Development of a KASP marker set for high-throughput genotyping in Japanese barley breeding programs with various end-use purposes

Abstract

In barley (Hordeum vulgare L.), many DNA markers have been developed for the selection of traits related to various end-use purposes of breeding. To perform rapid marker-assisted selection of many lines, we developed Kompetitive Allele-Specific PCR (KASP) markers, which can be used for effective automatic genotyping of single nucleotide polymorphisms (SNPs). The KASP primers were designed for 17 SNPs in 14 genes related to important traits. The target allele of all primers tried was identified on the basis of high FAM fluorescence in comparison with that of HEX. To evaluate the suitability of the developed markers in breeding programs, we used them to genotype 62 representative cultivars and lines. Then, using six of the developed markers, we comprehensively analyzed a total of 2,941 lines collected from eight breeding sites with a genotyping success rate of 95.1%–99.8% (mean, 98.6%). All six markers showed differences in allele percentages among breeding programs, and specific allele combinations were observed in all four barley types. Our data will be useful for predicting phenotype segregation and designing cross combinations. The developed KASP marker set can be used for high-throughput genotyping and should make breeding more efficient when combined with an accelerated generation technique.

Introduction

In 2022, the global production of barley (Hordeum vulgare L.), the fourth largest crop in the world, was about 155 million tonnes (https://www.fao.org/faostat/en/#data/QC, accessed 2024/05/16). In Japan, barley is used for brewing (beer and whisky), food (pearled barley and miso), and barley tea. These end-use products are closely related to four barley types: two-row type is used mainly for pearled barley, six-row type is used for pearled barley as food and barley tea, malting type is used for beer and whisky, and naked type is used mainly for miso. Because its use depends on the region, different DNA markers at multiple breeding sites have been used.

The DNA markers proanthocyanidin-free (ant28) (Himi et al. 2012), amylose-free (waxy) (Aoki et al. 2017, Domon et al. 2002), high-lysine (lys5) (Patron et al. 2004), high-amylose (amo1) (Li et al. 2011), and low steely-grain rate (fra) (Aoki et al. 2024, Saito et al. 2018) for pearling, lipoxygenase-less (lox-1) (Oozeki et al. 2007), grain protein content (GPC) related to beer foam (Protein Z4 and Protein Z7) (Iimure et al. 2011), and heat-stable β-amylase (Bmy1) (Paris et al. 2002) for malting have been developed and used for selection. In addition, Wang et al. (2015) reported that a single nucleotide polymorphism (SNP) in the coding region of the NAM-1 gene has a significant effect on GPC. Since appropriate GPC is important in cultivars used for malting barley, a DNA marker that can detect this SNP could be useful for controlling GPC in breeding programs. DNA markers for the improvement of agronomic traits, such as resistance to barley yellow mosaic disease (rym4 and rym5) (Nagamine et al. 2010, Stein et al. 2005) and seed dormancy, which inhibits field germination (Qsd1 and Qsd2) (Nakamura et al. 2016, Sato et al. 2016), are used in almost all Japanese breeding programs. Since multiple SNPs have been reported in the coding regions of Qsd1 and Qsd2, it is necessary to investigate these SNPs to accurately determine the alleles.

These DNA markers are genotyped mainly by gel electrophoresis. Cleaved amplified polymorphic sequence (CAPS) (Neff et al. 1998, Weining and Langridge 1991) and temperature switch PCR (Tabone et al. 2009) methods are frequently used to detect SNPs by gel electrophoresis. However, CAPS requires cost and time for restriction enzyme treatment, and primer design may be difficult for temperature switch PCR. Genotyping by next generation sequencing (NGS) can detect many SNPs and does not require gel electrophoresis (Bayer et al. 2017, Fan et al. 2006). Although the NGS approach can simultaneously survey many loci scattered across the genome, it is costly and time-consuming and is therefore unsuitable for investigating a specific gene in many samples in a short period. The competitive allele-specific PCR (called “Kompetitive Allele Specific PCR”, KASP) marker system is a method for SNP genotyping based on PCR with primers having bases corresponding to SNPs at the 3ʹ-end and detecting the fluorescence of the amplified product (Semagn et al. 2014) (https://www.biosearchtech.com/how-does-kasp-work, accessed 2022/04/14).

KASP markers can be used to rapidly analyze many samples because they can detect SNPs automatically without gel electrophoresis. They have been used for distinguishing genotypes in apple collections (Winfield et al. 2020) and stripe rust resistance genes of wheat (Wu et al. 2018). In barley, KASP markers have been developed for vernalization requirement, photoperiod reaction, and cleistogamy (Cockram et al. 2012), but these traits are not the main targets for marker-assisted selection in Japanese barley breeding.

In this study, we developed and validated a set of KASP markers that can be used to select for quality, disease resistance, and agronomic traits, which are the barley breeding targets in Japan. We used the markers to comprehensively estimate the genotypes of Japanese barley breeding materials and to examine the differences in allele percentages among breeding programs and in allele combinations among barley types. We also compared the conventional CAPS method and the KASP marker method in terms of the time, labor, and cost required for genotyping, and discuss the effectiveness of this marker set and its future use in barley breeding.

Materials and Methods

Plant materials

For the development of each KASP marker, one to three cultivars or breeding lines carrying the allele of interest were selected as positive controls. In addition, 62 leading Japanese cultivars, advanced breeding lines, and parental lines were used. For the fra, Qsd1, Qsd2 and rym5 genes, these 62 cultivars and lines have been genotyped using existing results of CAPS marker analysis and were used to evaluate the success and accuracy of the developed markers. For other genes, the reliability of developed makers was assessed using the positive controls listed in Supplemental Table 1.

To evaluate the suitability of the developed markers in segregating populations, we used 88 F₂ plants for ant28-484, 192 F₅ plants for fra, 96 F₂ plants for lox-1, 96 F₂ plants for Qsd2-E7, and 72 F₃ plants for waxSH97. These are breeding populations in progress, and identification of heterozygotes is especially required for efficient selection of the target genes.

To confirm the versatility of the developed markers and to investigate differences in allele frequencies among breeding programs, we analyzed the genotypes of 2,941 lines collected from eight barley breeding sites in Japan which each have different breeding programs (Table 1).

Table 1.Barley breeding sites and programs in Japan, and number of lines analyzed

Abbreviation	Breeding site	Prefecture	Location	Main objective of breeding	Main barley type	No. of lines
TARC	Tohoku Agricultural Research Center, NARO	Iwate	40°N 141°E	Pearled barley	Six-row	236
CARC	Central Region Agricultural Research Center, NARO	Niigata	37°N 138°E	Pearled barley	Six-row	716
NAES	Nagano Prefectural Agricultural Experiment Station	Nagano	37°N 138°E	Pearled barley	Six-row	194
TAES	Tochigi Prefectural Agricultural Experiment Station	Tochigi	37°N 140°E	Barley beer	Two-row, Malting	288
NICS	Institute of Crop Science, NARO	Ibaraki	36°N 140°E	Pearled barley, barley tea	Six-row, Naked	548
WARC	Western Region Agricultural Research Center, NARO	Kagawa	34°N 134°E	Pearled barley	Six-row, Naked	354
KARC	Kyushu Okinawa Agricultural Research Center, NARO	Fukuoka	33°N 130°E	Pearled barley, Shochua	Two-row	465
FARC	Fukuoka Agriculture and Forestry Research Center	Fukuoka	34°N 131°E	Barley beer	Two-row, Malting	140

^a Shochu is a kind of liquor.

DNA extraction

Seeds of all materials, except for the fra population, were sown in a 9-cm polypod containing Nippi Engei Baido 1 soil (Nihon Hiryo Co., Ltd., Fujioka, Gunma, Japan) and grown at 22°C for 2–3 weeks. Young leaves (ca. 1 cm) were placed into a 2.0-mL tube. For the fra population, upper young leaves (ca. 1 cm) were collected in the field of the Institute of Crop Science, NARO (NICS). DNA was extracted as described in Ishikawa et al. (2022). In brief, a 6-mm bead and 400 μL of TPS buffer (100 mM Tris-HCl, pH 8.0, 10 mM EDTA, 1 M KCl) were added to each sample in a tube and the tube was shaken until the buffer became pale green. The sample was centrifuged for 15 minutes (min) at 7,200 × g, and 100 μL of the supernatant was transferred to a 1.5-mL tube and mixed with an equal volume of isopropanol. It was then centrifuged for 10 min at 16,000 × g, and the supernatant was carefully removed. The pellet was washed with 200 μL of 70% ethanol. The mixture was centrifuged for 3 min at 16,000 × g, the supernatant was carefully removed, and the pellet was air dried at room temperature. Sterile distilled water was added to dissolve the pellet. The DNA concentration of each sample was measured by Nanodrop (ND-ONEC-W, Thermo Fisher Scientific Inc., Waltham, MA, USA) and adjusted to 10 ng/μL with sterile distilled water, and the sample was stored at –20°C.

KASP primer design

KASP primers were designed for 17 SNPs in 14 genes related to traits important for Japanese barley breeding. Details of the target genes are described in Supplemental Table 1. All target SNPs except for amo1 are located in the coding regions of the genes and have been reported as important polymorphisms that distinguish alleles affecting their phenotypes. The amo1 gene has not been characterized, but the target SNP is located in the vicinity of the causative gene, and it is known that the desired phenotype can be selected with this marker.

Using information obtained from the literatures listed in Supplemental Table 1, sequence data including SNPs were obtained from NCBI (https://www.ncbi.nlm.nih.gov/nuccore) or Ensembl Plants (https://plants.ensembl.org/index.html). The 3ʹ ends of the allele-specific primers were positioned on the SNP, and the primer length was adjusted in Net Primer software (http://www.premierbiosoft.com/netprimer/) so that the T_m values of the primers ranged from 60 to 65°C. The adaptor sequences of 5ʹ-gaaggtgaccaagttcatgct-3ʹ for one allele (primer labeled with FAM fluorescent dye) and 5ʹ-gaaggtcggagtcaacggatt-3ʹ for the other allele (primer labeled with HEX fluorescent dye) were added to the 5ʹ ends of the primers. Primers common to both alleles (COM) were designed in Primer3 software (https://primer3.ut.ee/) with settings of PCR product size 120–150 bp, T_m value 60–65°C, and GC rate close to those of the FAM/HEX primers. The designed primers were checked for self- and cross-dimerization and sequence specificity in Net Primer. When the ΔG of self- or cross-dimerization was below –10 kcal/mol, the primers were redesigned by adjusting the position of the COM primer or by using the complementary strand. Above, ΔG is the free energy of the primer calculated using the nearest neighbor method of Breslauer et al. (1986). In addition, the primer sequences were used as queries in BLAST searches against MorexV3_pseudomolecules_assembly in Ensembl Plants. Primers were redesigned if they matched sequences other than those near the 3ʹ end or if they had fewer than 3 base differences from the MorexV3 genome sequences other than the target genes. When none of the primers satisfied the above criteria, the specificity of the primer sequence was prioritized, and multiple primers were tested for their suitability in genotyping. Finally, the primer set that showed the best experimental results was selected and used as a marker for the target SNP (Table 2).

Table 2.KASP primer sequences and recommended number of PCR cycles

Gene/Target	SNP	Primer sequencesa	PCR cyclesb
amo1	G (High amylose)	FAM:gaaggtgaccaagttcatgctGCTGGCTCCGACTTTATTCG	32
	T (WT)	HEX:gaaggtcggagtcaacggattCGCTGGCTCCGACTTTATTCT
		COM:GCTCAACATACGCAAAGCAGTG
ant28-484	A (Proanthocyanidin-free)	FAM:gaaggtgaccaagttcatgctGCCTGAACAGAGGAGCGAGA	38
	G (WT)	HEX:gaaggtcggagtcaacggattGCCTGAACAGAGGAGCGAGG
		COM:TGGAGACGATGGTGTGGGTAAC
Bmy1_SNP698	C (High-thermostability β-amylases)	FAM:gaaggtgaccaagttcatgctGAGTGGGAATTTCCTAACGATGC	29
	T (Medium- or low-thermostability β-amylases)	HEX:gaaggtcggagtcaacggattCTGAGTGGGAATTTCCTAACGATGT
		COM:CCGTGCTTGATCAGATTGTTGG
fra	A (Low steely-grain rate)	FAM:gaaggtgaccaagttcatgctGGTAAATGGGCTCTCTGATGATTGA	32
	G (WT)	HEX:gaaggtcggagtcaacggattGTAAATGGGCTCTCTGATGATTGG
		COM:ATACATTATTTCAAGCGCCATCTTG
lox-1	T (Foam and flavour stability)	FAM:gaaggtgaccaagttcatgctCTACTCCATCAAGGCCATCACGT	32
	C (WT)	HEX:gaaggtcggagtcaacggattTACTCCATCAAGGCCATCACGC
		COM:CTTGATGCCGCCCTCATAGAG
lys5h (lys5g)	T (High lysine, shrunken endosperm)	FAM:gaaggtgaccaagttcatgctGCCTCAACCCTGTGCACCTATT	26
	C (WT)	HEX:gaaggtcggagtcaacggattGCCTCAACCCTGTGCACCTATC
		COM:TGCAACACAAGTACACAACACAACG
NAM-1_SNP544	C (High protein)	FAM:gaaggtgaccaagttcatgctGCGCGACCGCAAGTACC	29
	G (Not high protein)	HEX:gaaggtcggagtcaacggattGCGCGACCGCAAGTACG
		COM:GCCGAGGCCAGGATAGGCTT
ProteinZ4	A (Foam stability, pZ4-H)	FAM:gaaggtgaccaagttcatgctGTTCTACGAAATTCGGATACGAGGA	29
	G (WT, pZ4-L)	HEX:gaaggtcggagtcaacggattGTTCTACGAAATTCGGATACGAGGG
		COM:CCATATGCACTTTGGTACTTTGGTAG
ProteinZ7	C (Foam stability, pZ7-L and pZ7-L2)	FAM:gaaggtgaccaagttcatgctAGGCGGAGGTCGGTGGC	29
	T (WT, pZ7-H)	HEX:gaaggtcggagtcaacggattAGAGGCGGAGGTCGGTGGT
		COM:CCTGTTAAATATCCACCCAACACCCA
Qsd1-E9	G (High dormancy)	FAM:gaaggtgaccaagttcatgctGATTTTCGAAGTAAAGAGGTGCTTG	50
	C (Low dormancy)	HEX:gaaggtcggagtcaacggattGATTTTCGAAGTAAAGAGGTGCTTC
		COM:ATTCACATTTATGGTATTGCAAGGTACA
Qsd1-E11	G (High dormancy)	FAM:gaaggtgaccaagttcatgctAAGTTGCCAGATCACTTGGGTG	50
	A (Low dormancy)	HEX:gaaggtcggagtcaacggattGAAAGTTGCCAGATCACTTGGGTA
		COM:CCATGGGTCTCTGCTCTAAGGC
Qsd1-E14	A (High dormancy)	FAM:gaaggtgaccaagttcatgctCGCCAAGGCCGAGGACA	50
	G (Low dormancy)	HEX:gaaggtcggagtcaacggattCGCCAAGGCCGAGGACG
		COM:AGCTTATGTAACACAGGCCCGAC
Qsd2-E6	G (High dormancy)	FAM:gaaggtgaccaagttcatgctGGCAAAAATTACAGACTTTGGCG	50
	T (Low dormancy)	HEX:gaaggtcggagtcaacggattAGGCAAAAATTACAGACTTTGGCT
		COM:GATTTGATGGCATTGCTACACTATTATAA
Qsd2-E7	C (High dormancy)	FAM:gaaggtgaccaagttcatgctCATATATGTCACCTGAGAGAATTCGTAC	50
	A (Low dormancy)	HEX:gaaggtcggagtcaacggattCATATATGTCACCTGAGAGAATTCGTAA
		COM:CTGGGCCTTCATTGACATTATATG
rym4	T (Resistant to BaYMV)	FAM:gaaggtgaccaagttcatgctACAACCCGCAGGGCAAGTT	29
	C (Susceptible to BaYMV)	HEX:gaaggtcggagtcaacggatACAACCCGCAGGGCAAGTC
		COM:AGAATCCAGTAAGAGAGGGGCT
rym5	G (Resistant to BaYMV)	FAM:gaaggtgaccaagttcatgctGTGCCAATGGCGGTAAATGTAG	41
	C (Susceptible to BaYMV)	HEX:gaaggtcggagtcaacggattGTGCCAATGGCGGTAAATGTAC
		COM:GTGAGAAGGGAATTAGGGTGGAAC
waxSH97	A (Amylose free)	FAM:gaaggtgaccaagttcatgctGCAGAGAAGGCTGAAGCGCTA	44
	G (WT)	HEX:gaaggtcggagtcaacggattCAGAGAAGGCTGAAGCGCTG
		COM:AGGTGCATGGTGATTGATGTCAG

^a Lowercase letters indicate tail sequences in primers.

^b Number of cycles at 94°C for 20 s and 55°C for 60 s.

KASP genotyping

KASP assay mix (100 μL) was prepared by mixing the FAM primer (12 μL; 100 μM), HEX primer (12 μL; 100 μM), COM primer (30 μL, 100 μM), and 46 μL of sterile distilled water. DNA samples (2 μL; 10 ng/μL) were dispensed into 384-well plates in duplicate. To each sample, a mixture of 2.5 μL of 2× Master Mix (LGC Limited, Teddington, UK), 0.17 μL of KASP assay mix, and 0.33 μL of sterile distilled water was added. A CFX384TM real-time PCR detector (Bio-Rad, Hercules, CA, USA) was used for PCR at 94°C for 15 min followed by 10 cycles of 94°C for 20 seconds (sec) and 61–55°C for 60 sec with a 0.6°C decrease per cycle and then 26 cycles of 94°C for 20 sec and 55°C for 60 sec, according to the KASP genotyping manual (https://biosearch-cdn.azureedge.net/assetsv6/KASP-genotyping-chemistry-User-guide.pdf). Fluorescence intensities were detected in a CFX384TM Optics Module real-time detector (Bio-Rad). Alleles were determined in CFX Maestro software (Bio-Rad). If the difference between FAM and HEX fluorescence intensities was small, three to six cycles at 94°C for 20 sec and 55°C for 60 sec were added and detection was repeated.

Genotyping of 2,941 lines collected from eight breeding programs in Japan

Genotyping used 2,941 lines from eight barley breeding programs in Japan and six of the developed KASP markers—Bmy1_SNP698, fra, lox-1, NAM-1_SNP544, Qsd1-E9, and waxSH97. These genes are known to affect the end-use and were expected to vary in frequency among the breeding programs. The allele percentage for each marker was calculated for all lines from each breeding program. Samples with insufficient intensities of fluorescence or no amplification products were treated as missing data. The lines were classified into six-row, two-row, malting, and naked types on the basis of their end-use purposes and counted by the allele combinations of the six markers.

Phenotype investivgation of the waxSH97 population

Staining of waxSH97 seeds with povidone-iodine gargle solution (7% Iodine Gargle, Meiji Seika Kaisha, Ltd., Tokyo, Japan) allows detection of the phenotype (Yanagisawa et al. 2006). The waxSH97 population was used in a progeny test to confirm marker determination. The seeds of the F₂ lines were genotyped as wild type (WT), homozygous for the allele of interest, or heterozygous. At least eight seeds of each F₂ progeny line derived from ‘Kinumochi Nijo’ (waxSH97) × ‘YN004’ (WT) were used for each genotype.

Results

KASP marker development and validation for representative materials

KASP primers designed for 17 SNPs in 14 genes are shown in Table 2. As expected, in all primer sets the FAM primer detected the allele of interest and the HEX primer detected the WT or unfavorable allele, making it possible to distinguish cultivars or lines with the alleles of interest (Fig. 1, Supplemental Fig. 1).

Fig. 1.

Genotype plots of 62 representative cultivars and lines of barley obtained with KASP markers (A) Qsd1-E14 and (B) Qsd2-E7. RFU, relative fluorescence units. Genotype plots for other KASP markers are shown in Supplemental Fig. 1.

Using the KASP markers, we determined the genotypes of 62 cultivars and lines that have been important in barley breeding or are expected to be used as breeding materials. Eight markers—lox-1, NAM-1_SNP544, ProteinZ4, ProteinZ7, Qsd1-E14, Qsd2-E7, rym5 and waxSH97 determined the genotypes of all these materials (Supplemental Table 2). Other markers also showed high success rates in genotyping: 61 cultivars and lines (98.4%) by Bmy1_SNP698, fra, lys5h(lys5g), Qsd1-E11 and rym4; 59 (95.2%) by amo1 and ant28-484; and 57 (92.0%) by Qsd1-E9. For those genotyped with existing CAPS markers, the genotype results were consistent for all developed KASP markers except Qsd2-E7 (Supplemental Table 2). In Qsd2-E7, only three out of 60 cultivars or lines were discordant in genotype with the CAPS marker. Furthermore, all positive controls correctly showed FAM alleles (Supplemental Table 2). These results show that the developed markers can be used to characterize Japanese barley breeding materials.

Application of developed markers to segregating populations

To evaluate whether the markers work in a co-dominant manner, we used the segregating populations ant28-484, fra, lox-1, Qsd2-E7 and waxSH97. We determined the genotypes of 94.3% of plants in ant28-484, 92.3% in fra, 99.0% in lox-1, 99.0% in Qsd2-E7 and 100% in waxSH97 (Fig. 2, Supplemental Fig. 1). In the remaining samples, the intensity of fluorescence was insufficient to determine the genotype.

Fig. 2.

Genotype plots of the segregating population obtained with KASP markers (A) lox-1 and (B) Qsd2-E7. RFU, relative fluorescence units. Genotype plots for ant28-484, fra and waxSH97 populations are shown in Supplemental Fig. 1.

In the phenotype investigation of the waxSH97 population, all seeds whose parental line was WT or waxSH97 homozygous had the same phenotype as the parent. However, segregation of phenotypes was observed in seeds derived from heterozygous lines, confirming that the waxSH97 marker identified heterozygous plants.

Furthermore, consistency between phenotypes and genotyping results was observed in the ant28-484 population. However, this observation is not discussed in detail here, as not all populations have been subjected to the same level of study.

Comprehensive KASP genotyping of Japanese barley breeding materials

Out of the 2,941 breeding materials, Bmy1_SNP698 genotyped 2,796 (95.1%); fra genotyped 2,912 (99.0% of total); lox-1 genotyped 2,931 (99.7%); NAM-1_SNP544 genotyped 2,934 (99.8%); Qsd1-E9 genotyped 2903 (98.7%) and waxSH97 genotyped 2,914 (99.1%) (Table 3). The average success rate of the six markers was 98.6%. The number of samples with low fluorescence intensities or missing data was higher for Bmy1_SNP698 than for the other markers.

Table 3.Allele percentages in Japanese barley breeding materials determined with the six KASP markers

Allele	Bmy1_SNP698		fra		lox-1		NAM-1_SNP544		Qsd1-E9		waxSH97
	C		A		T		C		G		A
Breeding site	%	Ratioa	%	Ratioa	%	Ratioa	%	Ratioa	%	Ratioa	%	Ratioa
TARC	73.2	169/231	7.0	16/230	0.4	1/235	33.9	80/236	93.6	218/233	0.0	0/234
CARC	69.0	457/662	13.3	95/712	2.8	20/714	18.1	129/714	90.7	643/709	2.2	16/715
NAES	80.8	147/182	2.6	5/193	2.6	5/194	20.6	40/194	100.0	193/193	1.6	3/193
TAES	96.1	269/280	0.3	1/286	36.0	103/286	1.4	4/287	36.9	103/279	25.0	71/284
NICS	44.6	227/509	16.0	86/539	0.9	5/548	24.1	132/548	86.6	472/545	6.4	35/547
WARC	70.0	238/340	0.6	2/351	0.0	0/351	34.1	120/352	94.3	331/351	35.8	121/338
KARC	67.6	307/454	3.2	15/463	1.5	7/463	9.7	45/463	77.3	350/453	18.6	86/463
FARC	94.9	131/138	0.0	0/138	0.7	1/140	4.3	6/140	10.0	14/140	0.0	0/140
Overall	69.6	1945/2796	7.6	220/2912	4.8	142/2931	19.0	556/2934	80.1	2324/2903	11.4	332/2914

^a Number of FAM allele samples/Total number of fluorescent samples.

Allele percentages of all six markers differed among breeding programs (Tables 1, 3). The percentage of the low steely-grain rate allele of fra was 7.6% overall, but it was relatively high at CARC and NICS. The WT allele of waxSH97 was found in all lines at TARC and FARC, whereas the amylose-free allele was found in 25% of those at TAES and in 35.8% at WARC. The percentage of the foam and flavor stability allele of lox-1 was generally low, except TAES (36.0%). The dormancy allele of Qsd1-E9 was found in all lines at NAES, but only in 10% of lines at FARC.

The percentage of the high-protein allele of NAM-1_SNP544 was much lower at TAES (1.4%) and FARC (4.3%) than the overall value (19%). The percentage of the allele for high-thermostability β-amylases of Bmy1_SNP698 was highest at TAES (96.1%) and FARC (94.9%) and lowest at NICS (44.6%).

Allele combinations among barley breeding materials

To investigate the relationship between uses and allele combinations, we used 2,611 lines (out of 2,941) with no missing or heterozygous data for any of the six markers. The lines were classified into six-row, two-row, malting, and naked types, and counted by allele combinations of the six markers (Fig. 3, Supplemental Table 3). Since barley type information was not available for 332 lines, 2,279 lines were finally classified into the four types. Of 64 theoretically possible combinations, 31 unique combinations were found (18 in six-row, 22 in two-row, 6 in malting, and 21 in naked) (C1 to C31). We also counted the combinations present in more than 10% of the lines and counted the lines with each combination. In the six-row type, four combinations (C2, C18, C20 and C27) were found in 904 of 1,073 lines. In naked, four combinations (C18, C20, C26 and C27) were found in 413 of 565 lines. In two-row, combinations C20 and C23 were found in 309 of 515 lines. In malting, C23 was found in 112 of 126 lines. Among >2000 lines from eight programs, most lines had one of the above allele combinations. Combinations that included the FAM allele of NAM-1_SNP544 or the HEX allele of Bmy1_SNP698 were present only in the six-row and naked types.

Fig. 3.

Allele combinations of the six developed KASP markers in the four barley types.

Discussion

Practicality and limitations of developed KASP marker set in barley breeding

KASP markers for 17 SNPs in 14 genes involved in important traits in Japanese barley breeding were developed and confirmed to discriminate alleles clearly in multiple lines (Fig. 1). Markers ant28-484, fra, lox-1, and waxSH97 are available as co-dominant markers (Fig. 2) and will be effective in selecting early generations of cross populations in breeding programs.

Marker Bmy1_SNP698 had the lowest percentage of allele determination (95.1% in 2941 lines), which could be explained by the effect of its paralogous gene, Bmy2 (Vinje et al. 2011). Using the ‘Morex’ genome sequence of Bmy1 (EU589328.1) and Bmy2 (DQ889983.1), we compared the nucleotide sequences at the primer position of Bmy1 with the corresponding position of Bmy2, and found that they differed only in three bases of the FAM primer (outside the SNP) and two bases of the COM primer (data not shown). This result indicates why the Bmy1_SNP698 primer was less specific than the other primers. Although the call rate of the Bmy1_SNP698 marker is lower than that of other markers, the high-throughput advantage of the marker is considered significant for breeding programs with multiple samples.

Since specificity is important in primer design (Ye et al. 2012), the presence of highly similar sequences in the genome must be carefully checked. In KASP marker design, it is necessary to design primers at the positions of SNPs, and thus the positions of the primers are restricted. Therefore, not all SNP markers can be converted into KASP markers, owing to the limitations of GC content, ΔG of self- or cross-dimerization, monotonously repeated sequence, primer specificity. It should also be noted that if the gene of interest has unexpected allele, it cannot be typed accurately. However, our approach to primer design is more flexible than other methods of detecting SNPs.

Advantages of the developed KASP markers over conventional CAPS markers

The cost of SNP identification using a conventional CAPS marker varies owing to the wide range of restriction enzyme prices, but for a restriction enzyme available at a standard price the cost per 384 samples is approximately 18,700 JPY (Supplemental Table 4). Using a KASP marker, 384 samples can be genotyped for around 11,500 JPY. KASP markers require fewer steps and less time for genotyping than do CAPS markers because no gel electrophoresis is needed, and KASP markers are suitable for automated SNP genotyping owing to detection by fluorescence intensity. In breeding, many lines have to be genotyped with multiple markers in a short time, and the use of KASP markers could be a suitable method for marker-assisted selection (MAS).

Differences in allele percentage among breeding programs

Analysis of 2,941 cultivars and breeding lines collected from eight barley breeding programs in Japan revealed the effect of end-use purposes at each breeding site, as described below (Tables 1, 3).

SNPs selected in marker or phenotype selection: fra, lox-1, and waxSH97

The fra allele is useful to decrease the steely-grain rate, which has a negative effect on pearling time (Tonooka et al. 2010a). The percentage of the fra allele was highest at NICS (Pearled barley), with rich Andosols, where the steely-grain rate increases easily (Tonooka et al. 2010b). Therefore, lines with the fra mutant allele may have been preferentially introduced into lines at NICS.

The percentage of the lox-1 (lipoxygenase-less) allele was highest at TAES. Lipoxygenase produces 2-nonenal, which diminishes beer flavor and foam stability (Kuroda et al. 2003). Beer made from the malt of lox-1 lines has reduced contents of 2-nonenal (Hirota et al. 2006). TAES has been breeding beer barley, and our result may reflect the results of MAS of lox-1 (Oozeki et al. 2007). On the other hand, the percentage of the lox-1 allele was low (0.7%) at FARC where beer barley breeding is being performed. There are two possible reasons for this. One is that the marker was developed at TAES and may have been introduced into advanced breeding lines at an earlier stage. The other is that the allele may not have been prioritized at FARC. Further investigation is needed, but trait priorities, especially with regard to processing quality, may differ depending on manufacturer’s demand which may have influenced the different allele frequencies among breeding programs.

Barleys with no or low amylose content are used for pearling and are grown in many breeding programs. The mutant allele of waxSH97, which leads to the amylose-free phenotype, is derived from an artificial waxy mutant line of two-row barley (Domon et al. 2002). For this reason, the percentage of the waxSH97 mutant allele was high at TAES, WARC, and KARC, where two-row barley is grown. Amylose-free cultivars in six-row barley areas (Table 1), such as ‘Haneumamochi’ (Aoki et al. 2017), bred at CARC, or ‘Kihadamochi’ (Tonooka et al. 2022), bred at NICS, have a waxy mutation different from waxSH97. Therefore, the waxSH97 mutation is probably not widespread at CARC and NICS, which breed primarily six-row barley.

SNPs that differ in suitable alleles depending on the intended purpose: NAM-1_SNP544 and Qsd1-E9

The dormancy allele of Qsd1-E9 enhances seed dormancy and inhibits field sprouting, but because of the germination delay, the malt quality is low. The percentage of the dormancy allele was low in the beer barley breeding programs (TAES and FARC) and high in the other programs.

NAM-1_SNP544 affects protein content (Wang et al. 2015). High protein content decreases the quality of barley used for pearling and beer but increases that of barley used for tea (Mather et al. 1997, Matsuoka et al. 2010, Tonooka et al. 2010b). Six-row lines with the semi-dwarf gene (uzu) have been bred for barley tea at NICS. The relationship between NAM-1_SNP544 and barley tea quality has not been reported, but uzu lines at NICS used for barley tea (‘Kashima mugi’ and ‘Kashima goal’) had the high-protein allele (Supplemental Table 2). These results suggest that the high-protein allele of NAM-1_SNP544 may improve the quality of barley tea.

Bmy1_SNP698

Bmy1_SNP698 is related to beer quality; the high-thermostability β-amylase allele was found in over 90% of lines in beer barley breeding programs (TAES and FARC) and in about 70% of lines in all programs except NICS. Since the NILs of ‘Shikoku Hadaka 84’, which lacks Bmy1_SNP698 (Supplemental Table 2), are widely used as parental lines at NICS for introducing the fra allele, their progeny may reduce the overall Bmy1_SNP698 allele percentage at NICS.

When pearl barley is cooked with rice, maltose is produced by barley β-amylase (Tsuyukubo and Kasai 2013). The high-thermostability β-amylase allele was found in at least about 70% of lines in all but one breeding programs; this β-amylase would increase the amount of maltose during mixed cooking with rice. In cooked rice, the combined content of maltose and maltotriose positively correlates with the aroma in taste tests (Maruyama et al. 1983). Therefore, the Bmy1_SNP698 marker could be used to select lines of high quality for mixed cooking.

Our data showed an increase in the percentage of target alleles due to phenotype-based selection and genotypic selection during breeding. In the future, we may discover a novel marker–trait association by developing new markers. The information on genotypes obtained in this study would be useful for designing future crosses and selecting parents.

Development of a versatile variety based on KASP genotyping

In Japan, barley is often processed for multiple uses. For example, ‘Shunrai’ is used for both pearling and barley tea. Low steely-grain rate is good for pearling, and high protein content is suitable for barley tea (Matsuoka et al. 2010). However, there is a positive correlation between the steely-grain rate and protein content (Tonooka et al. 2010b). Therefore, it isn’t easy to improve the suitability for both pearling and barley tea. The fra mutation decreases steely-grain rate and increases protein content in barley lines (Aoki et al. 2024, Saito et al. 2018). Therefore, we hypothesized that combining the FAM alleles of fra and NAM-1_SNP544 would be beneficial for developing a versatile variety suitable for both barley tea and pearled barley. However, our genotyping found that only 1% of the lines analyzed had this combination (C1 and C3; Supplemental Table 3). To test this hypothesis, we intend to raise progeny using lines with C1 and C3 combinations as parents.

Application of gene pyramiding by early generation selection

In Japanese barley breeding, MAS is generally performed in the F₄ to F₆ generations, when the frequency of homozygotes is increased. MAS using multiple markers in these generations would result in most individuals being discarded before subsequent phenotype-based selection. As desirable alleles accumulate, the number of loci subject to MAS increases, further reducing the efficiency of the selection. To avoid this problem, it is desirable to start MAS in earlier generations before the target alleles are genetically fixed. In addition, a combination of accelerating the generations using “speed breeding” technology (Watson et al. 2018) and appropriate MAS in the early a few generations can dramatically increase the desired allele frequencies. In this case, since a genotyping system with multiple co-dominant markers in a short time is required, the developed KASP markers will be ideal for this purpose. After accumulation of desirable alleles by MAS, phenotypic selection for complex traits such as yield should allow for more efficient breeding of promising lines. Furthermore, these promising lines can be used as parents for the next crosses to accelerate barley breeding. The combination of speed breeding with KASP markers described here, will accelerate the improvement of Japanese barley breeding.

Author Contribution Statement

G.I. and J.T. designed the research; H.S. and H.A. performed the experiments; H.S. analyzed the data and wrote the original draft, M.N. provided guidance and advice on the Discussion section. All authors were involved in improving this manuscript. G.I. and J.T. are considered the corresponding authors since they shared the responsibility of supervising marker development and its breeding use, respectively.

 Acknowledgments

This study was supported by MAFF-commissioned project study on “Development of big data database and advanced supporting system in crop breeding (BAC) (JP J007142)” and “Smart breeding technologies to accelerate the development of new varieties toward achieving ‘Strategy for Sustainable Food Systems, MIDORI’ (JP J012037)”. The experimental work was supported by the Genome Breeding Support Office of the Institute of Crop Science, NARO.

Literature Cited

•  Aoki,  H.,  T.M.  Ikeda,  S.  Ohmori,  M.  Seki and  T.  Nagamine (2017) Development of DNA markers for the discrimination of the six-rowed waxy barley cultivar “Haneumamochi”. The Hokuriku Crop Science 52: 40–44 (in Japanese with English summary).
•  Aoki,  H.,  Y.  Nakano,  M.  Seki and  T.  Nagamine (2024) Effect of the fra mutation on grain quality in waxy and non-waxy barley. Cereal Res Commun 52: 825–832.
•  Bayer,  M.M.,  P.  Rapazote-Flores,  M.  Ganal,  P.E.  Hedley,  M.  Macaulay,  J.  Plieske,  L.  Ramsay,  J.  Russell,  P.D.  Shaw and  W.  Thomas (2017) Development and evaluation of a barley 50k iSelect SNP array. Front Plant Sci 8: 1792.
•  Breslauer,  K.J.,  R.  Frank,  H.  Blocker and  L.A.  Marky (1986) Predicting DNA duplex stability from the base sequence. Proc Natl Acad Sci USA 83: 3746–3750.
•  Cockram,  J.,  H.  Jones,  C.  Norris and  D.M.  O’Sullivan (2012) Evaluation of diagnostic molecular markers for DUS phenotypic assessment in the cereal crop, barley (Hordeum vulgare ssp. vulgare L.). Theor Appl Genet 125: 1735–1749.
•  Domon,  E.,  A.  Saito and  K.  Takeda (2002) Comparison of the waxy locus sequence from a non-waxy strain and two waxy mutants of spontaneous and artificial origins in barley. Genes Genet Syst 77: 351–359.
•  Fan,  J.B.,  K.L.  Gunderson,  M.  Bibikova,  J.M.  Yeakley,  J.  Chen,  E.W.  Garcia,  L.L.  Lebruska,  M.  Laurent,  R.  Shen and  D.  Barker (2006) [3] Illumina universal bead arrays. Methods Enzymol 410: 57–73.
•  Himi,  E.,  Y.  Yamashita,  N.  Haruyama,  T.  Yanagisawa,  M.  Maekawa and  S.  Taketa (2012) Ant28 gene for proanthocyanidin synthesis encoding the R2R3 MYB domain protein (Hvmyb10) highly affects grain dormancy in barley. Euphytica 188: 141–151.
•  Hirota,  N.,  H.  Kuroda,  K.  Takoi,  T.  Kaneko,  H.  Kaneda,  I.  Yoshida,  M.  Takashio,  K.  Ito and  K.  Takeda (2006) Brewing performance of malted lipoxygenase-1 null barley and effect on the flavor stability of beer. Cereal Chem 83: 250–254.
•  Iimure,  T.,  M.  Kihara,  S.  Ichikawa,  K.  Ito,  K.  Takeda and  K.  Sato (2011) Development of DNA markers associated with beer foam stability for barley breeding. Theor Appl Genet 122: 199–210.
•  Ishikawa,  G.,  H.  Sakai,  N.  Mizuno,  E.  Solovieva,  T.  Tanaka and  K.  Matsubara (2022) Developing core marker sets for effective genomic-assisted selection in wheat and barley breeding programs. Breed Sci 72: 257–266.
•  Kuroda,  H.,  S.  Furusho,  H.  Maeba and  M.  Takashio (2003) Characterization of factors involved in the production of 2 (E)-nonenal during mashing. Biosci Biotechnol Biochem 67: 691–697.
•  Li,  Z.Y.,  D.H.  Li,  X.H.  Du,  H.  Wang,  O.  Larroque,  C.L.D.  Jenkins,  S.A.  Jobling and  M.K.  Morell (2011) The barley amo1 locus is tightly linked to the starch synthase IIIa gene and negatively regulates expression of granule-bound starch synthetic genes. J Exp Bot 62: 5217–5231.
•  Maruyama,  E.,  K.  Higashi and  T.  Kajita (1983) The relation between physicochemical characteristics and the palatability evaluation. Journal of Home Economics of Japan 34: 819–825 (in Japanese with English summary).
•  Mather,  D.E.,  N.A.  Tinker,  D.E.  LaBerge,  M.  Edney,  B.L.  Jones,  B.G.  Rossnagel,  W.G.  Legge,  K.G.  Briggs,  R.G.  Irvine,  D.E.  Falk et al. (1997) Regions of the genome that affect grain and malt quality in a North American two-row barley cross. Crop Sci 37: 544–554.
•  Matsuoka,  T.,  N.  Ayuzawa and  T.  Kobayashi (2010) Simple method to determine which barley cultivar is suitable for roasted barley tea. Jpn J Crop Sci 79: 357–362 (in Japanese with English summary).
•  Nakamura,  S.,  M.  Pourkheirandish,  H.  Morishige,  Y.  Kubo,  M.  Nakamura,  K.  Ichimura,  S.  Seo,  H.  Kanamori,  J.  Wu,  T.  Ando et al. (2016) Mitogen-activated protein kinase kinase 3 regulates seed dormancy in barley. Curr Biol 26: 775–781.
•  Nagamine,  T.,  T.  Yanagisawa,  A.  Takahashi,  T.M.  Ikeda,  T.  Saotome and  T.  Okiyama (2010) DNA markers for the rym5 locus alleles involved in barley yellow mosaic virus resistance. https://www.naro.go.jp/project/results/laboratory/warc/2010/wenarc10-32.html. NARO (in Japanese).
•  Neff,  M.M.,  J.D.  Neff,  J.  Chory and  A.E.  Pepper (1998) dCAPS, a simple technique for the genetic analysis of single nucleotide polymorphisms: experimental applications in Arabidopsis thaliana genetics. Plant J 14: 387–392.
•  Oozeki,  M.,  T.  Nagamine,  T.M.  Ikeda,  Y.  Suzuki,  T.  Sekiwa,  E.  Yamaguchi and  T.  Kato (2007) Genetic variation in lipoxygenase activity among Japanese malting barley cultivars and identification of a new lipoxygenase-1 deficient mutant. Breed Res 9: 55–61 (in Japanese with English summary).
•  Paris,  M.,  M.G.K.  Jones and  J.K.  Eglinton (2002) Genotyping single nucleotide polymorphisms for selection of barley β-amylase alleles. Plant Mol Biol Report 20: 149–159.
•  Patron,  N.J.,  B.  Greber,  B.F.  Fahy,  D.A.  Laurie,  M.L.  Parker and  K.  Denyer (2004) The lys5 mutations of barley reveal the nature and importance of plastidial ADP-Glc transporters for starch synthesis in cereal endosperm. Plant Physiol 135: 2088–2097.
•  Saito,  M.,  T.  Tanaka,  K.  Sato,  P.  Vrinten and  T.  Nakamura (2018) A single nucleotide polymorphism in the “Fra” gene results in fractured starch granules in barley. Theor Appl Genet 131: 353–364.
•  Sato,  K.,  M.  Yamane,  N.  Yamaji,  H.  Kanamori,  A.  Tagiri,  J.G.  Schwerdt,  G.B.  Fincher,  T.  Matsumoto,  K.  Takeda and  T.  Komatsuda (2016) Alanine aminotransferase controls seed dormancy in barley. Nat Commun 7: 11625.
•  Semagn,  K.,  R.  Babu,  S.  Hearne and  M.  Olsen (2014) Single nucleotide polymorphism genotyping using Kompetitive Allele Specific PCR (KASP): overview of the technology and its application in crop improvement. Mol Breed 33: 1–14.
•  Stein,  N.,  D.  Perovic,  J.  Kumlehn,  B.  Pellio,  S.  Stracke,  S.  Streng,  F.  Ordon and  A.  Graner (2005) The eukaryotic translation initiation factor 4E confers multiallelic recessive Bymovirus resistance in Hordeum vulgare (L.). Plant J 42: 912–922.
•  Tabone,  T.,  D.E.  Mather and  M.J.  Hayden (2009) Temperature Switch PCR (TSP): Robust assay design for reliable amplification and genotyping of SNPs. BMC Genomics 10: 580.
•  Tonooka,  T.,  N.  Kawada,  M.  Fujita,  T.  Yoshioka and  C.  Kiribuchi-Otobe (2010a) Usefulness of starch mutants in improvement of pearling quality of barley cultivated in an andosol upland field. Jpn J Crop Sci 79: 308–315 (in Japanese with English summary).
•  Tonooka,  T.,  N.  Kawada,  T.  Yoshioka and  C.  Kiribuchi-Otobe (2010b) Pearling quality of barley cultivated in an andsol upland field. Jpn J Crop Sci 79: 296–307 (in Japanese with English summary).
•  Tonooka,  T.,  T.  Yanagisawa,  E.  Aoki,  M.  Taira and  T.  Yoshioka (2022) Breeding of a new six-rowed waxy barley cultivar “Kihadamochi” exhibiting high levels of yield and β-glucan content. Breed Res 24: 146–152 (in Japanese).
•  Tsuyukubo,  M. and  M.  Kasai (2013) Effect of endogenous enzymes on cooking mixed rice and barley and its impact on nutrition. Ann Nutr Metab 63: 1738–1739.
•  Vinje,  M.A.,  D.K.  Willis,  S.H.  Duke and  C.A.  Henson (2011) Differential expression of two β-amylase genes (Bmy1 and Bmy2) in developing and mature barley grain. Planta 233: 1001–1010.
•  Wang,  Y.G.,  X.F.  Ren,  D.F.  Sun and  G.L.  Sun (2015) Origin of worldwide cultivated barley revealed by NAM-1 gene and grain protein content. Front Plant Sci 6: 803.
•  Watson,  A.,  S.  Ghosh,  M.J.  Williams,  W.S.  Cuddy,  J.  Simmonds,  M.D.  Rey,  M.A.M.  Hatta,  A.  Hinchliffe,  A.  Steed,  D.  Reynolds et al. (2018) Speed breeding is a powerful tool to accelerate crop research and breeding. Nat Plants 4: 23–29.
•  Weining,  S. and  P.  Langridge (1991) Identification and mapping of polymorphisms in cereals based on the polymerase chain-reaction. Theor Appl Genet 82: 209–216.
•  Winfield,  M.,  A.  Burridge,  M.  Ordidge,  H.  Harper,  P.  Wilkinson,  D.  Thorogood,  L.  Copas,  K.  Edwards and  G.  Barker (2020) Development of a minimal KASP marker panel for distinguishing genotypes in apple collections. PLoS One 15: e0242940.
•  Wu,  J.H.,  Q.D.  Zeng,  Q.L.  Wang,  S.J.  Liu,  S.Z.  Yu,  J.M.  Mu,  S.  Huang,  H.A.  Sela,  A.  Distelfeld,  L.L.  Huang et al. (2018) SNP-based pool genotyping and haplotype analysis accelerate fine-mapping of the wheat genomic region containing stripe rust resistance gene Yr26. Theor Appl Genet 131: 1481–1496.
•  Yanagisawa,  T.,  E.  Domon,  M.  Fujita,  C.  Kiribuchi-Otobe and  T.  Takayama (2006) Starch pasting properties and amylose content from 17 waxy barley lines. Cereal Chem 83: 354–357.
•  Ye,  J.,  G.  Coulouris,  I.  Zaretskaya,  I.  Cutcutache,  S.  Rozen and  T.L.  Madden (2012) Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 13: 134.