2024 Volume 39 Issue 4 Article ID: ME24023
We herein investigated the effects of salt (NaCl) stress on soybean nodulation by rhizobial strains. We specifically examined: (1) the effects of NaCl on nodule maturity and positioning by inoculating three rhizobial strains (Bradyrhizobium diazoefficiens USDA110T, Bradyrhizobium elkanii USDA31, and Sinorhizobium fredii USDA191) onto soybean variety CNS, (2) the effects of the NaCl treatment on isoflavones (daidzein and genistein) secretion by CNS, (3) the effects of the NaCl treatment on gene expression induced by daidzein and genistein in rhizobia, and (4) the effects of the NaCl treatment on rhizobial growth. The results obtained were as follows: (1) the NaCl treatment delayed nodule development and reduced nodulation on the primary root following the USDA110T inoculation, minimal sensitivity regarding nodule formation in the USDA 31 inoculation, and significantly increased the mature nodule number and nodules on the primary root following the USDA 191 inoculation. (2) The NaCl treatment significantly reduced the secretion of daidzein from soybean roots, but did not significantly affect that of genistein. (3) NaCl treatment induced a significant decrease in genistein-induced nodC expression in USDA110T, but not in USDA31, and also caused a significant reduction in daidzein-induced nodC expression, but not genistein-induced expression, in USDA191. (4) NaCl treatment reduced survivability under acidic conditions, but increased survivability under saline-alkaline conditions for USDA191 than bradyrhizobia. These results indicate that saline conditions give S. fredii a competitive advantage over Bradyrhizobium during soybean infection.
Saline soils are prevalent across various regions worldwide, including Central Asia, India, Pakistan, China, Australia, the United States, and Europe (Ivushkin et al., 2019). They are caused by the accumulation of high salt concentrations in the surface layers due to the inadequate management of irrigation water, drought, seawater intrusion, and the abandonment of land after irrigation (Singh, 2015; Eswar et al., 2019; Laiskhanov et al., 2023). Saline soils are categorized into saline, sodic, and saline-sodic soils based on the type and quantity of salts present in the soil (Qadir et al., 2014; Zaman et al., 2018). Soil salinization is a global concern affecting more than 800 million ha of arable land worldwide and has a significant impact on crop production (FAO, 2008; Munns and Tester, 2008). Regions in which soil salinity and drought affect plant growth are expanding, covering 41–45% of the world’s land area (Gamalero et al., 2020). High salt concentrations affect plant pH, leaf structure and function, osmotic pressure and turgor, the transpiration rate, and ion compositions in leaves, which reduce crop productivity (Khan et al., 2014; Gamalero et al., 2020). The global spread of saline soils poses substantial threats to crop productivity and endangers livelihoods worldwide. Additionally, the global population is projected to increase from approximately 8 billion in 2022 to around 9.7 billion by 2050 (United Nations, 2019). Therefore, research that focuses on enhancing crop productivity in saline soils is imperative.
Soybeans form symbiotic relationships with rhizobia. They obtain fixed nitrogen from and provide carbohydrates to symbiotic rhizobia. During soybean root initiation, signaling substances, such as the isoflavones daidzein and genistein, are produced and secreted into the rhizosphere (Matsuda et al., 2023). Rhizobia in the soil receive these substances and synthesize lipo-chitooligosaccharides known as Nod factors (Wulandari et al., 2022). The basic structures of Nod factors are synthesized sequentially by various enzyme groups, namely, NodA, NodB, and NodC, which are encoded by the nodulation genes nodA, nodB, and nodC, respectively (Downie, 2014). Their specific substitutions, which affect host specificities, differ depending on the rhizobial strains (D’Haeze and Holsters, 2002). Soybean roots recognize Nod factors, leading to the expression of genes involved in rhizobial infection and the formation of root nodules (Janczarek et al., 2015). This process of rhizobial infection is affected by various soil environmental factors, including moisture, temperature, pH, nitrogen compounds, and the type and concentration of salts (Nishida and Suzaki, 2018; Ferguson et al., 2019; Nakei et al., 2022). Dardanelli et al. (2010) previously reported that a salt treatment inhibited the secretion of isoflavones, such as daidzein, and the intermediate naringenin from the roots of soybean variety Osumi. A number of studies have examined of nod gene expression in soybean rhizobia and the recognition of Nod factors by soybeans in relation to environmental factors (Duzan et al., 2004; Shiro et al., 2016). However, analyses that combine isoflavone secretion from soybeans and nod gene expression under salt stress conditions have yet to be performed. Additionally, high nodulation rates of Ensifer (Sinorhizobium) fredii have been detected in alkaline soils in Okinawa and Vietnam as well as in salt-accumulated soils in China and Brazil (Saeki et al., 2005; Suzuki et al., 2008; Han et al., 2009; Li et al., 2011). Some studies have evaluated salt tolerance in rhizobia using neutral media with 0–4% NaCl (Mukherjee and Samaddar, 1997; Djedidi et al., 2011). However, an evaluation of salt tolerance in relation to pH has not yet been conducted. We previously investigated the effects of NaCl on the nodulation of soybean variety CNS by various rhizobial strains and showed distinct variations in nodulation rates that were dependent on the rhizobial strain inoculated under NaCl treatments (Nitawaki et al., 2021). We demonstrated that nodule numbers were not affected by NaCl treatments following inoculations with B. diazoefficiens USDA110T and B. elkanii USDA31, whereas they significantly increased under 20–50 mM NaCl following an inoculation with S. fredii USDA191. Moreover, USDA191 exhibited higher competitiveness in a mixed inoculation under NaCl treatments. However, the mechanisms responsible for superior nodulation by S. fredii under saline conditions remain unclear.
Therefore, the present study investigated the mechanisms by which S. fredii achieved superior nodulation efficiency over Bradyrhizobium spp. soybean rhizobia under salt (NaCl) stress conditions. We initially examined the effects of NaCl on root nodule formation following inoculations with three types of rhizobia under NaCl treatment conditions. We then investigated changes in the secretion of isoflavones from the roots. We supplemented rhizobia with two types of isoflavones and assessed the effects of NaCl on nodC gene expression in rhizobia. We also examined the salt tolerance of rhizobia on media. Based on the results obtained, we investigated the effects of NaCl on the infection process leading to the establishment of the symbiotic relationship between soybean variety CNS and various rhizobial strains and the dominance of S. fredii in saline-alkaline soils.
In this study, the soybean variety CNS (Glycine max [L.] Merr.) was employed as the plant material, and the rhizobial strains B. diazoefficiens USDA110T, B. elkanii USDA31, and S. fredii USDA191, all compatible with variety CNS for nodulation, were utilized (Nitawaki et al., 2021). We herein refer to the latter species as S. fredii instead of Ensifer (Sinorhizobium) fredii, following the common convention of using the genus name with the suffix “rhizobium” for rhizobial species. All strains were cultured on Yeast-extract Mannitol Agar (YMA, Vincent, 1970) medium and stored at 4°C until used.
Effects of the NaCl treatment on nodule developmentExperiments were conducted to evaluate the effects of the NaCl treatment on nodule development in soybeans inoculated with rhizobia. Rhizobia were transferred from YMA culture plates to Yeast-extract Mannitol Broth (YMB, Vincent, 1970) and cultured at 28°C in the dark with continuous agitation at 120 rpm for 3 days for S. fredii and 5 days for Bradyrhizobium species until a stationary phase of 108 cells mL–1 was reached. Cultures were then diluted with sterilized water to 106 cells mL–1 to prepare inoculants (Nitawaki et al., 2021). The upper pots of Leonard jars (volume of 900 mL) were used as cultivation pots, filled with vermiculite, and supplemented with a 1/4 strength N-free hydroponic solution containing 0 mM (control) or 50 mM NaCl (Saeki et al., 2000; Nitawaki et al., 2021). The same hydroponic solution was added to the lower part of the jar, and the jars were covered with aluminum foil and autoclaved at 121°C for 20 min for sterilization. Soybean seeds were surface-sterilized with 70% ethanol and sodium hypochlorite (0.25% available chlorine) before sowing (Nitawaki et al., 2021). Sterilized seeds were individually sown and then covered with vermiculite, with each seed receiving 1 mL of an inoculant. Soybean cultivation took place in a plant growth chamber for 21 days, with a 16-h light period at 28°C and an 8-h dark period at 23°C. The number and size of nodules on the roots were examined on days 12, 15, 18, and 21 post-seed inoculation. Nodules with a diameter ≥1 mm were classified as “mature nodules”, whereas those <1 mm were classified as “immature nodules”, with nodule numbers being measured accordingly. The experiment was replicated 3–5 times, and a statistical analysis comparing different NaCl concentrations was performed using Welch’s t-test.
Effects of NaCl on the formation of nodules on primary and lateral rootsTo assess the infection rate based on the nodulation site, experiments were conducted independently of mature and immature nodule counts. Seeds were sown separately in 0 mM (control) and 50 mM NaCl treatments using the same medium as described above. Three strains of rhizobia were simultaneously inoculated using the same method as described above. Soybean cultivation followed the same procedure as described above, in a plant growth chamber for 21 days with a 16-h light period at 28°C and an 8-h dark period at 23°C. Nodule counts on both the primary and lateral roots were recorded for each treatment on days 12, 15, 18, and 21 after the soybean seed inoculation. The experiment was replicated 5–9 times, and a statistical analysis comparing nodulation counts on the primary and lateral roots between the different NaCl concentrations was performed using Welch’s t-test.
Effects of NaCl on soybean isoflavone secretionTo prepare soybean seedlings, approximately 50 mL of vermiculite was added to a 50-mL conical tube, followed by 20 mL of distilled water. The tube was covered with aluminum foil and autoclaved at 121°C for 20 min. Sterilized soybean seeds were individually sown, and the surface was covered with vermiculite. Soybean cultivation was conducted in a plant growth chamber under the conditions of 16 h of light at 28°C and 8 h of darkness at 23°C for 5–7 days after sowing. Seedlings were then collected from the tubes and vermiculite was carefully removed in pure water. The three soybean seedlings were submerged in a 50-mL conical tube containing 40–45 mL of 1/4 strength N-free hydroponic solution containing 0 or 50 mM NaCl and cultivated under the same conditions in the plant growth chamber for 48 h. After cultivation, the hydroponic solution was collected for isoflavone measurements. Isoflavones were extracted following the method described by Sugiyama et al. (2016). Briefly, the hydroponic solution was adjusted to pH 3.0 with hydrochloric acid, filtered through a 0.45-μm DISMIC filter (Advantec), supplemented with 6-methoxyflavone as the internal standard, and then made up to 100 mL. The solution was then passed through a Sep-Pak C18 Plus short cartridge (Waters), followed by elution with methanol to recover isoflavones. Isoflavones were concentrated under nitrogen gas, dried, and re-dissolved in methanol. Isoflavones were quantitatively analyzed using HPLC (LC20AD; Shimadzu) with CAPCELL PAK C18 MGII S5 4.6×250 mm (SHISEIDO) and UV detection at wavelengths of 254 and 260 nm. The column temperature was maintained at 40°C and the flow rate was set to 1.0 mL min–1. The methanol concentration gradient was programmed as follows: 50–60% from 0 to 20 min, 60–80% from 20 to 40 min, 80–95% from 40 to 41 min, 95% from 41 to 43 min, and 95–50% from 43 to 55 min. The peak areas of isoflavones were normalized using the peak area ratio of the internal standard, and isoflavone contents were measured. Dry weight measurements of the soybean roots utilized for isoflavone secretion were also performed. Isoflavone secretion was evaluated per unit dry weight and per individual plant. The experiment was replicated 5 times, and a statistical analysis of isoflavone levels between different NaCl concentrations was performed using Welch’s t-test.
Effects of NaCl on nodC gene expression in rhizobiaTo examine the effects of NaCl on nodC gene expression, three strains of rhizobia (B. diazoefficiens USDA110T, B. elkanii USDA31, and S. fredii USDA191) were used. NaCl concentrations were adjusted to 0, 30, and 100 mM in the medium for the analysis of nodC expression (Shiro et al., 2016; Nitawaki et al., 2021). In the nodC gene expression analysis in rhizobia, we used the housekeeping genes sigA and gyrB as reference genes (Beck et al., 1997; Rocha et al., 2015). Following the method by Shiro et al. (2016), the three rhizobial strains derived from YMA plates were inoculated in HEPES-MES (HM) liquid medium containing arabinose (Cole and Elkan, 1973; Sameshima et al., 2003) and then cultured in the dark at 28°C with continuous agitation at 120 rpm. S. fredii was cultured for 3 days, while Bradyrhizobium strains were cultured for 5 days until reaching a stationary phase with a concentration of 108 cells mL–1. According to Shiro et al. (2016), a 50-mL aliquot of the culture was mixed with 50 mL of fresh HM liquid medium containing daidzein or genistein at a concentration of 10 μM and NaCl at concentrations of 0, 60, and 200 mM (final concentration of isoflavones: 5 μM, NaCl: 0, 30, and 100 mM). Cultures were incubated with shaking at 100 rpm at 28°C under dark conditions for 24 h. Following the incubation, the bacterial suspension was centrifuged at 4°C and 9,000 rpm for 5 min using a refrigerated centrifuge to collect the rhizobial precipitate, followed by RNA extraction. RNA extraction was performed using ISOGEN (Nippon Gene) after the addition of 1 μL of a recombinant RNase inhibitor (Takara Bio) and drying RNA in a vacuum concentrator, followed by dissolution in 20 μL of RNase-free dH2O. Genomic DNA was eliminated using Recombinant DNaseI (Takara Bio) according to the protocol, and cDNA was synthesized using PrimeScript RT (Takara Bio) following the established protocol. Real-time PCR (denaturation at 95°C for 5 s and extension at 63°C for 30 s; 50 cycles) was performed using the Thermal Cycler Dice Real-Time System TP800 (Takara Bio) with specific primers for each gene (Table 1) and Luna Universal qPCR Master Mix (New England Biolabs). The specificity of PCR products was confirmed by denaturation at 95°C for 15 s and annealing at 60–95°C (Lang et al., 2008). The experiment was replicated 5 times. The relative expression levels of the nodC gene in the isoflavone-treated group were compared to those in the untreated group for each NaCl treatment using Dunnett’s test (Pfaffl, 2001; Livak and Schmittgen, 2001). Furthermore, Dunnett’s test was performed to assess the significance of differences between each NaCl treatment and the 0 mM NaCl control group. This approach enabled us to evaluate the effects of NaCl stress on nodC gene expression induced by two types of isoflavones.
Primers for qRT-PCR targeting the nodC gene in rhizobia
| Target gene | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| nodC for Bradyrhizobium diazoefficiens | TGGACGGGATTGACGATTG | GTGTGGAGCGAGAAGCCG |
| nodC for Bradyrhizobium elkanii | TGGACGGTGCTGACGATTG | TGTGAAGCGAGAAGCCGAG |
| nodC for Sinorhizobium fredii | GTCGACGATCCTGATGATTGC | TGTGCAGCGAAAACCCAAG |
| sigA | GCATGTATCTGCGCGAGATG | TCGTCGCGCCAGATGA |
| gyrB | CTGCGCGGCAAGATCC | GGTGATCAGCGTGCCGA |
To evaluate the salt tolerance of rhizobia, the colony area on YMA plate medium with adjusted pH and NaCl concentrations was examined (Mukherjee and Samaddar, 1997; Djedidi et al., 2011). The pH of the medium (pH 5.0, 6.8, and 9.0, adjusted with 0.5 M HCl and 0.5 M NaOH) and NaCl concentrations (0.01, 0.1, 0.3, 0.5, 0.7, and 0.9%) were adjusted in YMA medium. After culturing on YMB medium, bacterial density was measured under a microscope and adjusted to 106 cells mL–1 with sterile water. Thereafter, 0.7 μL of the adjusted bacterial suspension was spotted onto YMA medium and cultured in the dark at 28°C. After an incubation for 240 h, colony areas were measured using ImageJ (https://imagej.net/ij/) and the relative area ratios of rhizobial colonies were evaluated against the colony area on YMA medium containing 0.01% NaCl as the control. Cultures were triplicates for pH 6.8 and six replicates for pH 5 and 9, and a statistical analysis was performed using Dunnett’s test.
Statistical analysisStatistical analyses were conducted using R v.4.1.1 (R Core Team: https://www.R-project.org/).
The present study investigated the effects of salt (NaCl) on the nodulation process mediated by the three rhizobial strains using soybean variety CNS. Fig. 1A, B, and C show the results obtained on nodule numbers. Following the USDA110T inoculation (Fig. 1A), mature nodule numbers were significantly lower 12 and 15 days after inoculation (DAI) under the 50 mM NaCl treatment than under the control treatment (0 mM NaCl). However, no significant difference was observed by 18 and 21 DAI, with almost equal nodule numbers being counted. Conversely, the number of immature nodules under the 50 mM NaCl treatment was similar to that under the control treatment. Following the USDA31 inoculation (Fig. 1B), the numbers of mature and immature nodules at each time point post-rhizobial inoculation under the 50 mM NaCl treatment were similar to those under the control treatment. Following the USDA191 inoculation (Fig. 1C), the number of mature nodules was significantly higher at 12, 18, and 21 DAI under the 50 mM NaCl treatment than under the control treatment. However, no significant differences were observed in the number of immature nodules at any DAI between both treatments.
Mature and immature root nodule numbers on soybean hosts inoculated with rhizobia under saline conditions: (A) Bradyrhizobium diazoefficiens USDA110T, (B) Bradyrhizobium elkanii USDA31, and (C) Sinorhizobium fredii USDA191.
Data are shown as the mean±S.D. (n=3–5), with asterisks indicating significant differences in Welch’s t-test (*: P<0.05, **: P<0.01).
Fig. 2 shows the results of nodule formation on the primary and lateral roots on 12–21 DAI. Based on the results shown in Fig. 2, following the USDA110T inoculation, the number of nodules on primary roots was significantly lower on 15, 18, and 21 DAI under the 50 mM NaCl treatment than under the control treatment (Fig. 2A). However, following the USDA31 inoculation, the number of nodules on the primary roots was similar under both treatments (Fig. 2B). Following the USDA191 inoculation, the number of nodules on the primary roots on 15 and 18 DAI was significantly higher under the 50 mM NaCl treatment (Fig. 2C). Nodule numbers on the lateral roots also slightly increased under the 50 mM NaCl treatment.
Nodule numbers on primary or lateral roots of host soybeans inoculated with rhizobia under saline conditions: (A) Bradyrhizobium diazoefficiens USDA110T, (B) Bradyrhizobium elkanii USDA31, and (C) Sinorhizobium fredii USDA191.
Data are shown as the mean±S.D. (n=5–7), with asterisks indicating significant differences in Welch’s t-test (*: P<0.05, **: P<0.01).
Fig. 3 shows the results obtained on the concentrations of isoflavones secreted from the roots of CNS in the absence of rhizobial inoculations. A comparison of the amounts of two isoflavones, daidzein and genistein, using 5-day-old seedlings showed low levels of secretion (0.66–1.17 nmol daidzein plant–1 and 0.20–0.22 nmol genistein plant–1), with no significant differences under the control and NaCl treatments (data not shown). However, in the experiment using 7-day-old seedlings, the secretion of daidzein increased under the control treatment, whereas a significant decrease in daidzein secretion was observed under the NaCl treatment (Fig. 3A). In contrast, the secretion of genistein was lower than that of daidzein, with levels ranging from 58–68 nmol (g root DW)–1, and no significant difference was observed due to the NaCl treatment (Fig. 3B). Despite a 28-fold difference between daidzein and genistein secretion under the control treatment, the decrease in daidzein secretion under to the NaCl treatment resulted in a difference in concentrations of less than 5-fold.
Effects of NaCl treatments on isoflavone secretion from soybean roots: (A) daidzein, and (B) genistein.
Data are shown as the mean±S.D. (n=3–5), with asterisks between NaCl treatments indicating significant differences in Welch’s t-test (*: P<0.05).
Changes in nodC expression under various NaCl concentrations were examined. Similar expression levels were obtained in both correction results, despite large differences in variability (Fig. 4). In B. diazoefficiens USDA110T, the significant up-regulation of nodC expression was observed in the nodC/gyrB expression under the control with genistein treatment. nodC/sigA expression increased with the genistein treatment, similar to nodC/gyrB expression (Fig. 4A). However, a significant decrease was observed in nodC/gyrB expression with the genistein treatment as NaCl concentrations increased. Although no significant difference was noted, a similar decrease was observed in nodC/sigA expression (Fig. 4A). In contrast, relative expression levels in the daidzein treatment zone increased regardless of the NaCl concentration; however, no significant changes were noted in expression levels under the different NaCl treatments, similar to the genistein treatment. In B. elkanii USDA31, the NaCl treatments had no significant effect on expression levels (Fig. 4B). nodC gene expression in response to the isoflavone treatment showed no significant difference in the control. However, nodC expression with the daidzein treatment was significantly higher under the 30 mM and 100 mM NaCl treatments than under the control treatment in nodC/sigA expression. Although there was no significant difference, nodC/gyrB expression with the daidzein treatment was similar to nodC/sigA expression. In S. fredii USDA191, nodC/gyrB expression significantly increased with both the genistein and daidzein treatments, and similar changes were detected in nodC/sigA expression (Fig. 4C). However, nodC expression with the daidzein treatment significantly decreased with increases in the concentration of NaCl in both sigA and gyrB corrections. On the other hand, no significant decrease in expression was observed in either correction zone with the genistein treatment. The results obtained from the nodC expression analysis of rhizobia indicated similar outcomes in both corrections based on the sigA and gyrB genes, showing different reactions to varying NaCl concentrations depending on the strain of bacteria and the type of isoflavone.
Relative expression of the nodC gene in soybean rhizobia at each NaCl concentration.
The values represent the expression levels of the nodC gene in the presence of an isoflavone (5 μM) relative to those of the control at each NaCl concentration in the medium. Data are shown as the mean±S.E. (n=5). Expression levels were normalized to the housekeeping genes sigA and gyrB. In multiple comparisons, Dunnett’s tests were conducted using the absence of an isoflavone at each NaCl concentration as the control and between NaCl concentrations using 0 mM NaCl as the control for relative expression levels. ・ and * in the bar indicate a significant difference from the control, and ・ and * between bars indicate a significant difference from the control (・: P<0.1, *: P<0.05).
The results obtained on the NaCl tolerance of rhizobia on YMA medium are shown in Fig. 5. Colony growth by all strains was inhibited under the NaCl treatments; however, NaCl tolerance varied among the strains. B. diazoefficiens USDA110 showed tolerance up to 0.5% NaCl at pH 5–6.7, but did not grow at 0.3% NaCl and pH 9 (Fig. 5A). B. elkanii USDA31 exhibited broad tolerance, showing resistance up to 0.7% NaCl at pH 5 and up to 0.5% NaCl at pH 6.8–9 (Fig. 5B). S. fredii USDA191 displayed different characteristics from bradyrhizobia, showing no growth at pH 5. It exhibited tolerance up to 0.3% NaCl at pH 6.8 and up to 0.9% NaCl at pH 9 (Fig. 5C).
Salt tolerance of rhizobia on YMA medium.
Colony areas after an incubation for 240 h were evaluated against the colony area on YMA medium containing 0.01% NaCl as the control. Data are shown as the mean±S.D. (n=3–6). * in the bar indicates a significant difference from the control (Dunnett’s test, *: P<0.05).
We herein examined the effects of a NaCl treatment on the nodulation process of the soybean variety CNS by three rhizobial strains (B. diazoefficiens USDA110T, B. elkanii USDA31, and S. fredii USDA191). Regarding bradyrhizobia, mature nodule formation by USDA110T showed an approximately 3-day delay under the 50 mM NaCl treatment (Fig. 1A), while the NaCl treatment did not affect nodulation by USDA31 (Fig. 1B). Conversely, the NaCl treatment facilitated mature nodule formation by USDA191 (Fig. 1C). Our previous study on nodulation dominance by these three rhizobial strains in mixed inoculation experiments revealed differences in nodulation dominance under NaCl treatments (Nitawaki et al., 2021). Specifically, the nodulation occupancy of strain USDA191 significantly increased at higher NaCl concentrations, whereas that of USDA110T significantly decreased. Other studies noted the prevalent nodulation of Sinorhizobium spp. in alkaline soils in Okinawa and Vietnam as well as in saline-accumulated soils in China and Brazil (Saeki et al., 2005; Suzuki et al., 2008; Han et al., 2009; Li et al., 2011). The present results suggest that the high nodulation rate of S. fredii under saline conditions contributes to its dominance of nodulation in saline-alkaline soils. Tu (1981) and Duzan et al. (2004) reported that NaCl stress reduced the responsiveness of soybean root hairs to rhizobial Nod factors. Therefore, in the USDA110T inoculation, the recognition of a USDA110T-synthesized Nod factor by CNS root hairs may have been reduced under NaCl treatment conditions, which may have delayed nodulation. However, in the case of the USDA191 inoculation, the responsiveness of soybean root hairs to rhizobial Nod factors increased under the NaCl treatment, resulting in distinct effects of NaCl on soybean root hair recognition of Nod factor between the USDA191 and USDA110T inoculations. Consequently, the effects of NaCl on soybean root hair recognition of Nod factor appeared to be less pronounced than those on the rhizobial recognition of soybean isoflavones. Although this issue warrants further study, it may be due to differences in the structures of Nod factors produced by rhizobia. Strain USDA110T synthesizes a single-structure Nod factor, whereas USDA191 produces multiple Nod factors (D’Haeze and Holsters, 2002). There may be advantages to synthesizing multiple Nod factors for nodulation under saline conditions.
We noted a decrease in daidzein secretion under the 50 mM NaCl treatment (Fig. 3A). This result was similar to the findings of Dardanelli et al. (2010) showing that a NaCl treatment inhibited the secretion of daidzein and the intermediate naringenin from soybean roots. Therefore, the reduced secretion of daidzein from CNS roots may be due to the effects of NaCl on the generation and subsequent secretion of isoflavones. Conversely, although genistein secretion levels were lower than those of daidzein, no discernible effect of NaCl on genistein secretion was observed (Fig. 3B). USDA110T exhibited high responsiveness to genistein, leading to a significant increase in nodC expression under the control treatment. However, responsiveness to daidzein was lower than that to genistein under the control treatment. The response to genistein decreased under the NaCl treatments (Fig. 4A), leading to the significant inhibition of nodC gene expression. This result suggested that the synthesis of Nod factors was suppressed, thereby delaying infection of the host soybean (Fig. 1A and 2A). Regarding USDA31, although the significant expression of nodC/sigA under the daidzein treatment was not observed with the control treatment, nodC gene expression was generally efficient regardless of the NaCl treatment (Fig. 4B). Additionally, the response to genistein was weaker than that to daidzein; however, the increase in nodC gene expression remained unchanged with the NaCl treatment. Therefore, the delay in rhizobial infection due to the NaCl treatment was not significant (Fig. 1B and 2B). Following the USDA31 inoculation, more nodules formed on the lateral roots than on the primary roots regardless of the presence of NaCl (Fig. 2B). In a previous study (Nitawaki et al., 2021), when a mixed inoculation of these three strains (USDA31, USDA110T, and USDA191) was performed, the nodulation occupancy of USDA31 was markedly lower than those of the other two strains. These results indicate that infection by USDA31 was not affected by NaCl; however, its infectivity was lower than that by the two other strains under the culture conditions employed. The response of strain USDA191 to daidzein was significantly weaker than that of other rhizobia as the NaCl concentration increased, while its response to genistein remained unchanged (Fig. 4C). Therefore, despite the decrease in daidzein secretion from soybean roots, the expression of nod genes remained unaffected due to the stable secretion of genistein. In contrast to USDA110T, the sustained high expression of nod genes by genistein in USDA191 resulted in the maintenance of infectivity. Consequently, infection by USDA191, which maintained the expression of genistein-inducible nod genes under the NaCl treatment, appeared to be stronger than that by USDA110T, leading to an increase in nodulation occupancy. These results show the changes in isoflavone secretion from soybeans and the responses of rhizobia to genistein and daidzein under saline conditions, and offer insights into the mechanisms underlying the high nodulation occupancy of S. fredii in saline soils.
The results obtained on the NaCl tolerance of rhizobia on YMA medium under three pH conditions (Fig. 5) were attributed to Bradyrhizobium being alkali-producing bacteria and Sinorhizobium being acid-producing bacteria on YM medium (Suzuki et al., 2008). Additionally, the present results indicate that the survivability of USDA191 was inferior under acidic conditions and superior under saline-alkaline conditions to Bradyrhizobium (Fig. 5). Since the pH range in the culture pots used for soybean cultivation was 6.8–7.0, and 50 mM NaCl was approximately 0.3% NaCl, the salt tolerance of USDA191 on the medium does not serve as evidence for the superiority of USDA191 in nodule formation under saline conditions in this study. However, nodule formation by S. fredii was observed even under the culture conditions employed herein, indicating that its characteristics on medium differ from the actual rhizobial ecology in soil and the soybean rhizosphere. S. fredii has a high nodule occupancy rate in soybean cultivation under saline-alkaline conditions and is dominant in saline-alkaline soils (Saeki et al., 2005; Suzuki et al., 2008; Han et al., 2009; Li et al., 2011), suggesting that its salt tolerance on medium is one of the physiological characteristics that allow it to dominate in saline-alkaline soils.
In the present study, we focused on isoflavone concentrations in 7-day-old seedlings and analyzed nodC gene expression 24 h after the isoflavone treatment. Therefore, the results of this study alone cannot fully explain the significant increases observed in the rate of nodule formation and the number of primary root nodules (Fig. 1C and 2C). In another study on different rhizobia, such as Rhizobium tropici CIAT899, the expression of nodulation genes was observed in response to a NaCl treatment even without nod gene inducers (Guasch-Vidal et al., 2013). Therefore, S. fredii may up-regulate nod gene expression under saline conditions, even in the absence of isoflavones. More detailed studies, such as time-course analyses of isoflavone secretion from roots and nod gene expression in response to salt or isoflavone treatments, are necessary to further explore this aspect. Although additional research is needed to understand the promotion of S. fredii nodulation under saline-alkaline conditions, the present study has provided insights into the mechanisms by which soybean infection by S. fredii is superior to Bradyrhizobium under saline conditions.
Nitawaki, Y., Yasukochi, T., Naono, S., Yamamoto, A., and Saeki, Y. (2024) Effects of NaCl Treatment on Root Nodule Formation, Isoflavone Secretion in Soybean, and Nodulation Gene Expression in Rhizobia. Microbes Environ 39: ME24023.
https://doi.org/10.1264/jsme2.ME24023
We thank Dr. Akifumi Sugiyama for his important advice regarding the isoflavone analysis. This study was supported by JSPS KAKENHI Grant Numbers 21KK0103 and 22K05369, and by the Microbiome and Metabolome Control Project, University of Miyazaki, Japan.
