Molecular-based race classification of Pyrenophora tritici-repentis causing tan spot of wheat in Japan

Abstract

Tan spot, a foliar disease of Triticum spp. such as bread wheat (T. aestivum L.) and durum wheat (T. turgidum ssp. durum (Desf.) Husn.) caused by the filamentous fungus Pyrenophora tritici-repentis (Died.) Drechsler leads to serious losses of crop yield and quality in some areas in Japan. P. tritici-repentis is classified into eight races according to the combinations of three necrotrophic effectors, PtrToxA, PtrToxB, and PtrToxC encoded by ToxA, ToxB, and ToxC1, respectively. Race classification has been based on reaction of a differential variety to necrotrophic effectors, which is tested by inoculation. Recent identification of the Tox genes and development of specific DNA markers have enabled us to classify races of P. tritici-repentis collected in Japan by Tox gene genotyping. We found that 17 strains collected from Triticum spp. in Japan were mainly race 1 or 2, because they carried ToxA as a toxin gene by current race classification; wheat genotype tsn1 is resistant to ToxA. Establishment of wheat cultivars carrying tsn1 would be most effective for decreasing agronomic losses caused by the disease in Japan.

Introduction

A foliar disease of wheat (Triticum spp.) caused by the filamentous fungus Pyrenophora tritici-repentis (Died.) Drechsler, called tan spot or yellow spot. It occurs in almost all wheat-growing regions all over the world including Japan (Kamel et al. 2019, Lamari and Strelkov 2010, Nishi et al. 1993, Shi et al. 2022, Tsukiboshi 2005, Yoshimatsu and Kato 2003). The disease can lead to considerable yield loss up to 50% and/or red smudge on grains to deteriorate their quality on susceptible cultivars to the disease in favorable condition (Lamari and Bernier 1989, Rees et al. 1982, Schilder and Bergstrom 1994). Recently, the wheat cultivated area of Japan is about 220,000 ha, and yield is about 1 million t a year (https://www.maff.go.jp/j/tokei/kouhyou/sakumotu/index.html, accessed April 7, 2023). Tan spot has become a serious problem in some areas of Japan. For reducing damages by the disease, crop rotation with rice, harvested residue removal and fungicides application are mainly done, but the most effective method for reducing disease is the development of genetically resistant varieties (Kariyawasam et al. 2018, Running et al. 2022).

The pathogenic fungus is currently known to have eight races defined according to combinations of three necrotrophic effectors, PtrToxA (13.2 kDa), PtrToxB (6.6 kDa), and PtrToxC, encoded respectively by ToxA, ToxB, and ToxC (Ballance et al. 1996, Ciuffetti et al. 1997, Effertz et al. 2002, Faris et al. 2013, Martinez et al. 2004, Strelkov et al. 2006). PtrToxA induces necrosis, and PtrToxB and PtrToxC induce chlorosis. Races of P. tritici-repentis have been identified on the basis of necrotrophic effector production and virulence after inoculation of a set of four differential varieties (Abdullah et al. 2017a, 2017b, 2017c, Faris et al. 2013, Kamel et al. 2019, Lamari and Strelkov 2010). Recently, genes encoding ToxA, ToxB, toxb, and ToxC1 have been identified. A ToxB homolog, toxb has missense mutations and encodes a non-toxic protein (Kamel et al. 2019, Strelkov et al. 2006). PtrToxC is considered to be a low-molecular-mass protein (Effertz et al. 2002), and a conserved hypothetical gene, ToxC1, is required but is not sufficient for PtrToxC production (Shi et al. 2022). Specific DNA markers for these genes have been developed (Kamel et al. 2019, Shi et al. 2022).

Although information about Tox genes is available, knowledge of P. tritici-repentis races in Japan is insufficient. In this study, we attempted to classify the strains present in Japan into races by genetic methods.

Materials and Methods

Fungus materials and genomic DNA extraction

We used 17 strains isolated from bread wheat (T. aestivum L.), durum wheat (T. turgidum ssp. durum (Desf.) Husn.), or Agropyron sp. registered as P. tritici-repentis at the Research Center of Genetic Resources, National Agriculture and Food Research Organization (NARO) (Table 1). Each strain was grown in potato dextrose broth (Becton, Dickinson and Co., Franklin Lake, NJ, USA), and genomic DNA was extracted in DNAs-ici-F extraction buffer (Rizo Inc., Tsukuba, Japan).

Table 1.

Materials used in this study

MAFF number	Collection		Host	Cultivar of isolation	Accession numbera				PCR amplification of Tox genesb				Predicted race
	Location (town/city, prefecture)	Year			ITS	gapdh	rpb2		ToxA	ToxB	toxb	ToxC1
150143	Fukuyama, Hiroshima	2017	Durum wheat	Setodure	LC685424	LC685441	LC685458		+	–	–	–	Race 2
150144	Fukuyama, Hiroshima	2018	Durum wheat	Setodure	LC685425	LC685442	LC685459		+	–	–	–	Race 2
150085	Tsuyama, Okayama	2017	Durum wheat	Setodure	LC685426	LC685443	LC685460		+	–	–	–	Race 2
150079	Miyoshi, Hiroshima	2016	Bread wheat	Minaminokaori	LC685427	LC685444	LC685461		+	–	–	–	Race 2
150080	Higashi-Hiroshima, Hiroshima	2016	Bread wheat	Kinuhime	LC685428	LC685445	LC685462		+	–	–	–	Race 2
150081	Tsuyama, Okayama	2016	Bread wheat	Setokirara	LC685429	LC685446	LC685463		+	–	–	–	Race 2
150084	Tsuyama, Okayama	2018	Bread wheat	Setokirara	LC685430	LC685447	LC685464		+	–	–	–	Race 2
150087	Tsuyama, Okayama	2017	Bread wheat	Setokirara	LC685431	LC685448	LC685465		+	–	–	+	Race 1 or race 2
150089	Tsuyama, Okayama	2017	Bread wheat	Setokirara	LC685432	LC685449	LC685466		+	–	–	–	Race 2
150090	Tsuyama, Okayama	2018	Bread wheat	Setokirara	LC685433	LC685450	LC685467		+	–	–	–	Race 2
150137	Fukuyama, Hiroshima	2018	Bread wheat	Setokirara	LC685434	LC685451	LC685468		+	–	–	–	Race 2
150138	Fukuyama, Hiroshima	2018	Bread wheat	Chinese Spring	LC685435	LC685452	LC685469		+	–	–	+	Race 1 or race 2
305430	Karatsu, Saga	1977	Bread wheat	Unknown	LC685436	LC685453	LC685470		+	–	–	+	Race 1 or race 2
306088	Ibaraki Prefecture	1990	Bread wheat	Unknown	LC685437	LC685454	LC685471		+	–	–	+	Race 1 or race 2
306089	Mie Prefecture	1990	Bread wheat	Unknown	LC685438	LC685455	LC685472		+	–	–	+	Race 1 or race 2
511122	Karatsu, Saga	1977	Bread wheat	Unknown	LC685439	LC685456	LC685473		+	–	–	+	Race 1 or race 2
306661	Ashoro, Hokkaido	2002	Agropyron sp.	Unknown	LC685440	LC685457	LC685474		–	–	–	–	Race 4

^a DNA sequences were registered in DDBJ.

^b + Tox gene-specific primers amplified a fragment; – they did not amplify a fragment.

PCR amplification and sequencing

The species identity of the 17 strains was verified according to Marin-Felix et al. (2019) using DNA sequences of the internal transcribed spacer region (ITS) and the coding regions of the genes for glyceraldehyde-3-phosphate dehydrogenase (gapdh) and the second largest subunit of RNA polymerase II (rpb2). These regions were amplified in a PCR Thermal Cycler Dice (Takara Bio, Shiga, Japan) using AmpliTaq Gold 360 (Applied Biosystems, Waltham, MA, USA) at an initial 95°C for 10 min; 35 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 60 s; and a final 72°C for 7 min. PCR primers are listed in Table 2. The PCR fragments were separated by electrophoresis in 2% agarose gel, visualized with Gel Red stain (Biotium, Fremont, CA, USA), and extracted with a Qiaquick Gel Extraction Kit (Qiagen, Hilden, Germany). They were sequenced by Fasmac Co. Ltd. (Kanagawa, Japan). The sequences were registered in the DNA Data Bank of Japan (DDBJ) with the accession numbers shown in Table 1.

Table 2.

Sequences of primers used in this study

Purpose and target gene	Sequence 5ʹ–3ʹ		Reference
For fungal identification
Internal transcribed spacer (ITS)	TCCGTAGGTGAACCTGCGG	TCCTCCGCTTATTGATATGC	White et al. (1990)
Glyceraldehyde-3-phosphatedehydrogenase (gapdh)	CAACGGCTTCGGTCGCATTG	GCCAAGCAGTTGGTTGTGC	Berbee et al. (1999)
Second largest subunit of RNA polymerase II (rpb2)	GGTCGTGACGGTAAACTGG	ATCATGGCCGGATGAATCT	Designed in this study
For race identification by quadruplex PCR
ToxA	GCGTTCTATCCTCGTACTTC	GCATTCTCCAATTTTCACG	Kamel et al. (2019)
ToxB	GCTACTTGCTGTGGCTATC	ACTAACAACGTCCTCCACTTTG	Kamel et al. (2019)
toxb	GCTACTTGCTGTGGCTATC	TATGAATGATTGACTGGGGTTA	Kamel et al. (2019)
CHS	TGGGGCAAGGATGCTTGGAAGAAG	TGGAAGAACCATCTGTGAGAGTTG	Kamel et al. (2019)
For race identification by duplex PCR
ToxB	GACTACCATGCTACTTGCTGTG	AACAACGTCCTCCACTTTGC	Kamel et al. (2019)
toxb	AAGTGGTCATTGCGACTGG	CCTCCACTTGCCAAACTCTC	Kamel et al. (2019)
ToxC1	GAGCAGCATTTTGACGAGTG	TGGAAGTCGTTCATTGTTGC	Shi et al. (2022)

Phylogenetic analysis

A phylogenetic tree was constructed using the UPGMA algorithm with 1000 bootstrap replicates in MEGA11 software (Tamura et al. 2021) with the sequences of the 17 strains and P. tritici-repentis CBS 191.29, P. grahamii CBS 128044, P. dictyoides CBS 127933, P. cynosuri CBS 127918, and P. fugax CBS 509.77 (Marin-Felix et al. 2019). A pairwise distances were calculated among 17 strains in MEGA11 software.

Genotyping of Tox genes

Genomic DNA was amplified in a Thermal Cycler Dice using Quicktaq HS (Toyobo, Osaka, Japan) by quadruplex PCR (ToxA, ToxB, toxb, and chitin synthase 1 (CHS1) as an internal control) or duplex PCR (ToxB, toxb, or ToxC1 and CHS1 at an initial 95°C for 2 min, followed by 30 cycles of 94°C for 30 s, and 68°C for 60 s. The amplified PCR fragments were separated and visualized as above.

Results

Species identification

All 17 strains listed in Table 1 formed a subclade together with P. tritici-repentis CBS 191.29 and were thereby confirmed as P. tritici-repentis (Fig. 1a). The pairwise distance was ranged 0.0005–0.0094 (data not shown). The minimum was between MAFF 150089 and MAFF 150137, and the maximum was between MAFF 150080 and MAFF 306661. The positions of the 17 strains within the subclade did not reflect the wheat species or cultivar from which they were isolated, or the collection site, and year (Fig. 1b, Table 1).

Fig. 1.

Phylogenetic analysis of the 17 strains examined in this study. The DNA sequences of ITS, gapdh, and rpb2 (Table 1) of each isolate were aligned, and phylogenetic trees were generated in MEGA11 software with the UPGMA algorithm and 1000 bootstrap replicates. GenBank accession numbers: P. tritici-repentis CBS 191.29 (ITS, MK540018; gapdh, MK540229; rpb2, MK540144); P. grahamii CBS 128044 (ITS, MK539988; gapdh, MK540197; rpb2, MK540113); P. dictyoides CBS 127933 (ITS, MH877971; gapdh, MK540191; rpb2, MK540109); P. cynosuri CBS 127918 (ITS, MK539980; gapdh, MK539980; rpb2, MK540106); P. fugax CBS 509.77 (ITS, MK539985; gapdh, MK540194; rpb2, MK540111). (a) Overall view of the phylogenetic tree. (b) Enlarged view of the subclade containing the 17 strains and P. tritici-repentis CBS 191.29. Bootstrap values are indicated at each branch node, and the scale bar indicates the number of nucleotide substitutions per site.

Tox gene distribution

The 16 strains collected from bread wheat or durum wheat had ToxA-specific fragments, but not ToxB- and toxb-specific fragments in quadruplex or duplex PCR (Fig. 2a–2c, Table 1). The 6 strains of them, MAFF 150087, 150138, 305430, 306088, 306089 and 511122, also had ToxC1-specific fragments. ToxA is necessary and sufficient for production of PtrToxA, and ToxC1 is necessary but not sufficient for that of PtrToxC. So, PtrToxC is unproduced through expression of ToxC1 only. According to the current race classification by Faris et al. (2013), we inferred that the 10 strains of MAFF 150143, 150144, 150085, 150079, 150080, 150081, 150084, 150089, 150090 and 150137 with ToxA-specific fragments only belong to race 2 producing PtrToxA only, as well as that the 6 strains with ToxA- and ToxC1-specific fragments belong to race 2 or race 1 producing both PtrToxA and PtrToxC. MAFF 306661 collected from Agropyron sp. did not have ToxA-, ToxB-, toxb-, and ToxC1-specific fragments. We inferred that it belongs to race 4, which has no PtrToxs (Table 1).

Fig. 2.

PCR-based genotyping of Tox genes. The MAFF numbers of the strains are shown on the top. A 275-bp fragment of the CHS1 gene was amplified as an internal positive control. (a) Quadruplex PCR of ToxA (573 bp) and ToxB/toxb (232 bp). (b) Duplex PCR of ToxB (245 bp). (c) Duplex PCR of toxb (157 bp). (e) Duplex PCR of ToxC1 (505 bp).

Discussion

This is the first report of identification of tan spot pathogens in Japan as P. tritici-repentis by current genetic methods and the inference of their races from the presence of Tox genes (Figs. 1, 2, Table 1). 17 strains were identified as P. tritici-repentis with ITS, gapdh and rpb2 sequence by current phylogenetic analysis according to Marin-Felix et al. (2019), a pairwise distances of them were very low and not characterized them by wheat species or cultivar from which they were isolated, or the collection site and year (Fig. 1, Table 1). No diversity was found ITS and β-tubulin gene in 10 strains of P. tritici-repentis from bread wheat in Mie Prefecture in Japan, although isolated year, site, and cultivar were differed (Hafez et al. 2022). We deduced from these reports that identification of P. tritici-repentis could be succeeded, but not clustered the collected information of 17 strains by phylogenetical analysis.

A race distribution of P. tritici-repentis in the world without East Asia including Japan was reported that race 1 was predominant in the Americas, Europe, North and South Asia and the Caucasus (Kamel et al. 2019). And race 2 was second predominant in the Americas and North and South Asia, but it was low frequency in Europe and the Caucasus (Kamel et al. 2019). In Australia and New Zealand, only races 1 or 2 were distributed (Antoni et al. 2010, Kamel et al. 2019). In Africa, a tendency of a race distribution of P. tritici-repentis were different from other areas, race 5 was predominant and race 6 was second predominant (Kamel et al. 2019). Hafez et al. (2022) used inoculation to analyze 10 isolates of P. tritici-repentis from bread wheat grown in Mie Prefecture in Japan and classified 8 isolates as race 1 and 2 isolates as race 2. Based on molecular analysis, we presume that the predominant race of P. tritici-repentis isolated from not only bread wheat but also durum wheat in Japan is race 1 or race 2, each of which has at least the ToxA gene and distributed in west area from Kanto region (Table 1, Fig. 2). Especially, 10 strains classified as race 2 were distributed around Hiroshima and Okayama Prefectures (Table 1, Fig. 2), because there is possibility that they were collected from a relatively confined location. In addition, this study inferred that MAFF 306661 from Agropyron sp. in Hokkaido was race 4. Race 4 has already been found from noncereal grasses in various areas in America with low frequency (Ali and Francl 2003). In the case of a distribution of wheat yellow mosaic virus in Japan, geographically distribution was found that pathotype I, II, and III were distributed in central, northern, and southern areas of Japan, respectively (Ohki et al. 2014). So, due to verify race identification with more strains of P. tritici-repentis from various collected sites and host wheats may lead complete understanding of race distribution in Japan.

The pathosystem between P. tritici-repentis and wheat has been studied in detail. In particular, hypersensitive reaction of the host leading to necrosis is mediated by PtrToxA and depends on the presence or absence of Tsn1 (an S/TPK-NBS-LRR gene) in the host (Faris et al. 2010). Wheat genotypes with Tsn1 are sensitive to PtrToxA, whereas null (tsn1) genotypes are insensitive (Faris et al. 2010). PtrToxC interacts with the wheat sensitivity gene Tsc1 to induce chlorosis, and the tsc1 genotype is insensitive (Effertz et al. 2002, Kariyawasam et al. 2018, Shi et al. 2022). Under the current distribution of P. tritici-repentis races, establishment of wheat cultivars with the tsn1 genotype is strongly required and of those with the tsc1 genotype is desirable as a direction of the crop breeding program to decrease agronomic losses caused by tan spot in Japan. In addition to introduce tsn1 and tsc1 in Japanese wheat cultivar(s) under the current situation, pyramiding of PtrToxB insensitive wheat genotype tsc2 with them might be better to be prepared for future invasions of new races of P. tritici-repentis. This breeding strategy will be possibility to confer a combined insensitivity for both necrosis and chlorosis by any PtrToxs.

Author Contribution Statement

All authors contributed to the study conception and design. KK, KT and HS prepared the materials. KK, YB, MY and KT collected and analyzed the data. All authors interpreted the data. KK and KT wrote the initial draft and all authors reviewed and approved the manuscript.

Acknowledgments

We are grateful to the Research Center of Genetic Resources, NARO, for providing P. tritici-repentis strains, and to Ms. Toshie Nakai for technical assistance with fungal strain cultures. This work was supported by the National Rice, Wheat and Barley Improvement Association.

Literature Cited

•  Abdullah,  S.,  S.K.  Sehgal and  S.  Ali (2017a) Race diversity of Pyrenophora tritici-repentis in South Dakota and response of predominant wheat cultivars to tan spot. J Plant Pathol Microbiol 8: 409.
•  Abdullah,  S.,  S.K.  Sehgal,  S.  Ali,  Z.  Liatukas,  M.  Ittu and  N.  Kaur (2017b) Characterization of Pyrenophora tritici-repentis (tan spot of wheat) races in Baltic states and Romania. Plant Pathol J 33: 133–139.
•  Abdullah,  S.,  S.K.  Sehgal,  K.D.  Glover and  S.  Ali (2017c) Reaction of global collection of rye (Secale cereale L.) to tan spot and Pyrenophora tritici-repentis races in South Dakota. Plant Pathol J 33: 229–237.
•  Ali,  S. and  L.J.  Francl (2003) Population race structure of Pyrenophora tritici-repentis prevalent on wheat and noncereal grasses in the great plains. Plant Dis 87: 418–422.
•  Antoni,  E.A.,  K.  Rybak,  M.P.  Tucker,  J.K.  Hane,  P.S.  Solomon,  A.  Drenth,  M.  Shankar and  R.P.  Oliver (2010) Ubiquity of ToxA and absence of ToxB in Australian populations of Pyrenophora tritici-repentis. Australas Plant Pathol 39: 63–68.
• Ballance, G.M., L. Lamari, R. Kowatsch and C.C. Bernier (1996) Cloning, expression and occurrence of the gene encoding the Ptr necrosis toxin from Pyrenophora tritici-repentis. Mol Plant Pathol On-line. https://www.cabdirect.org/cabdirect/abstract/19971002889.
•  Berbee,  M.L.,  M.  Pirseyedi and  S.  Hubbard (1999) Cochliobolus phylogenetics and the origin of known, highly virulent pathogens, inferred from ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycologia 91: 964–977.
•  Ciuffetti,  L.M.,  R.P.  Tuori and  J.M.  Gaventa (1997) A single gene encodes a selective toxin causal to the development of tan spot of wheat. Plant Cell 9: 135–144.
•  Effertz,  R.J.,  S.W.  Meinhardt,  J.A.  Anderson,  J.G.  Jordahl and  L.J.  Francl (2002) Identification of a chlorosis-inducing toxin from Pyrenophora tritici-repentis and the chromosomal location of an insensitivity locus in wheat. Phytopathology 92: 456–572.
•  Faris,  J.D.,  Z.  Zhang,  H.  Lu,  S.  Lu,  L.  Reddy,  S.  Cloutier,  J.P.  Fellers,  S.W.  Meinhardt,  J.B.  Rasmussen,  S.S.  Xu et al. (2010) A unique wheat disease resistance-like gene governs effector-triggered susceptibility to necrotrophic pathogens. Proc Natl Acad Sci USA 107: 13544–13549.
•  Faris,  J.D.,  Z.  Liu and  S.S.  Xu (2013) Genetics of tan spot resistance in wheat. Theor Appl Genet 126: 2197–2217.
•  Hafez,  M.,  T.  Despins,  K.  Nakajima and  R.  Aboukhaddour (2022) Identification of a novel ToxA haplotype of Pyrenophora tritici-repentis from Japan. Phytopathology 112: 1597–1820.
•  Kamel,  S.,  M.  Cherif,  M.  Hafez,  T.  Despins and  R.  Aboukhaddour (2019) Pyrenophora tritici-repentis in Tunisia: Race structure and effector genes. Front Plant Sci 10: 1562.
•  Kariyawasam,  G.K.,  W.  Hussain,  A.  Easterly,  M.  Guttieri,  V.  Belamkar,  J.  Poland,  J.  Venegas,  S.  Baenziger,  F.  Marais,  J.B.  Rasmussen et al. (2018) Identification of quantitative trait loci conferring resistance to tan spot in a biparental population derived from two Nebraska hard red winter wheat cultivars. Mol Breed 38: 140.
•  Lamari,  L. and  C.C.  Bernier (1989) Evaluations of wheat lines and cultivars to tan spot [Pyrenophora tritici-repentis] based on lesion type. Can J Plant Pathol 11: 49–56.
•  Lamari,  L. and  S.E.  Strelkov (2010) The wheat/Pyrenophora tritici-repentis interaction: progress towards an understanding of tan spot disease. Can J Plant Pathol 32: 4–10.
•  Marin-Felix,  Y.,  M.  Hernández-Restrepo,  I.  Iturrieta-González,  D.  García,  J.  Gené,  J.Z.  Groenewald,  L.  Cai,  Q.  Chen,  W.  Quaedvlieg,  R.K.  Schumacher et al. (2019) Genera of phytopathogenic fungi: GOPHY 3. Stud Mycol 94: 1–124.
•  Martinez,  J.P.,  N.W.  Oesch and  L.M.  Ciuffetti (2004) Characterization of the multiple-copy host-selective toxin gene, ToxB, in pathogenic and nonpathogenic isolates of Pyrenophora tritici-repentis. Mol Plant Microbe Interact 17: 467–474.
•  Nishi,  K.,  T.  Sato,  H.  Takahashi and  T.  Fukuda (1993) Varietal resistance to yellow spot in wheat. Proceedings of the Kanto-Tosan Plant Protection Society 40: 29–30 (in Japanese).
•  Ohki,  T.,  O.  Netsu,  H.  Kojima,  J.  Sakai,  M.  Onuki,  T.  Maoka,  Y.  Shirako and  T.  Sasaya (2014) Biological and genetic diversity of Wheat yellow mosaic virus (Genus Bymovirus). Phytopathology 104: 313–319.
•  Rees,  R.G.,  G.J.  Platz and  R.J.  Mayer (1982) Yield losses in wheat from yellow spot: comparison of estimates derived from single tillers and plots. Aust J Agric Res 33: 899–908.
•  Running,  K.L.D.,  A.  Momotaz,  G.K.  Kariyawasam,  J.D.  Zurn,  M.  Acevedo,  A.H.  Carter,  Z.  Liu and  J.D.  Faris (2022) Genomic analysis and delineation of the tan spot susceptibility locus Tsc1 in wheat. Front Plant Sci 13: 793925.
•  Schilder,  A.M.C. and  G.C.  Bergstrom (1994) Pyrenophora tritici-repentis as a component of the fungal flora of winter wheat seed in New York. Seed Sci Tech 22: 285–297.
•  Shi,  G.,  G.  Kariyawasam,  S.  Liu,  Y.  Ling,  S.  Zhong,  S.  Ali,  P.  Moolhuijzen,  C.S.  Moffat,  J.B.  Rasmussen,  T.L.  Friesen et al. (2022) A conserved hypothetical gene is required but not sufficient for Ptr ToxC production in Pyrenophora tritici-repentis. Mol Plant Microbe Interact 35: 336–348.
•  Strelkov,  S.E.,  R.F.  Kowatsch,  G.M.  Balance and  L.  Lamari (2006) Characterization of the ToxB gene from North African and Canadian isolates of Pyrenophora tritici-repentis. Physiol Mol Plant Pathol 67: 164–170.
•  Tamura,  K.,  G.  Stecher and  S.  Kumar (2021) MEGA11: Molecular evolutionary genetics analysis version 11. Mol Biol Evol 38: 3022–3027.
• Tsukiboshi, T. (2005) Collection of graminicolous Bipolaris, Drechslera and Exserohilum in Hokkaido. https://www.gene.affrc.go.jp/pdf/publications/micro-exp_2003(17)_p1.pdf (in Japanese).
• White, T.J., T. Bruns, S. Lee and J. Taylor (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A., D.H. Gelfand, J.J. Sninsky and T.J. White (eds.) PCR protocols: a guide to methods and applications, Academic Press, Inc., New York, pp. 315–322.
•  Yoshimatsu,  H. and  T.  Kato (2003) Occurrence of yellow spot on wheat and resistance of wheat cultivars against the disease. Annals of the Phytopathological Society of Japan 69: 19–20 (in Japanese).