Species-specific Primer and Probe Sets for Detection of Syntrophic Long-chain Fatty Acid-degrading Bacteria in Anaerobic Digestion Using Quantitative PCR

Abstract

Lipid-rich wastes are energy-dense substrates for anaerobic digestion. However, long-chain fatty acids (LCFAs), key intermediates in lipid degradation, inhibit methanogenic activity. In this study, TaqMan-based qPCR assays targeting the 16S rRNA gene of the cardinal LCFA-degrading bacterial species Syntrophomonas palmitatica and S. zehnderi were developed and validated. A trial experiment showed the advantage of species-specific quantification versus genus-specific quantification in assessing bacterial capacity for lipidic waste degradation. These qPCR assays will serve as monitoring tools for estimating the LCFA-degrading capacity of anaerobic digester communities and developing an effective strategy to enrich LCFA-degrading bacteria.

Anaerobic digestion is a practical method for recovering energy resources, such as methane, by treating various organic wastes. However, the broader application of anaerobic digestion requires further improvements in treatment efficiency and stability (Salama et al., 2019). The co-digestion of energy-rich wastes with wastewater sludge is attracting increasing attention due to improved digestion efficiency and biomethane yield (Wang et al., 2013). Lipidic wastes are considered to be desirable co-substrates because they exhibit higher levels of convertibility to biogas than sugars and proteins (Xu et al., 2018). However, long-chain fatty acids (LCFAs, with carbon chains of more than 12 carbon atoms) produced by the hydrolysis of lipids have been reported to inhibit anaerobic microorganisms (Shin et al., 2003; Palatsi et al., 2009; Silva et al., 2016). Therefore, LCFA degradation is required to promote stable and effective methane production from lipidic wastes.

In an anaerobic environment, LCFAs are degraded to hydrogen and acetate via the beta-oxidation pathway (Elsamadony et al., 2021). This process is the rate-limiting step during the anaerobic digestion of lipid-rich substrates (Lalman and Bagley, 2002). The syntrophic relationship between beta-oxidizing bacteria and methanogenic archaea is necessary because the reaction only proceeds under very low H₂ pressure (Weng and Jeris, 1976). For example, Schink and Friedrich (1994) reported that the oxidation of 3-hydroxy butyryl CoA to acetoacetyl CoA may be coupled to proton reduction at a hydrogen partial pressure close to 10^–5 bar [=1 Pa].

Currently, all of the isolated bacterial species that grow on LCFAs with methanogens belong to the families Syntrophomonadaceae and Syntrophaceae (Elsamadony et al., 2021). The bacterial species detected in mesophilic anaerobic digestion are Syntrophomonas sapovorans (Roy et al., 1986), S. wolfei subsp. saponavida (Lorowitz et al., 1989), S. curvata (Zhang et al., 2004), S. zehnderi (Sousa et al., 2007), S. palmitatica (Hatamoto et al., 2007a), and Syntrophus aciditrophicus (Jackson et al., 1999). Previous studies indicated that, among these species, Syntrophomonas palmitatica and S. zehnderi are the most important for LCFA degradation. Hatamoto et al. (2007b) investigated LCFA-degrading microorganisms using RNA-based stable isotope probing with ¹³C-labeled palmitate (saturated LCFA) and demonstrated that S. palmitatica was the dominant bacterial species. We also showed that after an approximately two-year pre-incubation of anaerobic digester sludge, the dominant species of genus Syntrophomonas was the closest to S. palmitatica, and its abundance increased as the loading amount of an oily substrate became higher (Sakurai et al., 2021). Similarly, a previous study indicated that S. zehnderi-related species became dominant in a continuously fed anaerobic digester treating LCFA (Ziels et al., 2017); therefore, S. palmitatica and S. zehnderi both dominate the degradation of LCFAs. However, methods to quantify these species have been limited to full-length 16S rRNA amplicon sequencing, shotgun metagenomics, and metatranscriptomics, all of which are expensive and time-consuming.

Quantitative PCR (qPCR) is a widely-employed, highly sensitive method for rapidly quantifying microorganisms of interest (Nadkarni et al., 2002). It is a proven and powerful tool for monitoring microbial populations in anaerobic digesters (Yu et al., 2005; Ziels et al., 2015). The use of a dual-labeled fluorogenic hydrolysis probe in the qPCR assay (TaqMan based) offers more specific detection than the SYBR Green assay (Wittwer et al., 1997). A previous study developed a TaqMan-based qPCR assay targeting the genus Syntrophomonas (Ziels et al., 2015). However, since not all Syntrophomonas members are capable of degrading LCFAs, species-specific quantification assays are needed to evaluate the LCFA-degrading potential of anaerobic digester communities. The present study aimed to develop and validate TaqMan qPCR assays targeting the two most important LCFA-degrader microorganisms during anaerobic digestion: S. palmitatica and S. zehnderi.

The developed primer/probe sets targeting the S. palmitatica and S. zehnderi 16S rRNA genes are listed in Table 1, and the amplicon sizes for their qPCR assays were 256 and 420 bp, respectively. The specificity of each primer and probe set was tested in silico using SILVA TestPrime 1.0 and TestProbe 3.0 (Klindworth et al., 2013). Microbial organisms with three or more mismatches between each of the three nucleotide sequences were not identified and this was attributed to the low possibility of their amplification (Yu et al., 2005). As a result, no potential non-target organisms were detected by the in silico ana­lysis for the S. palmitatica or S. zehnderi qPCR assays. To further verify the specificity of the primer/probe set, experimental validation was conducted as follows. PCR was performed using the primer sets developed for S. palmitatica and S. zehnderi. PCR products were purified and cloned into T-Vector pMD19 (Simple) (TaKaRa Bio), and the resulting vectors were transformed into T-Competent Quick DH5a (TOYOBO). Positive transformants were randomly selected and colony PCR was performed using the M13 primer RV (5′-CAGGAAACAGCTATGAC-3′) and M13 primer M4 (5′-GTTTTCCCAGTCACGAC-3′) (TaKaRa Bio). Clones with inserted DNA were identified and successfully sequenced after purification using ExoSAP-IT (Thermo Fisher Scientific). The insertion sequences were aligned using MAFFT v7.475 (Katoh and Standley, 2013), and primer sequences were trimmed using Jalview v 2.9.0b2 (Waterhouse et al., 2009). The taxa from which the sequences arose were identified using BLAST (http://www.blast.ncbi.nlm.nih.gov/genbank/). Using these clone sequences as templates, TaqMan-based qPCR assays were conducted to confirm that the assays successfully detected the target sequences only. The 16S rRNA nucleotide sequences obtained in the present study were deposited in Genbank/EMBL/DDBJ under accession codes LC752552 to LC752640.

Table 1. Characteristics of 16S rRNA gene-targeted qPCR primer/probe sets

	Target	Oligo. sequence (5′-3′)	E. coli position	Product size (bp)	Tm (°C)b
SynPal_Probe (P)	Syntrophomonas palmitatica	TGTCTAGAGCAATAACACGGCTTTAGAA	547–574		67
SynPalF (F)		GCGAAGAAGGCCTTAGGGTT	502–521	256	60
SynPalR (R)		CCTGCCCTCAAGAACTCCAG	738–757		60
SynZehn_Probe (P)	Syntrophomonas zehnderi	TGTTCGCGTCAGTAATATGGGCGTGAAA	509–542		75
SynZehnF (F)		GATGAGCCCGCGTCTGATTA	269–288	420	60
SynZehnR (R)		CAGTTTCAAGTGCAACCCCG	669–688		60

^a Designations in parentheses: P, TaqMan probe; F, forward primer; R, reverse primer.

^b Calculated using the nearest-neighbor method.

Using the primer sets for the S. palmitatica qPCR assay, 37 clones were constructed and sequenced (Table S1): 18 clones for S. palmitatica (identity: 92–100%) and 19 for S. zehnderi (identity: 91–100%). There were 16 clones with the TaqMan probe sequence with fewer than three mismatches from the clone library. These clones were the closest to S. palmitatica (identity: 99–100%). Only these clones were amplified by qPCR targeting S. palmitatica (Fig. 1A). Using the primer sets for the S. zehnderi qPCR assay, 52 clones were constructed and sequenced (Table S2): 18 clones for S. zehnderi (identity: 93–99%), four for S. bryantii (identity: 95%), 19 for S. sapovorans (identity: 95–99%), and 11 for S. wolfei (identity: 93–100%) and 4 for S. bryantii (identity: 95%). Five clones carrying the region matching the TaqMan probe had less than three mismatches from the clone library. The species closest to these clones was S. zehnderi (identity: 97–99%). Only these clones were amplified by qPCR targeting S. zehnderi (Fig. 1B). Overall, the primer/probe sets developed for S. palmitatica or S. zehnderi successfully amplified only the target sequences. These results indicate the high specificity of the qPCR assays developed. DNA samples for calibration standards were prepared by cloning the target PCR amplicon fragment of each primer set, derived from pure culture DNA, using the same protocol described above. Pure S. palmitatica cultures were purchased from the National Institute of Technology and Evaluation (Tokyo, Japan). Pure‍ ‍S. zehnderi cultures were purchased from Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (Braunschweig, Germany). The slopes of the calibration dilution series were calculated using linear regressions by plotting Ct values versus template concentrations. A linear dynamic range spanning seven orders of magnitude (10⁸–10² copies) is displayed for each species (Fig. 2). Slopes of –‍3.016 for S. palmitatica and –3.024 for S. zehnderi were obtained. The qPCR calibration slopes for the S. palmitatica and S. zehnderi assays corresponded to PCR efficiencies of 114.6 and 114.1%, respectively. These values were within the acceptable 80–120% range suggested in the MIQE guidelines (Bustin et al., 2009). The regression coefficients (R²) for S. palmitatica and S. zehnderi were 0.990 and 0.996, respectively.

Fig. 1.

Specific detection of target species as increases in fluorescence using the clone library.

TaqMan-based qPCR assays targeting (A) Syntrophomonas palmitatica and (B) Syntrophomonas zehnderi. Samples colored in red did not produce a fluorescence signal. The number following # indicates the clone ID described in Supplementary Table S1.

Fig. 2.

Threshold cycle (Ct) values versus 16S rRNA gene copies on a typical standard calibration curve.

Standard curves generated from qPCR assays targeting (A) Syntrophomonas palmitatica and (B) Syntrophomonas zehnderi. Triplicate points are shown for each standard dilution.

The utility of the qPCR assays developed was assessed using the two bioreactor samples described in our previous study: Sludge I and Sludge II (Sakurai et al., 2021). Briefly, Sludge I was prepared by incubating the collected sludge with lipidic waste for approximately 2 years. Sludge II was prepared by incubating it with glucose. In a batch experiment using scum from digested lipidic waste, Sludge I showed a 30% higher methane conversion rate than Sludge II. These sludges were used in the qPCR assay for specific 16S rRNA genes of the genus Syntrophomonas and species S. palmitatica and S. zehnderi (Table 2). Using the genus-specific primer/probe set developed by Ziels et al. (2015), the 16S rRNA gene copy numbers of Syntrophomonas were 3.9±0.9 E+05 in Sludge I and 2.2±0.2 E+06 copies mL^–1 in‍ ‍Sludge II. The 16S rRNA gene copy number of S. palmitatica was 9.1±0.9 E+05 copies mL^–1 in Sludge I and not detected in Sludge II. The 16S rRNA gene copy number of S. zehnderi was 2.9±0.3 E+05 copies mL^–1 in Sludge I and not detected in Sludge II. Even though Sludge II showed a higher 16S rRNA gene copy number of Syntrophomonas, neither S. palmitatica nor S. zehnderi were detected. These results suggested that the presence of S. palmitatica and S. zehnderi in Sludge I contributed to a 30% higher methane conversion rate. In conclusion, the presented TaqMan-based qPCR assays targeting S. palmitatica and S. zehnderi were validated and applied. Field testing indicated the advantage of species-specific quantification towards genus-specific quantification when assessing the capability of lipidic waste degradation. The assays presented here enabled the absolute quantification of LCFA-degrading bacteria for the first time and may lead to the establishment of better anaerobic digester operating strategies.

Table 2. Quantification of LCFA-degrading bacteria in anaerobic digestion sludge using qPCR assays developed in this study

Sample source	Target	Number of the 16S rRNA gene (copies mL–1*)	Reference
Sludge I	Syntrophomonas	3.9±0.9 E+05	Sakurai et al., 2021
	S. palmitatica	9.1±0.9 E+05	This study
	S. zehnderi	2.9±0.3 E+05	This study
Sludge II	Syntrophomonas	2.2±0.2 E+06	Sakurai et al., 2021
	S. palmitatica	n.d.	This study
	S. zehnderi	n.d.	This study

* Values represent the standard deviation of the mean (n=3 biological replicates).

Citation

Sakurai, R., Fukuda, Y., and Tada, C. (2023) Species-specific Primer and Probe Sets for Detection of Syntrophic Long-chain Fatty Acid-degrading Bacteria in Anaerobic Digestion Using Quantitative PCR. Microbes Environ 38: ME23023.

https://doi.org/10.1264/jsme2.ME23023

Acknowledgements

This study was supported by BIOENERGY (Tokyo, Japan). This work was supported by the Project of Integrated Compost Science (PICS). We would like to thank Editage (www.editage.com) for English language editing.

References

•  Bustin,  S.A.,  Benes,  V.,  Garson,  J.A.,  Hellemans,  J.,  Huggett,  J.,  Kubista,  M., et al. (2009) The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55: 611–622.
•  Elsamadony,  M.,  Mostafa,  A.,  Fujii,  M.,  Tawfik,  A., and  Pant,  D. (2021) Advances towards understanding long chain fatty acids-induced inhibition and overcoming strategies for efficient anaerobic digestion process. Water Res 190: 116732.
•  Hatamoto,  M.,  Imachi,  H.,  Fukayo,  S.,  Ohashi,  A., and  Harada,  H. (2007a) Syntrophomonas palmitatica sp. nov., an anaerobic syntrophic, long-chain fatty-acid-oxidizing bacterium isolated from methanogenic sludge. Int J Syst Evol Microbiol 57: 2137–2142.
•  Hatamoto,  M.,  Imachi,  H.,  Ohashi,  A., and  Harada,  H. (2007b) Identification and cultivation of anaerobic, syntrophic long-chain fatty acid-degrading microbes from mesophilic and thermophilic methanogenic sludges. Appl Environ Microbiol 73: 1332–1340.
•  Jackson,  B.E.,  Bhupathiraju,  V.K.,  Tanner,  R.S.,  Woese,  C.R., and  McInerney,  M.J. (1999) Syntrophus aciditrophicus sp. nov., a new anaerobic bacterium that degrades fatty acids and benzoate in syntrophic association with hydrogen-using microorganisms. Arch Microbiol 171: 107–114.
•  Katoh,  K., and  Standley,  D.M. (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol Biol Evol 30: 772–780.
•  Klindworth,  A.,  Pruesse,  E.,  Schweer,  T.,  Peplies,  J.,  Quast,  C.,  Horn,  M., and  Glöckner,  F.O. (2013) Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res 41: 1–11.
•  Lalman,  J., and  Bagley,  D.M. (2002) Effects of C18 long chain fatty acids on glucose, butyrate and hydrogen degradation. Water Res 36: 3307–3313.
•  Lorowitz,  W.H.,  Zhao,  H., and  Bryant,  M.P. (1989) Syntrophomonas wolfei subsp. saponavida subsp. nov., a long-chain fatty-acid-degrading, anaerobic, syntrophic bacterium; Syntrophomonas wolfei subsp. wolfei subsp. nov.; and emended descriptions of the genus and species. Int J Syst Bacteriol 39: 122–126.
•  Nadkarni,  M.A.,  Martin,  F.E.,  Jacques,  N.A., and  Hunter,  N. (2002) Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology 148: 257–266.
•  Palatsi,  J.,  Laureni,  M.,  Andrés,  M.V.,  Flotats,  X.,  Nielsen,  H.B., and  Angelidaki,  I. (2009) Strategies for recovering inhibition caused by long chain fatty acids on anaerobic thermophilic biogas reactors. Bioresour Technol 100: 4588–4596.
•  Roy,  F.,  Samain,  E.,  Dubourguier,  H.C., and  Albagnac,  G. (1986) Synthrophomonas sapovorans sp. nov., a new obligately proton reducing anaerobe oxidizing saturated and unsaturated long chain fatty acids. Arch Microbiol 146: 142–147.
•  Sakurai,  R.,  Takizawa,  S.,  Fukuda,  Y., and  Tada,  C. (2021) Exploration of microbial communities contributing to effective methane production from scum under anaerobic digestion. PLoS One 16: e0257651.
•  Salama,  E.S.,  Saha,  S.,  Kurade,  M.B.,  Dev,  S.,  Chang,  S.W., and  Jeon,  B.H. (2019) Recent trends in anaerobic co-digestion: Fat, oil, and grease (FOG) for enhanced biomethanation. Prog Energy Combust Sci 70: 22–42.
•  Schink,  B., and  Friedrich,  M. (1994) Energetics of syntrophic fatty acid oxidation. FEMS Microbiol Rev 15: 85–94.
•  Shin,  H.,  Kim,  S.,  Lee,  C., and  Nam,  S. (2003) Inhibitory effects of long-chain fatty acids on VFA degradation and β-oxidation. Water Sci Technol 47: 139–146.
•  Silva,  S.A.,  Salvador,  A.F.,  Cavaleiro,  A.J.,  Pereira,  M.A.,  Stams,  A.J.M.,  Alves,  M.M., and  Sousa,  D.Z. (2016) Toxicity of long chain fatty acids towards acetate conversion by Methanosaeta concilii and Methanosarcina mazei. Microb Biotechnol 9: 514–518
•  Sousa,  D.Z.,  Smidt,  H.,  Madalena Alves,  M., and  Stams,  A.J.M. (2007) Syntrophomonas zehnderi sp. nov., an anaerobe that degrades long-chain fatty acids in co-culture with Methanobacterium formicicum. Int J Syst Evol Microbiol 57: 609–615.
•  Wang,  L.,  Aziz,  T.N., and  De los Reyes,  F.L. (2013) Determining the limits of anaerobic co-digestion of thickened waste activated sludge with grease interceptor waste. Water Res 47: 3835–3844.
•  Waterhouse,  A.M.,  Procter,  J.B.,  Martin,  D.M.A.,  Clamp,  M., and  Barton,  G.J. (2009) Jalview Version 2-A multiple sequence alignment editor and ana­lysis workbench. Bioinformatics 25: 1189–1191.
•  Weng,  C.-nan, and  Jeris,  J.S. (1976) Biochemical mechanisms in the methane fermentation of glutamic and oleic acids. Water Res 10: 9–18.
•  Wittwer,  C.T.,  Herrmann,  M.G.,  Moss,  A.A., and  Rasmussen,  R.P. (1997) Continuous fluorescence monitoring of rapid cycle DNA amplification. BioTechniques 22: 130–138
•  Xu,  F.,  Li,  Y.,  Ge,  X.,  Yang,  L., and  Li,  Y. (2018) Anaerobic digestion of food waste—challenges and opportunities. Bioresour Technol 247: 1047–1058.
•  Yu,  Y.,  Lee,  C.,  Kim,  J., and  Hwang,  S. (2005) Group-specific primer and probe sets to detect methanogenic communities using quantitative real-time polymerase chain reaction. Biotechnol Bioeng 89: 670–679.
•  Zhang,  C.,  Liu,  X., and  Dong,  X. (2004) Syntrophomonas curvata sp. nov., an anaerobe that degrades fatty acids in co-culture with methanogens. Int J Syst Evol Microbiol 54: 969–973.
•  Ziels,  R.M.,  Beck,  D.A.C.,  Martí,  M.,  Gough,  H.L.,  Stensel,  H.D., and  Svensson,  B.H. (2015) Monitoring the dynamics of syntrophic β-oxidizing bacteria during anaerobic degradation of oleic acidby quantitative PCR. FEMS Microbiol Ecol 91: fiv028
•  Ziels,  R.M.,  Beck,  D.A.C., and  Stensel,  H.D. (2017) Long-chain fatty acid feeding frequency in anaerobic codigestion impacts syntrophic community structure and biokinetics. Water Res 117: 218–229.