Research Papers
Seedless formation of a landrace ‘Sanenashi’ (Pyrus L.) collected from Northern Tohoku, Japan
2024 Volume 74 Issue 5 Pages 427-434
Details
2024 Volume 74 Issue 5 Pages 427-434
‘Sanenashi’ is a landrace of Pyrus ussuriensis var. aromatica (Iwateyamanashi) with seedless fruit originating from northern Tohoku, Japan. To determine the mechanism of seedless fruit formation, we compared the number of styles in the pistil, fruit, seed set and the pollen tube growth between ‘Sanenashi’ and the Japanese pear cultivar ‘Kosui’. Morphological variations such as short or browning pistils were observed in 64.2% of ‘Sanenashi’ and 5.9% of ‘Kosui’. The initial fruit set rate of ‘Sanenashi’ was 48.3% at 4 weeks after cross-pollination with pear, and there were no fruit sets with peach pollen and non-pollinated sections at 8 weeks. Although the seed sets of ‘Sanenashi’ fruit were much lower than that of ‘Kosui’, 55.3% of viable ‘Sanenashi’ seeds germinated. Pollen tube growths were observed in the stigma and style of ‘Sanenashi’, but whether they reached the ovary could not be confirmed. Single sequence repeat (SSR) alleles of F1 progenies between ‘Sanenashi’ and pear cultivars were presented by five SSR markers. These results suggest that the seedless fruit formation in ‘Sanenashi’ corresponds with pseudo-parthenocarpy (stenospermocarpy) because pollination by pear pollen is necessary for the fruit set. However, the results do not fully confirm this hypothesis and require further experiments.
Consumers tend to prefer seedless fruit because it is easier to consume than seeded fruit. Therefore, the mutations in naturally occurring seedless fruit have been selected and maintained by traditional methods of propagation, such as grafting. Seedless watermelons and grapes have been established by artificial breeding (Andrus et al. 1971, Aradhya et al. 2003). Many studies have investigated the mechanisms of seedless fruit formation (e.g., in citrus and grape). Parthenocarpy is a common mechanism of seedless fruit formation that does not require pollination and fertilization (Nitsch 1965). However, Winkler (1908) has identified other mechanisms requiring pollination or other stimulation, namely as heat and hormone stresses. Autonomic-parthenocarpy, not requiring pollination, occurs in various Japanese persimmon cultivars (e.g., ‘Hiratanenashi’ and ‘Miyazaki-mukaku’) and the ‘Black Collins’ grape, and stimulative-parthenocarpy occurs in the citrus ‘Hyuuga-natsu’ and European pear ‘Seckel’. Kobel (1931) has identified another pollination-based mechanism, namely, pseudo-parthenocarpy. In parthenocarpic fruit, the ovules are unfertilized, and in pseudo-parthenocarpic fruit, the ovules can be normally fertilized, after which they show a sudden arrest of growth and disappear or form rudimentary structures. This phenomenon is observed in certain varieties of European pears, cherry, persimmon, grape, avocado, and cucumber.
In pears (Pyrus spp.), although seedless European and Chinese cultivars have been established, no seedless Japanese cultivar exists, except for hybrids between European and Japanese pear cultivars (Moriya et al. 2005, Nishitani et al. 2012, Nyeki et al. 1998). Katayama and Uematsu (2006) reported that ‘Sanenashi’ (Iwate-mukaku), a landrace of Pyrus ussuriensis var. aromatica (Iwateyamanashi) collected from northern Tohoku, Japan, was favored during the Edo era (ca. 400 years ago) because of its good taste, aroma, and small seedless core; thus it was widely disseminated by grafting. Although the aroma of ‘Sanenashi’ has been evaluated using sensory and chemical techniques (Katayama et al. 2013), the mechanism of seedless fruit formation remains largely unclear.
Adachi (1935) has reported that the mechanism of seedless fruit formation in ‘Mukaku-nashi’ (synonymous with ‘Sanenashi’) is caused by differences in the flower organ that directly affect female sterility, such as incomplete stigma and few pistils. Accordingly, this study investigated the mechanism of seedless fruit formation in ‘Sanenashi’ by comparing the rates of seedlessness and germination, as well as the histological pollen tube growth between ‘Sanenashi’ and a Japanese pear cultivar, ‘Kosui’.
The seedless pear landrace ‘Sanenashi’, two Japanese pear cultivars (‘Kosui’ and ‘Chojuro’), and the peach cultivar ‘Nagasawa Hakuho’, were used in this study. The plants were maintained at Food Resources Education and Research Center, Kobe University.
Morphological variations in pistil and pollination experimentsField experiments were conducted for 2 years: 2010 and 2011. Morphological changes in the pistils of ‘Sanenashi’ and ‘Kosui’ were observed in 2010. The number of pistils per flower was calculated and the styles were categorized according to their shape and color as follows: “normal”, “flat stigma”, “dried stigma”, “short pistil” or “browning”. Using one or two trees for each pear, we conducted cross-pollinations by collecting anthers from pollen parents selected from the second to fourth flowers in a nonadjacent flower cluster. Flowers were emasculated during anthesis by using tweezers. Cross- and non-pollination were performed on April 17, 2010, and April 16, 2011. ‘Sanenashi’ was pollinated with pollen from ‘Kosui’, ‘Chojuro’, and ‘Nagasawa Hakuho’ (peach) for 2 years and covered with paraffin paper bags to avoid pollen contamination. Fruit sets were observed from 1 to 8 weeks after pollination. Cross-pollinated fruits from ‘Sanenashi’ and ‘Kosui’ were harvested at 16 weeks, and the number of seeds per locule was counted. The diameter and major axis of ‘Sanenashi’ seeds were measured using an electric slide caliper. Seeds were categorized by size (Student’s t test, p < 0.01) and appearance as “mature” (viable), “immature” (inviable black seed), and “aborted” (white seed). ‘Kosui’ seeds were categorized “mature” and “immature” based on appearance because clear differences were observed.
Pollen tube growthWe examined pollen grain germination and tube growth as described by Sitch and Snape (1987). Briefly, in 2010, pistils were fixed 48 h after pollination, initially washed in water, hydrolyzed in 70% lactic acid in a boiling water bath, and then cooled. The softened pistils were washed in distilled water and immersed in 0.1 M K3PO4 for 16 h. The pistils were stained with Aniline blue [0.2% (w/v) in 0.1 M K3HPO4]. Each pistil was dissected using a fluorescence microscope (HB-10101AF, Nikon, Tokyo, Japan) to expose the ovule.
Seed germination rates and hybrid identificationAfter breaking dormancy in 2010, seeds were planted in a plug tray and maintained in a growth chamber. The number and rate of seed germination were calculated. For determining the fertilization status of germinated progenies, F1 hybrids were identified with five single sequence repeat (SSR) markers (NH011b, NB104a, NH009b, NH025a, and NH201a; Table 1) as described by Yamamoto et al. (2002a, 2002b). Total DNAs of the F1 hybrids were extracted as described by Sassa (2007). Polymerase chain Reactions (PCR) were performed using the total DNAs under the following conditions: 94°C for 2 m, 30 cycles of (94°C for 1 m, 55°C for 1 m, 72°C for 1 m), and 72°C for 2 m. PCR amplification was conducted using a GeneAmp PCR system 9700 (Thermo Fisher Scientific, Waltham, MA, USA) and analyzed using an Applied Biosystems 3500 genetic analyzer with GeneScan software (Thermo Fisher Scientific). Internal standard DNA (GeneScan 350 TAMRA, Thermo Fisher Scientific) was used to calculate the amplified fragment size.
| SSR name | Label | Origin | Primer sequence (5ʹ-3ʹ) | Motif | Reference |
|---|---|---|---|---|---|
| NH011b | fluo (Vic) | ‘Hosui’ | F GGTTCACATAGAGAGAGAGAG R GTTTCTTTTTGCCGTTGGACCGAGC |
(AG)9AA(AG)7 | Yamamoto et al. 2002a and 2002b |
| NH009b | fluo (Fam) | ‘Hosui’ | F CCGAGCACTACCATTGA R GTTTCTTCGTCTGTTTACCGCTTCT |
(AG)20 | |
| NH025a | fluo (Hex) | ‘Hosui’ | F CTGGACACAAACATTCAAGAGGG R CACACCAGAAACTCCAAAACAGG |
(AG)21(GA)4 | |
| NB104a | fluo (Fam) | ‘Bartlett’ | F TCGGAGAGGAAGAGTTGGAGGA R AGGTCCGTGCCCAGTTTCTTTC |
(GT)3GC(GT)5(GA)2TA(GA)5 | Sawamura et al. 2004 |
| NH201a | fluo (Fam) | ‘Hosui’ | F GTTTTGCTGCAATATCTCGCTA R GTTTCTTGATTGGAAGTGGATGGAGGA |
(CA)14 |
No notable weather anomalies and no frost damage were observed during the experimental period. The mean numbers of pistils in flowers varied: The highest mean rates of pistils per flower in ‘Sanenashi’ were 48.9% for two pistils and 32.6% for three pistils, and the highest mean rates of pistils per flower in ‘Kosui’ were 37.7% and 26.5% for seven and eight pistils during the 2 years (Fig. 1, Table 2).
Morphological variation in pistils of ‘Sanenashi’. The numbers indicate the number of pistils.
| Sample | Year | No. of flowers | No. of pistil | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | ||||||||||||||||
| ‘Sanenashi’ | 2011 | 1076 | 10 | (0.9%) | 110 | (10.2%) | 380 | (35.3%) | 414 | (38.5%) | 127 | (11.8%) | 35 | (3.3%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) |
| 2010 | 1213 | 2 | (0.2%) | 90 | (7.4%) | 738 | (60.8%) | 331 | (27.3%) | 47 | (3.9%) | 5 | (0.4%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | |
| Mean | 1144 | 6 | (0.5%) | 100 | (8.7%) | 559 | (48.9%) | 372.5 | (32.6%) | 87 | (7.6%) | 20 | (1.7%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | |
| ‘Kosui’ | 2011 | 285 | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 2 | (0.7%) | 24 | (8.4%) | 40 | (14.0%) | 91 | (31.9%) | 93 | (32.6%) | 28 | (9.8%) | 6 | (2.1%) | 0 | (0.0%) | 1 | (0.4%) |
| 2010 | 153 | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 2 | (1.3%) | 15 | (9.8%) | 38 | (24.8%) | 74 | (48.4%) | 23 | (15.0%) | 0 | (0.0%) | 1 | (0.7%) | 0 | (0.0%) | 0 | (0.0%) | |
| Mean | 219 | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 2 | (0.9%) | 19.5 | (8.9%) | 39 | (17.8%) | 82.5 | (37.7%) | 58 | (26.5%) | 14 | (6.4%) | 3.5 | (1.6%) | 0 | (0.0%) | 0.5 | (0.2%) | |
Morphological changes were observed in 374 ‘Sanenashi’ pistils from 2010, with a 64.2% appearance rate of abnormalities within the pistil and stigma. The various shapes were categorized into three types: 189 pistils (50.5%) with a flat stigma, 2 pistils (0.5%) with a dried stigma, and 49 pistils (13.1%) that were short and/or browning (Fig. 2, Table 3). From the 205 pistils in ‘Kosui’, 12 (5.9%) were short and/or browning.
Morphological variations in the pistils and stigmas of ‘Sanenashi’. (A) Normal pistil and stigma. (B) Flat and dried stigma. (C) Short and browning pistil. (D) Normal pistil in ‘Kosui’.
| Sample | No. of pistil | Normal | Abnormal | Abnormal stigma | Abnormal pistil | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Flat | Dried | Short and/or Browning | ||||||||||
| ‘Sanenashi’ | 374 | 134 | (35.8%) | 240 | (64.2%) | 189 | (50.5%) | 2 | (0.5%) | 49 | (13.1%) | |
| ‘Kosui’ | 205 | 193 | (94.1%) | 12 | (5.9%) | 0 | (0.0%) | 0 | (0.0%) | 12 | (5.9%) | |
In one flower, there were some with the same shape of pistil and others with different shapes of pistils. In ‘Sanenashi’, there were 27 (17.2%) flowers with only normal pistils, 78 (49.7%) flowers with only abnormal pistils, and 52 (33.1%) flowers with mixed (normal and abnormal), respectively. In ‘Kosui’, there were no flowers with only abnormal pistils (Table 4). These findings indicate that ‘Sanenashi’ had more morphological variations in the pistil and stigma than ‘Kosui’.
| Sample | No. of flower | Normal pistil | Abnormal pistil | Mixed (Normal and abnormal) | |||
|---|---|---|---|---|---|---|---|
| ‘Sanenashi’ | 157 | 27 | (17.2%) | 78 | (49.7%) | 52 | (33.1%) |
| ‘Kosui’ | 30 | 20 | (66.7%) | 0 | (0.0%) | 10 | (33.3%) |
The fruit sets were counted in ‘Sanenashi and ‘Kosui’ at six time points (0, 1, 2, 3, 4, and 8 weeks) over 2 years. In ‘Sanenashi’, a total of 690 flowers were cross-pollinated with ‘Chojuro’ and ‘Kosui’, of which >40% produced fruit sets after 8 weeks. No fruit sets were observed in non-pollinated ‘Sanenashi’ at 8 weeks. Moreover, no fruit sets were observed in the ‘Nagasawa Hakuho’ (peach) pollen experiment at 4 weeks. In ‘Kosui’, 76 flowers were pollinated with ‘Chojuro’ and 28 flowers with peach for 2 years. The mean fruit set rates of ‘Kosui’ cross-pollinated with ‘Chojuro’ and peach pollens were 56.6% and 3.6%, respectively, at 8 weeks. The mean fruit set rate in non-pollinated ‘Kosui’ was 8.3% at 8 weeks (Table 5).
| Sample | Pollen donor | Year | No. and rate of total fruit set | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 week | 1 weeks | 2 weeks | 3 weeks | 4 weeks | 8 weeks | |||||||||
| ‘Sanenashi’ | ‘Kosui’ | 2011 | 126 | (100.0%) | 125 | (99.2%) | 121 | (96.0%) | 76 | (60.3%) | 68 | (54.0%) | 51 | (40.5%) |
| 2010 | 207 | (100.0%) | 175 | (84.5%) | 126 | (60.9%) | 106 | (51.2%) | 102 | (49.3%) | 92 | (44.4%) | ||
| Mean | 166.5 | (100.0%) | 150 | (90.1%) | 123.5 | (74.2%) | 91 | (54.7%) | 85 | (51.1%) | 71.5 | (42.9%) | ||
| ‘Chojuro’ | 2011 | 128 | (100.0%) | 127 | (99.2%) | 107 | (83.6%) | 60 | (46.9%) | 55 | (43.0%) | 53 | (41.4%) | |
| 2010 | 229 | (100.0%) | 220 | (96.1%) | 176 | (76.9%) | 111 | (48.5%) | 108 | (47.2%) | 92 | (40.2%) | ||
| Mean | 178.5 | (100.0%) | 173.5 | (97.2%) | 141.5 | (79.3%) | 85.5 | (47.9%) | 81.5 | (45.7%) | 72.5 | (40.6%) | ||
| Pear cultivars | 690 | (100.0%) | 647 | (93.8%) | 530 | (76.8%) | 353 | (51.2%) | 333 | (48.3%) | 288 | (41.7%) | ||
| Non-pollinated | 2011 | 513 | (100.0%) | 512 | (99.8%) | 494 | (96.3%) | 13 | (2.5%) | 2 | (0.4%) | 0 | (0.0%) | |
| 2010 | 378 | (100.0%) | 346 | (91.5%) | 178 | (47.1%) | 2 | (0.5%) | 0 | (0.0%) | 0 | (0.0%) | ||
| Mean | 445.5 | (100.0%) | 429 | (96.3%) | 336 | (75.4%) | 7.5 | (1.7%) | 1 | (0.2%) | 0 | (0.0%) | ||
| ‘Nagasawa Hakuho’ (Peach) | 2011 | 9 | (100.0%) | 9 | (100.0%) | 9 | (100.0%) | 1 | (11.1%) | 0 | (0.0%) | 0 | (0.0%) | |
| 2010 | 20 | (100.0%) | 20 | (100.0%) | 19 | (95.0%) | 2 | (10.0%) | 0 | (0.0%) | 0 | (0.0%) | ||
| Mean | 14.5 | (100.0%) | 14.5 | (100.0%) | 14 | (96.6%) | 1.5 | (10.3%) | 0 | (0.0%) | 0 | (0.0%) | ||
| Others | 920 | (100.0%) | 887 | (96.4%) | 700 | (76.1%) | 18 | (2.0%) | 2 | (0.2%) | 0 | (0.0%) | ||
| ‘Kosui’ | ‘Chojuro’ | 2011 | 29 | (100.0%) | 29 | (100.0%) | 29 | (100.0%) | 21 | (72.4%) | 19 | (65.5%) | 13 | (44.8%) |
| 2010 | 47 | (100.0%) | 46 | (97.9%) | 46 | (97.9%) | 44 | (93.6%) | 39 | (83.0%) | 30 | (63.8%) | ||
| Mean | 38 | (100.0%) | 37.5 | (98.7%) | 37.5 | (98.7%) | 32.5 | (85.5%) | 29 | (76.3%) | 21.5 | (56.6%) | ||
| Pear cultivars | 76 | (100.0%) | 75 | (98.7%) | 75 | (98.7%) | 65 | (85.5%) | 58 | (76.3%) | 43 | (56.6%) | ||
| Non-pollinated | 2011 | 121 | (100.0%) | 120 | (99.2%) | 115 | (95.0%) | 70 | (57.9%) | 47 | (38.8%) | 10 | (8.3%) | |
| 2010 | 48 | (100.0%) | 45 | (93.8%) | 10 | (20.8%) | 6 | (12.5%) | 4 | (8.3%) | 4 | (8.3%) | ||
| Mean | 84.5 | (100.0%) | 82.5 | (97.6%) | 63 | (74.6%) | 38 | (45.0%) | 26 | (30.8%) | 7 | (8.3%) | ||
| ‘Nagasawa Hakuho’ (Peach) | 2011 | 22 | (100.0%) | 22 | (100.0%) | 22 | (100.0%) | 15 | (68.2%) | 9 | (40.9%) | 1 | (4.5%) | |
| 2010 | 6 | (100.0%) | 6 | (100.0%) | 6 | (100.0%) | 4 | (66.7%) | 3 | (50.0%) | 0 | (0.0%) | ||
| Mean | 14 | (100.0%) | 14 | (100.0%) | 14 | (100.0%) | 9.5 | (67.9%) | 6 | (42.9%) | 0.5 | (3.6%) | ||
| Others | 197 | (100.0%) | 193 | (98.0%) | 153 | (77.7%) | 95 | (48.2%) | 63 | (32.0%) | 15 | (7.6%) | ||
( ) denotes the appearance rate for the total number of flowers.
The mean locule number per fruit in ‘Sanenashi’ pollinated with ‘Kosui’ and ‘Chojuro’ ranged from 2.3 to 2.6 over the 2 years. In ‘Kosui’, the number of cross-pollinated locule was 7.0–8.0 (Table 6). The mean diameters (lengths) of mature seeds in ‘Sanenashi’ pollinated with ‘Kosui’ and ‘Chojuro’ were 2.1 (4.9) mm and 2.8 (5.0) mm, those of immature seeds were 0.9 (3.7) mm and 1.2 (3.7) mm, and those of aborted seeds were 0.7 (2.5) mm and 0.7 (2.5) mm, respectively. Seed size and lengths varied significantly between categories (Student’s t test, p < 0.01; Fig. 3, Table 7).
| Sample | Pollen donor | Year | Total no. of fruit | No. of locule/fruit a | Total no. of seeds | No. of seed observed in each category | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature | Imperfect | ||||||||||||
| Total | Immature | Aborted | |||||||||||
| ‘Sanenashi’ | ‘Kosui’ | 2011 | 26 | 2.5 ± 0.1 | 115 | 4 | (3.5%) | 111 | (96.5%) | 38 | (33.0%) | 73 | (63.5%) |
| 2010 | 47 | 2.5 ± 0.1 | 202 | 16 | (7.9%) | 186 | (92.1%) | 30 | (14.9%) | 156 | (77.2%) | ||
| ‘Chojuro’ | 2011 | 32 | 2.6 ± 0.1 | 151 | 22 | (14.6%) | 129 | (85.4%) | 67 | (44.4%) | 62 | (41.1%) | |
| 2010 | 13 | 2.3 ± 0.1 | 52 | 6 | (11.5%) | 46 | (88.5%) | 15 | (28.8%) | 31 | (59.6%) | ||
| Non-pollinated | 2011 | 0 | 0.0 ± 0.0 | 0 | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | |
| 2010 | 0 | 0.0 ± 0.0 | 0 | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | ||
| ‘Nagasawa Hakuho’ (Peach) | 2011 | 0 | 0.0 ± 0.0 | 0 | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | 0 | (0.0%) | |
| Total | 118 | — | 520 | 48 | (9.2%) | 472 | (90.8%) | 150 | (28.8%) | 322 | (61.9%) | ||
| ‘Kosui’ | ‘Chojuro’ | 2011 | 7 | 7.5 ± 0.2 | 105 | 24 | (22.9%) | 81 | (77.1%) | 81 | (77.1%) | 0 | (0.0%) |
| 2010 | 22 | 7.0 ± 0.2 | 303 | 159 | (52.5%) | 144 | (47.5%) | 144 | (47.5%) | 0 | (0.0%) | ||
| Non-pollinated | 2011 | 4 | 6.6 ± 0.9 | 56 | 0 | (0.0%) | 56 | (100.0%) | 56 | (100.0%) | 0 | (0.0%) | |
| 2010 | 4 | 7.0 ± 0.0 | 42 | 4 | (9.5%) | 38 | (90.5%) | 38 | (90.5%) | 0 | (0.0%) | ||
| ‘Nagasawa Hakuho’ (Peach) | 2011 | 1 | 8.0 ± 0.0 | 8 | 0 | (0.0%) | 8 | (100.0%) | 8 | (100.0%) | 0 | (0.0%) | |
| Total | 38 | — | 514 | 187 | (36.4%) | 327 | (63.6%) | 327 | (63.6%) | 0 | 0.0% | ||
a Mean value ± standard error.
Values in parentheses indicate the occurrence rate of total number of seeds.
( ) denotes the appearance rate for the total number of seeds.
Mature and immature seeds of ‘Kosui’ and ‘Sanenashi’. 1, mature seeds in ‘Kosui’; 2, immature seeds in ‘Kosui’; 3, mature seeds in ‘Sanenashi’; 4, immature seeds in ‘Sanenashi’; 5, aborted seeds in ‘Sanenashi’.
| Category | Year | Number of samples | Diameter (mm)a (Mean value ± standard error) |
Length (mm)a (Mean value ± standard error) |
|---|---|---|---|---|
| Mature | 2011 | 24 | 2.1 ± 0.1 | 4.9 ± 0.2 |
| 2010 | 20 | 2.8 ± 0.1 | 5.0 ± 0.1 | |
| Immature | 2011 | 93 | 0.9 ± 0.0 | 3.7 ± 0.1 |
| 2010 | 20 | 1.2 ± 0.0 | 3.7 ± 0.1 | |
| Aborted | 2011 | 57 | 0.7 ± 0.0 | 2.5 ± 0.1 |
| 2010 | 20 | 0.7 ± 0.0 | 2.5 ± 0.1 |
a Three categorized values are significant at p < 0.01.
The rates of immature and aborted seeds were 96.5% and 92.1% for in ‘Sanenashi’ pollinated with ‘Kosui’ and 85.4% and 88.5% for in ‘Sanenashi’ pollinated with ‘Chojuro’, respectively. Non-pollinated and cross-pollinated ‘Sanenashi’ seeds by peach pollens were not observed. The seeds of ‘Kosui’ pollinated with ‘Chojuro’ were categorized into mature (viable) and immature (inviable). The rates of mature seeds in ‘Kosui’ pollinated with ‘Chojuro’ were 22.9% and 52.5%, respectively. Thus, the rate of mature seeds was considerably lower in ‘Sanenashi’ than ‘Kosui’. In 2010, 9.5% of non-pollinated ‘Kosui’ seeds were mature (Table 6).
After seed dormancy, the germination rates of 10 and 16 mature seeds from ‘Sanenashi’ pollinated by ‘Kosui’ or ‘Chojuro’ pollen were 43.5% and 72.7%, respectively, for 2 years. The germination rate of mature ‘Kosui’ seeds was relatively higher than that in ‘Sanenashi’ (Table 8).
| Sample | Pollen donor | Year | Category | No. of seeds | No. of germinated seeds | Germination rate |
|---|---|---|---|---|---|---|
| ‘Sanenashi’ | ‘Kosui’ ‘Chojuro’ |
2011 | Mature | 23 | 10 | 43.5% |
| Immature | 78 | 0 | 0.0% | |||
| Aborted | 40 | 0 | 0.0% | |||
| 2010 | Mature | 22 | 16 | 72.7% | ||
| Immature | 24 | 1 | 4.2% | |||
| Aborted | 20 | 0 | 0.0% | |||
| Mean | Mature | 23.5 | 13 | 55.3% | ||
| Immature | 51 | 0.5 | 1.0% | |||
| Aborted | 30 | 0 | 0.0% | |||
| ‘Kosui’ | ‘Sanenashi’ | 2011 | Mature | 35 | 31 | 88.6% |
| Immature | 129 | 0 | 0.0% | |||
| Aborted | 0 | 0 | 0.0% | |||
| 2010 | Mature | 22 | 20 | 90.9% | ||
| Immature | 76 | 0 | 0.0% | |||
| Aborted | 0 | 0 | 0.0% | |||
| Mean | Mature | 28.5 | 25.5 | 89.5% | ||
| Immature | 102.5 | 0 | 0.0% | |||
| Aborted | 0 | 0 | 0.0% |
We further investigated seed formation in ‘Sanenashi’ based on pollen tube growth in the pistils of both soft and resin-embedded tissue. Pollen germination was observed in the pistils of ‘Sanenashi’ pollinated by ‘Chojuro’ and ‘Kosui’ pollen. We observed callose plugs in the stigma, the tip and base of the style in ‘Sanenashi’, consistent with the observations for ‘Kosui’ pollinated with ‘Chojuro’. The stigma and style of ‘Kosui’ had more pollen tubes than those of ‘Sanenashi’. Although a few pollen tubes occurred near the ovule in both ‘Sanenashi’ and ‘Kosui’, no pollen tubes were observed to reach the embryo sac in either soft or resin-embedded tissue sections (Fig. 4).
Fluorescence microscopy images of pollen tube growth in pistils of ‘Sanenashi’ and ‘Kosui’. Several pollen tubes can be seen growing in the stigma of ‘Sanenashi’ (A), stigma of ‘Kosui’ (B), transmitting tissue of ‘Sanenashi’ (C), transmitting tissue of ‘Kosui’ (D), around ovule in ‘Sanenashi’ (E), and around ovule in ‘Kosui’ (F).
We screened five SSR markers (derived from European pear and Japanese pear varieties) in 14 F1 seedlings (13 mature and 1 immature seeds) of ‘Sanenashi’ pollinated with a ‘Kosui’ or ‘Chojuro’ pollen (Sawamura et al. 2004, Yamamoto et al. 2002a, 2002b, Table 1). The F1-progeny samples were compared with control ‘Sanenashi’, ‘Kosui’, and ‘Chojuro’ samples. Three alleles in the F1 progeny were discriminated by NB104a, NH009b, and NH201a; four and six alleles were detected with NH011b and NH025a (Table 9). These results confirmed that all F1 progeny were hybrids of ‘Sanenashi’ and ‘Kosui’ or ‘Chojuro’.
| Samplea | SSR genotype (bp) | ||||
|---|---|---|---|---|---|
| NH011b | NB104a | NH009b | NH025a | NH201a | |
| S1 | 174/182 | 153/172 | 159/163 | 91/98 | 189/195 |
| S2 | 170/184 | 153/172 | 149/163 | 68/101 | 189/195 |
| S3 | 174/182 | 153/167 | 149/163 | 76/101 | 189/203 |
| S4 | 170/184 | 153/172 | 149/163 | 98/101 | 189/195 |
| S5 | 170/184 | 153/172 | 149/163 | 68/101 | 189/195 |
| S6 | 170/184 | 153/172 | 149/163 | 68/101 | 189/195 |
| S7 | 170/184 | 153/172 | 149/163 | 68/91 | 189/195 |
| S8 | 170/184 | 153/172 | 149/163 | 68/101 | 189/195 |
| S9 | 170/184 | 153/172 | 149/163 | 91/98 | 189/195 |
| S10 | 170/184 | 153/172 | 149/163 | 68/91 | 189/195 |
| S11 | 170/184 | 153/172 | 149/163 | 68/101 | 189/195 |
| S12 | 170/184 | 153/172 | 149/163 | 98/101 | 189/195 |
| S13 | 170/184 | 153/172 | 149/163 | 68/91 | 189/195 |
| SIM1 | 170/184 | 153/172 | 149/163 | 68/91 | 189/195 |
| ‘Sanenashi’ | 170/174 | 153/172 | 149/159 | 91/101 | 189/189 |
| ‘Kosui’ | 182/184 | 172/172 | 163/163 | 68/98 | 195/195 |
| ‘Chojuro’ | 174/182 | 167/167 | 163/163 | 76/95 | 195/203 |
a S and SIM are derived from ‘Sanenashi’ mature seed and immature seed, respectively.
‘Sanenashi’ and ‘Kosui’ pistils had many morphological differences (Tables 2–4). The number of pistils per flower was mainly two or three in ‘Sanenashi’ and in contrast with five or more in ‘Kosui’ or the typical P. ussuriensis and P. pyrifolia. Morphological variations such as short or browning pistils were observed in 64.2% of ‘Sanenashi’ and 5.9% of ‘Kosui’. The initial fruit set rates in ‘Sanenashi’ were 48.3% and 0.2%, and those of ‘Kosui’ were 76.3% and 32.0%, 4 weeks after cross- and non-pollination, respectively (Table 5). Thus, morphological differences in ‘Sanenashi’ pistils can somehow prevent their pollination or fertilization. For example, secretion around the stigmas can influence pollen germination (Edlund et al. 2004).
Chauhan et al. (1987) reported morphological differences in Crescentia cujete L., where the stigma surfaces of both seeded and seedless plants exhibited distinct characteristics under an electron microscope; the former showed small and loosely arranged wet papillae, and the latter displayed large compactly arranged dry papillae.
In ‘Sanenashi’, most pistils with morphological variation had small or absent stigma (Fig. 2). Adachi (1935) observed in ‘Sanenashi’ approximately 1–2 normal stigma per flower, with the majority abnormal, which may lead to sterility. Thus, we hypothesized that pollen attachment is poorer in abnormal (e.g., dry or shape of stigma surface) than normal stigmas. In this study, ‘Sanenashi’ had a mixture of flowers, some with the same type of pistil and others with different types of pistils (Table 4). It is challenging to trace the association between morphological characteristics and seedless formation. However, we may comprehend it using the flower with all the same type of pistils. Further research should consider the association between morphological differences and fertilization, such as pollen germination, growth, and fecundation in affected pistils.
Parthenocarpy and pseudo-parthenocarpyApproximately half of all ‘Sanenashi’ fruit were pollinated and set, whereas no fruits were non- or peach-pollinated and set (Table 5). These findings suggest that seedlessness in ‘Sanenashi’ is neither stimulative- nor autonomic-parthenocarpic. Therefore, further research should investigate the potential for pseudo-parthenocarpy to produce these phenotypes. By contrast, a few ‘Kosui’ non- and peach-pollinated fruits set, with most having only immature seeds (Tables 5, 6). This phenomenon is consistent with autonomic-parthenocarpy and that some P. pyrifolia cultivars, such as ‘Hosui’, show weak parthenocarpy but not seedlessness (Nishitani et al. 2012). However, the ‘Kosui’ non-pollinated section in 2010 obtained four mature seeds, despite non-pollinated pears with weak parthenocarpy being known to be unable to produce mature seeds. The cause of this phenomenon is unknown, but it might be due to a technical oversight in 2010, such as contamination due to incomplete bagging or the failure to emasculate the flowers, because no mature seeds were within the same section in 2011.
Seed fertilityIn ‘Sanenashi’, the total number of seeds was 520: 48 (9.2%) were mature, and 472 (90.8%) were abnormal (Table 6). Over 50% of the mature seeds germinated, and one of the abnormal seeds germinated (Table 8).
Pearson (1932, 1933) has reported that ‘Thompson Seedless’, a pseudo-parthenocarpic grape variety, ordinarily has four ovules in the ovary, of which at least one fertilizes and germinates, and the others are incomplete and degenerate without fertilization. The germinated ovules variously grow into aborted, imperfect, or perfect seeds (mostly aborted) that have previously been cultivated into embryo plants. Stout (1936) has found that due to a mixture of post-fertilization degeneration and non-fertilization phenomena, seedless fruit formation in ‘Thompson Seedless’ does not correspond completely to conventional pseudo-parthenocarpy and defines the mechanism as “stenospermocarpy”.
Because most of the seeds were aborted and imperfect, we hypothesize that seedlessness in ‘Sanenashi’ occurs by pseudo-parthenocarpy and that the characteristics of this mechanism may be similar to those of stenospermocarpy.
Ovule fertilization and potential mechanism of seedless fruit formationIn ‘Sanenashi’ pistils, we observed pollen germination at the stigma along with pollen tubes growing through the stigma, tip of the style, and base of the style in both ‘Chojuro’ and ‘Kosui’ pollinated sections. However, fewer pollen tube growths were observed in ‘Sanenashi’ than in ‘Kosui’. We did not observe any germinated ovules. If seedless fruit formation in ‘Sanenashi’ is caused by pseudo-parthenocarpy, then ovules would be expected to germinate normally, after which most degenerate and are aborted. However, in this study, the pollen tubes were not observed to arrive at the ovules, which is inconsistent with pseudo-parthenocarpy and somewhat consistent with stenospermocarpy of ‘Thompson Seedless’, as described in the previous paragraph “Seed fertility”. These results also suggested that ‘Sanenashi’ could fruit by physical stimulation through pollination alone, but we rejected stimulative-parthenocarpy based on the peach pollination test. Notably, we did not observe the pollen tubes reaching the ovules in ‘Kosui’ control plants either, which may be due to inappropriate handling in the experiment or limitations in the experimental setup. Under the conditions of 48 h after pollination, the same as in this study, An et al. (2016) reported that many pollen tubes had reached the ovules, and Claessen et al. (2022) indicated that from 61.4% (N = 44) to 78.1% (N = 32) of the individuals had one or more pollen tubes visible at the base of the style. However, some studies observed the vicinity of the ovules at, for example, 72 h and 5 d after pollination (Sanzol and Herrero 2007, Yamashita et al. 1990). On the basis of our observations, we could not confirm that seedless fruit formation in ‘Sanenashi’ is pseudo-parthenocarpic (or stenospermocarpic), which might require further validation of the experimental system, namely modification of the observation time after pollination.
The SSR-marker analysis confirmed that the F1 progeny derived from the ‘Sanenashi’ mature or immature seeds had alleles from both ‘Sanenashi’ and ‘Kosui’ or ‘Chojuro’, suggesting hybridization with ‘Kosui’ or ‘Chojuro’ (Table 9). The results indicated that at least one ovule in ‘Sanenashi’ germinated, which is consistent with pseudo-parthenocarpy (stenospermocarpy).
In conclusion, seedless fruit formation in ‘Sanenashi’ likely occurs through a pseudo-parthenocarpic (stenospermocarpic) mechanism. However, this hypothesis is not fully confirmed by the results within this study and requires further experimental validation, for example, assessing the relationship between the morphological differences in pistils and fertilization rates, identifying stenospermocarpic degeneration of the ovules, or validating stimulative-parthenocarpy through pollination with sterile pollen.
S.M., S.N, C.U. and H.K. conceived and designed the research. S.M. and S.N. conducted the experiments and prepared samples. S.M. and S.N. analyzed the data. C.U. and H.K. supervised the experiments. All authors contributed to the development of this manuscript.
We thank Drs. T. Yasuda (Takasaki) and R. Ishikawa, Kobe University, for their technical input. We also thank Mr. S. Kakehi, Mr. K. Masaki, Ms. Y. Owa, and Mr. R. Tanigawa, Kobe University, for the plant maintenance.
