17 varied significantly from the resistance level of IR64-BPH17-ptb, against the Koshi-2013 BPH population used in this study. This result was similar to that of a previous study conducted by Nguyen et al. (2019), using the Hadano-1966 BPH strain, collected from Japan, on T65-NILs. In a previous study, BPH17-NIL with a ‘T65’ genetic background showed higher resistance levels than that of BPH20-NIL, as per the MSST and antibiosis test (Nguyen et al. 2019). In this study, IR64-BPH17 with an ‘IR64’ background showed higher resistance levels in the MSST and antibiosis test, compared to IR64-BPH20, and the resistance level of IR64-BPH17 was almost similar to that of ‘Rathu Heenati’. This result was similar to the results of a previous study that compared the resistance levels of BPH17 and BPH20. BPH17 is a cluster of three genes (OsLecRK1-OsLecRK3) and these three genes function might be related to confer broad-spectrum and durable resistance against BPH (Liu et al. 2015). Therefore, the remaining chromosomal segments on chromosome 4 might influence the resistance level of these pre-NILs (IR64-BPH17, IR64-BPH17-ptb and IR64-BPH20). Furthermore, fine mapping and comparison of genome sequences of BPH17, BPH17-ptb and BPH20 might elucidate the genetic basis of the different resistance levels.

Six BPH resistance loci have been identified on the short arm of chromosome 6 (0.2–1.7 Mbp), from different sources (Fujita et al. 2013). This cluster is known as the cluster C on chromosome 6S. Among the detected genes/QTLs, BPH3 and BPH32 are commonly used for the development of NILs with elite genetic backgrounds (‘T65’, ‘IR24’ and ‘9311’). Previously, BPH32 was identified around the 1.2 Mbp region on chromosome 6S (Ren et al. 2016). The resistance levels of BPH32-NILs with ‘T65’, ‘IR24’ and ‘9311’ genetic backgrounds were lower than that of BPH3-NILs according to MSST (Jena et al. 2017, Nguyen et al. 2019, Xiao et al. 2016). In this study, the resistance level of IR64-BPH3 was higher than that of IR64-BPH32, according to both antibiosis and MSST. Thus, our results are in accordance with that of a previous study that characterized the resistance of pre-NILs against BPH strains. The difference in the resistance levels between IR64-BPH3 and IR64-BPH32 might be related to the donor parents, because the BPH3 (Jairin et al. 2007b) and BPH32 (Ren et al. 2016) genes were identified in ‘Rathu Heenati’ and ‘PTB33’, respectively. For confirmation of the difference in effect between these two resistance genes, the comparison of the amino acid sequence of BPH3 resistance gene for BPH32 region is necessary in future study.

It was reported that the BPH25-NIL and BPH26-NIL with the ‘T65’ genetic background were not effective against the Philippine BPH populations (Srinivasan et al. 2015). Myint et al. (2012) also evaluated two pre-NILs (BPH25-NIL and BPH26-NIL) developed from the susceptible variety ‘T65’, containing a single resistance gene, and both NILs were found to be susceptible to the virulent BPH strain, Japan-KG-06. However, in this study, IR64-BPH25 and IR64-BPH26 exhibited resistance against the strong BPH population, Koshi-2013, based on the antibiosis and MSST. The location of BPH26 was the same as that of BPH1 (Myint et al. 2012), and therefore, IR64-BPH26 contains both BPH26 and BPH37. The resistance level of IR64-BPH26 was significantly higher than that of ‘IR64’, suggesting that the resistance levels of BPH26 is greater than that of BPH1. Moreover, the BPH resistance exhibited by BPH26 was effective against highly virulent BPH, even if the current BPH population could overcome a rice line with only the BPH26 gene. Therefore, it is possible to use the BPH25 and BPH26 resistance genes in rice breeding for pyramiding of BPH resistance genes.

Genetic background survey of the NILs were performed using SSR markers. In this study, we assessed the genome recovery of the recurrent parent through SSR markers distributed on 12 rice chromosomes. The genome recovery of IR64-NILs ranged from 89.3–98.8% (Fig. 2A–2H, Supplemental Table 1). These results for genome recovery conformed to the theoretical value. However, two IR64-NILs (IR64-BPH26 and IR64-BPH32) exhibited a low recovery of the recurrent parent (‘IR64’) genome (89.3% and 92.1%). Due to lesser backcrossing (only three rounds), IR64-BPH26 and IR64-BPH32 recovered lesser portions of the recurrent parent genome. Thus, it is necessary to increase the number of backcrosses for getting a higher percentage recovered parent genome from ‘IR64’ for these two NILs. Additionally, we compared the agronomic characteristics of the pre-NILs with the recurrent parent ‘IR64’ (Table 3). Agronomic characteristics of the pre-NILs developed are closely related to the genetic background of the recurrent parent. In this study, some of the agronomic traits in IR64-BPH20, IR64-BPH17-ptb and IR64-BPH17 were different from that in ‘IR64’, while IR64-BPH3 and IR64-BPH32 have agronomic traits similar to ‘IR64’. IR64-BPH20, IR64-BPH17-ptb and IR64-BPH17 have unfavorable agronomic traits in the form of linkage drag around BPH resistance gene regions, because the remaining chromosomal segments from the donor parents on BC₃F₃ were retained. The alleles of the donor NILs (T65-NILs) might be influenced to create differences in the agronomic traits of the IR64-NILs. Moreover, the linkage drag problem in breeding can be minimized through the development of tightly linked DNA markers and more backcrossing.

We incorporated BPH resistance genes from T65-NILs into the elite variety ‘IR64’, using marker-assisted backcross breeding to develop NILs. Among the pre-NILs developed in this study, three pre-NILs (IR64-BPH17, IR64-BPH3 and IR64-BPH26) had significantly enhanced BPH resistance levels, and the resistance levels of IR64-BPH17 and IR64-BPH3 were close to that of ‘Rathu Heenati’. In particular, IR64-BPH17 showed high resistance levels in all of tests, indicating BPH17 is the most effective resistance gene against the current BPH population migrating to Japan. The IR64-NILs are unique because each NIL has at least three BPH resistance genes. Therefore, the NILs developed in this study are not only useful in rice breeding programs for increasing the resistance level of Indica Group varieties against BPH but also used as breeding lines such as multiline varieties. Because multiline varieties are developed using the mixture of lines with several resistance genes in a common genetic background (Mundt 2002). In Japan, multiline varieties with blast resistance genes were developed using Japonica Group varieties, which efficiently managed rice blast disease (Abe 2004, Ishizaki et al. 2005, Koizumi 2007). Later, both Koide et al. (2011) and Fukuta et al. (2022) developed multiline rice varieties with blast resistance for the tropics using Indica Group varieties, ‘IR49830-7-1-2-2’ and ‘IR64’ genetic backgrounds, respectively and both were effective in controlling rice blast disease. So, these newly developed NILs will not only be exceptional plant materials for genetic and breeding studies for BPH resistance, but can also serve as monitoring tools against emerging BPH biotypes in different Asian countries.

Author Contribution Statement

DF and MMK designed the study. MMK, CDN and DF develop the plant materials. SS-M reared insects for conducting the research. SZ provided support for conducting the research and writing the manuscript. MMK and DF performed the experiments and wrote the paper.

Acknowledgments

We thank the staff of the Insect Pest Management Research Group, Kyushu Okinawa Agricultural Research Center, NARO, for rearing and providing the insect population. This work was supported by JSPS KAKENHI (Grant Number 18KK0169 and 21K05527). We also thank the Bangabandhu Science and Technology Fellowship Trust, Ministry of Science and Technology, Government of the People’s Republic of Bangladesh, for the doctoral fellowship granted to MMK. This research was part of the dissertation submitted by the first author in partial fulfilment of the Ph.D. degree. All authors have provided consent.

Literature Cited

•  Abe,  S. (2004) Breeding of a blast resistant multiline cultivar of rice, Sasanishiki BL. Jpn Agric Res Q 38: 149–154.
• Brar, D.S., P.S. Virk, K.K. Jena and G.S. Khush (2009) Breeding for resistance to planthoppers in rice. In: Heong, K.L. and B. Hardy (eds.) Planthoppers: New threats to the sustainability of intensive rice production systems in Asia, International Rice Research Institute, Los Baños, pp. 401–427.
• Cabauatan, P.Q., R.C. Cabunagan and I.R. Choi (2009) Rice viruses transmitted by the brown planthopper Nilaparvata lugens Stål. In: Heong, K.L. and B. Hardy (eds.) Planthoppers: New threats to the sustainability of intensive rice production systems in Asia, International Rice Research Institute, Los Baños, pp. 357–368.
• Catindig, J.L.A., G.S. Arida, S.E. Baehaki, J.S. Bentur, L.Q. Cuong, M. Norowi, W. Rattanakarn, W. Sriratanasak, J. Xia and Z. Lu (2009) Situation of planthoppers in Asia. In: Heong, K.L. and B. Hardy (eds.) Planthoppers: New threats to the sustainability of intensive rice production systems in Asia. International Rice Research Institute, Los Baños, pp. 191–220.
•  Cheng,  X.Y.,  L.L.  Zhu and  G.C.  He (2013) Towards understanding of molecular interactions between rice and the brown planthopper. Mol Plant 6: 621–634.
•  Cohen,  M.B.,  S.N.  Alam,  E.B.  Medina and  C.C.  Bernal (1997) Brown planthopper, Nilaparvata lugens, resistance in rice cultivar ‘IR64’: mechanism and role in successful N. lugens management in Central Luzon, Philippines. Entomol Exp Appl 85: 221–229.
•  Dellaporta,  S.L.,  J.  Wood and  J.B.  Hicks (1983) A plant DNA minipreparation: Version II. Plant Mol Biol Report 1: 19–21.
•  Du,  B.,  W.  Zhang,  B.  Liu,  J.  Hu,  Z.  Wei,  Z.  Shi,  R.  He,  L.  Zhu,  R.  Chen,  B.  Han et al. (2009) Identification and characterization of Bph14, a gene conferring resistance to brown planthopper in rice. Proc Natl Acad Sci USA 106: 22163–22168.
•  Fujii,  T.,  K.  Yoshida,  T.  Kobayashi,  K.K.M.  Myint,  H.  Yasui,  S.  Sanada-Morimura and  M.  Matsumura (2021) Long-term virulence monitoring of differential cultivars in Japan’s immigrant populations of Nilaparvata lugens (Hemiptera: Delphacidae) in 2001–2019. Appl Entomol Zool 56: 407–418.
•  Fujita,  D.,  A.  Kohli and  F.G.  Horgan (2013) Rice resistance to planthoppers and leafhoppers. CRC Crit Rev Plant Sci 32: 162–191.
•  Fukuta,  Y.,  M.J.  Telebanco-Yanoria,  Y.  Koide,  H.  Saito,  N.  Kobayashi,  M.  Obara and  S.  Yanagihara (2022) Near-isogenic lines for resistance to blast disease, in the genetic background of the Indica Group rice (Oryza sativa L.) cultivar IR64. Field Crops Res 282: 108506.
•  Guo,  J.,  C.  Xu,  D.  Wu,  Y.  Zhao,  Y.  Qiu,  X.  Wang,  Y.  Ouyang,  B.  Cai,  X.  Liu,  S.  Jing et al. (2018) Bph6 encodes an exocyst-localized protein and confers broad resistance to planthoppers in rice. Nat Genet 50: 297–306.
• Heinrichs, E.A., F.G. Medrano and H.R. Rapusas (1985) Brown planthopper, whitebacked planthopper, green leafhopper, and zigzag leafhopper. In: Heinrichs, E.A., F.G. Medrano and H.R. Rapusas (eds.) Genetic evaluation for insect resistance in rice, International Rice Research Institute, Los Baños, pp. 71–170.
•  Horgan,  F.G.,  A.F.  Ramal,  J.S.  Bentur,  R.  Kumar,  K.V.  Bhanu,  P.S.  Sarao,  E.H.  Iswanto,  H.V.  Chien,  M.H.  Phyu,  C.C.  Bernal et al. (2015) Virulence of brown planthopper (Nilaparvata lugens) populations from South and South East Asia against resistant rice varieties. Crop Prot 78: 222–231.
•  Hu,  J.,  C.  Xiao and  Y.  He (2016) Recent progress on the genetics and molecular breeding of brown planthopper resistance in rice. Rice (N Y) 9: 30.
• International Rice Genome Sequencing Project (IRGSP) (2005) The map-based sequence of the rice genome. Nature 436: 793–800.
• International Rice Research Institute (IRRI) (2014) Standard evaluation system for rice (SES) 5th edn. International Rice Research Institute, Los Baños, p. 57.
•  Ishizaki,  K.,  T.  Hoshi,  S.  Abe,  Y.  Sasaki,  K.  Kobayashi,  H.  Kasaneyama,  T.  Matsui and  S.  Azuma (2005) Breeding of blast resistant isogenic lines in rice cultivar “Koshihikari” and evaluation of their characters. Breed Sci 55: 371–377.
•  Jairin,  J.,  S.  Teangdeerith,  P.  Leelagud,  K.  Phengrat,  A.  Vanavichit and  T.  Toojinda (2007a) Detection of brown planthopper resistance genes from different rice mapping populations in the same genomic location. Sci Asia 33: 347–352.
•  Jairin,  J.,  S.  Teangdeerith,  P.  Leelagud,  K.  Phengrat,  A.  Vanavichit and  T.  Toojinda (2007b) Physical mapping of BPH3, a brown planthopper resistance locus in rice. Maejo International Journal of Science and Technology 1: 166–177.
•  Jena,  K.K.,  S.L.  Hechanova,  H.  Verdeprado,  G.D.  Prahalada and  S.R.  Kim (2017) Development of 25 near-isogenic lines (NILs) with ten BPH resistance genes in rice (Oryza sativa L.): Production, resistance spectrum, and molecular analysis. Theor Appl Genet 130: 2345–2360.
•  Ji,  H.,  S.R.  Kim,  Y.H.  Kim,  J.P.  Suh,  H.M.  Park,  N.  Sreenivasulu,  G.  Misra,  S.M.  Kim,  S.L.  Hechanova,  H.  Kim et al. (2016) Map-based cloning and characterization of the BPH18 gene from wild rice conferring resistance to brown planthopper (BPH) insect pest. Sci Rep 6: 34376.
•  Jiang,  H.,  J.  Hu,  Z.  Li,  J.  Liu,  G.  Gao,  Q.  Zhang,  J.  Xiao and  Y.  He (2018) Evaluation and breeding application of six brown planthopper resistance genes in rice maintainer line Jin 23B. Rice (N Y) 11: 22.
• Khush, G.S. (1979) Genetics of and breeding for resistance to the brown planthopper. Brown planthopper: Threat to rice production in Asia, International Rice Research Institute, Los Baños, pp. 321–332.
•  Khush,  G.S. (2005) What it will take to feed 5.0 billion rice consumers in 2030. Plant Mol Biol 59: 1–6.
• Khush, G.S. and P.S. Virk (2005) IR varieties and their impact. In: Hardy, B. (ed.) Selection criteria, International Rice Research Institute, Los Baños, pp. 6–15.
•  Koide,  Y.,  L.A.  Ebron,  H.  Kato,  H.  Tsunematsu,  M.J.  Telebanco-Yanoria,  N.  Kobayashi,  M.  Yokoo,  S.  Maruyama,  T.  Imbe and  Y.  Fukuta (2011) A set of near-isogenic lines for blast resistance genes with an Indica-type rainfed lowland elite rice (Oryza sativa L.) genetic background. Field Crops Res 123: 19–27.
• Koizumi, S. (2007) Durability of resistance to rice blast disease. In: Fukuta, Y., C.M. Vera Cruz and N. Kobayashi (eds.) A Differential System for Blast Resistance for Stable Rice Production Environment. JIRCAS Working Report No. 53. Japan International Research Center for Agricultural Sciences, Tsukuba, pp. 1–10.
•  Liu,  Y.,  H.  Wu,  H.  Chen,  Y.  Liu,  J.  He,  H.  Kang,  Z.  Sun,  G.  Pan,  Q.  Wang,  J.  Hu et al. (2015) A gene cluster encoding lectin receptor kinases confers broad-spectrum and durable insect resistance in rice. Nat Biotechol 33: 301–305.
•  Liu,  Y.,  L.  Chen,  Y.  Liu,  H.  Dai,  J.  He,  H.  Kang,  G.  Pan,  J.  Huang,  Z.  Qiu,  Q.  Wang et al. (2016) Marker assisted pyramiding of two brown planthopper resistance genes, Bph3 and Bph27(t), into elite rice Cultivars. Rice (N Y) 9: 27.
•  McCouch,  S.R.,  L.  Teytelman,  Y.  Xu,  K.B.  Lobos,  K.  Clare,  M.  Walton,  B.  Fu,  R.  Maghirang,  Z.  Li,  Y.  Xing et al. (2002) Development and mapping of 2240 new SSR markers for rice (Oryza sativa L.). DNA Res 9: 199–207.
•  Mundt,  C.C. (2002) Use of multiline cultivars and cultivar mixtures for disease management. Annu Rev Phytopathol 40: 381–410.
•  Muthayya,  S.,  J.  Hall,  J.  Bagriansky,  J.  Sugimoto,  D.  Gundry,  D.  Matthias,  S.  Prigge,  P.  Hindle,  R.  Moench-Pfanner and  G.  Maberly (2012) Rice fortification: An emerging opportunity to contribute to the elimination of vitamin and mineral deficiency worldwide. Food Nutr Bull 33: 296–307.
•  Myint,  K.K.M.,  H.  Yasui,  M.  Takagi and  M.  Matsumura (2009) Virulence of long-term laboratory populations of the brown planthopper, Nilaparvata lugens (Stål), and whitebacked planthopper, Sogatella furcifera (Horváth) (Homoptera: Delphacidae), on rice differential varieties. Appl Entomol Zool 44: 149–153.
•  Myint,  K.K.M.,  D.  Fujita,  M.  Matsumura,  T.  Sonoda,  A.  Yoshimura and  H.  Yasui (2012) Mapping and pyramiding of two major genes for resistance to the brown planthopper (Nilaparvata lugens [Stål]) in the rice cultivar ADR52. Theor Appl Genet 124: 495–504.
•  Nguyen,  C.D.,  H.  Verdeprado,  D.  Zita,  S.  Sanada-Morimura,  M.  Matsumura,  P.S.  Virk,  D.S.  Brar,  F.G.  Horgan,  H.  Yasui and  D.  Fujita (2019) The development and characterization of near-isogenic and pyramided lines carrying resistance genes to brown planthopper with the genetic background of Japonica rice (Oryza sativa L.). Plants (Basel) 8: 498.
•  Nguyen,  C.D.,  S.H.  Zheng,  S.  Sanada-Morimura,  M.  Matsumura,  H.  Yasui and  D.  Fujita (2021) Substitution mapping and characterization of brown planthopper resistance genes from indica rice variety, ‘PTB33’ (Oryza sativa L.). Breed Sci 71: 497–509.
• Painter, R.H. (1951) Insect resistance in crop plants. The Macmillan Company, New York, p. 81.
•  Rahman,  M.L.,  W.  Jiang,  S.H.  Chu,  Y.  Qiao,  T.H.  Ham,  M.O.  Woo,  J.  Lee,  M.S.  Khanam,  J.H.  Chin,  J.U.  Jeung et al. (2009) High-resolution mapping of two rice brown planthopper resistance genes, Bph20(t) and Bph21(t), originating from Oryza minuta. Theor Appl Genet 119: 1237–1246.
•  Ren,  J.,  F.  Gao,  X.  Wu,  X.  Lu,  L.  Zeng,  J.  Lv,  X.  Su,  H.  Luo and  G.  Ren (2016) Bph32, a novel gene encoding an unknown SCR domain-containing protein, confers resistance against the brown planthopper in rice. Sci Rep 6: 37645.
•  Shi,  S.,  H.  Wang,  L.  Nie,  D.  Tan,  C.  Zhou,  Q.  Zhang,  Y.  Li,  B.  Du,  J.  Guo,  J.  Huang et al. (2021) Bph30 confers resistance to brown planthopper by fortifying sclerenchyma in rice leaf sheaths. Mol Plant 14: 1714–1732.
•  Srinivasan,  T.S.,  M.L.P.  Almazan,  C.C.  Bernal,  D.  Fujita,  A.F.  Ramal,  H.  Yasui,  M.K.  Subbarayalu and  F.G.  Horgan (2015) Current utility of the BPH25 and BPH26 genes and possibilities for further resistance against plant- and leafhoppers from the donor cultivar ADR52. Appl Entomol Zool 50: 533–543.
•  Sun,  L.,  C.  Su,  C.  Wang,  H.  Zhai and  J.  Wan (2005) Mapping of a major resistance gene to the brown planthopper in the rice cultivar Rathu Heenati. Breed Sci 55: 391–396.
•  Tamura,  Y.,  M.  Hattori,  H.  Yoshioka,  M.  Yoshioka,  A.  Takahashi,  J.  Wu,  N.  Sentoku and  H.  Yasui (2014) Map-based cloning and characterization of a brown planthopper resistance gene BPH26 from Oryza sativa L. ssp. indica cultivar ‘ADR52’. Sci Rep 4: 5872.
•  Tanaka,  K.,  S.  Endo and  H.  Kazano (2000) Toxicity of insecticides to predators of rice planthoppers: Spiders, the mirid bug and the dryinid wasp. Appl Entomol Zool 35: 177–187.
•  Temnykh,  S.,  G.  DeClerck,  A.  Lukashova,  L.  Lipovich,  S.  Cartinhour and  S.  McCouch (2001) Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): Frequency, length variation, transposon associations, and genetic marker potential. Genome Res 11: 1441–1452.
•  Van Mai,  T.,  D.  Fujita,  M.  Matsumura,  A.  Yoshimura and  H.  Yasui (2015) Genetic basis of multiple resistance to the brown planthopper (Nilaparvata lugens Stål) and the green rice leafhopper (Nephotettix cincticeps Uhler) in the rice cultivar ‘ASD7’ (Oryza sativa L. ssp. indica). Breed Sci 65: 420–429.
•  Wang,  H.,  S.  Shi,  Q.  Guo,  L.  Nie,  B.  Du,  R.  Chen,  L.  Zhu and  G.  He (2018) High-resolution mapping of a gene conferring strong antibiosis to brown planthopper and developing resistant near-isogenic lines in 9311 background. Mol Breed 38: 107.
•  Wang,  Y.,  L.  Cao,  Y.  Zhang,  C.  Cao,  F.  Liu,  F.  Huang,  Y.  Qiu,  R.  Li and  X.  Luo (2015) Map-based cloning and characterization of BPH29, a B3 domain-containing recessive gene conferring brown planthopper resistance in rice. J Exp Bot 66: 6035–6045.
•  Xiao,  C.,  J.  Hu,  Y.T.  Ao,  M.X.  Cheng,  G.J.  Gao,  Q.L.  Zhang,  G.C.  He and  Y.Q.  He (2016) Development and evaluation of near-isogenic lines for brown planthopper resistance in rice cv. 9311. Sci Rep 6: 38159.
•  Yang,  H.,  A.  You,  Z.  Yang,  F.  Zhang,  R.  He,  L.  Zhu and  G.  He (2004) High-resolution genetic mapping at the Bph15 locus for brown planthopper resistance in rice (Oryza sativa L.). Theor Appl Genet 110: 182–191.
•  Yang,  M.,  L.  Cheng,  L.  Yan,  W.  Shu,  X.  Wang and  Y.  Qiu (2019) Mapping and characterization of a quantitative trait locus resistance to the brown planthopper in the rice variety IR64. Hereditas 156: 22.
•  Yara,  A.,  C.N.  Phi,  M.  Matsumura,  A.  Yoshimura and  H.  Yasui (2010) Development of near-isogenic lines for BPH25(t) and BPH26(t), which confer resistance to the brown planthopper, Nilaparvata lugens (Stål.) in indica rice ‘ADR52’. Breed Sci 60: 639–647.
•  Young,  N.D. and  S.D.  Tanksley (1989) Restriction fragment length polymorphism maps and the concept of graphical genotypes. Theor Appl Genet 77: 95–101.
•  Zhao,  Y.,  J.  Huang,  Z.  Wang,  S.  Jing,  Y.  Wang,  Y.  Ouyang,  B.  Cai,  X.F.  Xin,  X.  Liu,  C.  Zhang et al. (2016) Allelic diversity in an NLR gene BPH9 enables rice to combat planthopper variation. Proc Natl Acad Sci USA 113: 12850–12855.