The Journal of Toxicological Sciences
Online ISSN : 1880-3989
Print ISSN : 0388-1350
ISSN-L : 0388-1350
Letter
Effect of gestational cadmium exposure on fetal growth, polyubiquitinated protein and monoubiqutin levels in the fetal liver of mice
Hisaka KuritaTatsuya HasegawaYoshiyuki SekoHisamitsu NagaseMaki TokumotoJin-Yong LeeMasahiko Satoh
著者情報
ジャーナル フリー HTML

2018 年 43 巻 1 号 p. 19-24

詳細
Abstract

Cadmium (Cd) is an environmental pollutant present in contaminated water, food and soil. Cd adversely affects fetal development. We exposed pregnant mice to daily oral doses of 5 and 10 mg/kg Cd and examined fetal growth. It was demonstrated that the exposure to Cd (10 mg/kg) during gestation caused fetal growth retardation (FGR). Investigation of the ubiquitin-proteasome system in fetal livers of mice exposed to gestational Cd revealed increased polyubiquitinated protein accumulation, contrasting with decreased levels of monoubiquitin protein. Moreover, the expression level of Ubc (encoding polyubiquitin C protein) was significantly decreased in 5 and 10 mg/kg Cd-treated groups in comparison with the control group. Therefore, we propose that decrease of monoubiquitin level and accumulation of polyubiquitinated protein in the fetal liver may be important factors in Cd-induced FGR.

INTRODUCTION

Cadmium (Cd) is an environmental pollutant found in contaminated water, food and soil (Järup and Akesson, 2009). Cadmium is also present in tobacco smoke, and humans are exposed to Cd daily in food or tobacco smoke (Henson and Chedrese, 2004). Exposure to Cd causes disruption of gene expression and toxic effects on several tissues, such as liver, kidney, lung, bone and reproductive organs (Satoh et al., 2002; Zalups and Ahmad, 2003; Honda et al., 2010a, 2010b; Lee et al., 2013; Tokumoto et al., 2013). The risk for Cd-induced toxicity is elevated during pregnancy. In some epidemiological studies, the maternal body burden of Cd was associated with low birth weight (Nishijo et al., 2004; Tian et al., 2009; Kippler et al., 2012) or low birth height (Nishijo et al., 2002; Zhang et al., 2004). In studies using rats, Cd absorption from the gastrointestinal tract was increased during pregnancy (Leazer et al., 2002), and maternal Cd exposure during gestation was related to fetal death (Ferm, 1971; Rohrer et al., 1979; Levin and Miller, 1980), decreased fetus numbers (Samarawickrama and Webb, 1981; Barański et al., 1982) and fetal growth retardation (FGR) (Hastings et al., 1978; Rohrer et al., 1979; Barański et al., 1982; Barański, 1987). Cadmium induced morphological toxicity in maternal vasculature and necrosis of trophoblastic cells (Levin et al., 1981). Growth of the fetal liver is important for mouse embryonic survival, because hematopoietic stem cells (HSCs) increase in the fetal liver during embryonic days 12-16 (Ikuta and Weissman, 1992; Morrison et al., 1995; Ema and Nakauchi, 2000), then migrate to the spleen and bone marrow (Morrison et al., 1995). Our recent study has revealed that gestational Cd exposure changes gene expression in the mouse fetal liver (Kurita et al., 2016).

Previous studies showed that Cd disturbed the ubiquitin-proteasome system (UPS) in several cell lines (Tokumoto et al., 2011; Yu et al., 2011; Du et al., 2014; Lee et al., 2016). Furthermore, Cd changes the activities of transcription factors involved in the transcription of UPS-related genes (Tokumoto et al., 2014). UPS plays an important role in maintaining the quality and homeostasis of proteins. In the UPS process, a target protein is tagged with ubiquitin, and the ubiquitinated protein is degraded in proteasome complexes (Amm et al., 2014). Three different enzymes regulate UPS. Ubiquitin activating enzyme (E1) forms a covalent bond between the C-terminal of ubiquitin and a cysteine residue of its active site. The ubiquitin residue is transferred to ubiquitin-conjugated enzyme (E2). Subsequently, ubiquitin ligase (E3) bonds both the E2-ubiquitin complex and target protein, allowing ubiquitin to bind to the target protein. Eventually, a proteasome recognizes and degrades the polyubiquitinated protein.

The association of Cd-induced FGR with UPS in the fetal liver has not been completely investigated. Therefore, we examined the effect of Cd on the level of polyubiquitinated proteins, using fetal livers of mice exposed to Cd during gestation.

MATERIALS AND METHODS

Animals and treatment

C57BL/6J mice were a generous gift from Dr. C. Tohyama, The University of Tokyo. Animals were maintained in a controlled temperature and humidity environment of 12/12-hr light/dark cycles. All animals were given free access to rodent chow and water. The present experiments were performed in accordance with the Guidelines for Animal Experiments of the Gifu Pharmaceutical University. Nulliparous female mice aged 8 weeks were housed with one male of the same strain overnight (approximately 24 hr). After the mating period, females were separated from the males and housed individually in plastic cages at gestational day 1 (GD1). Dams were separated into three groups: 5 and 10 mg Cd/kg treatment (n = 10 and n = 3, respectively) and control (n = 4) groups. Cadmium solution was prepared daily with CdCl2 (2.5-hydrous powder, purity 99.9%, Wako Pure Chemical Industries, Osaka, Japan) in distillated water for oral administration. A daily single dose of Cd solution was orally administered to the pregnant mice from GD1 to GD18. A control group was treated with distilled water for the same period and by the same route. At GD19, pregnant mice were deeply anesthetized with ether, and fetal livers were removed and pooled for each litter. Fetuses were not divided into male and female in all experiments. Samples were quick-frozen and stored at −80°C.

Determination of Cd accumulation in fetal liver

Aliquots of the fetal livers were weighed and digested with nitric acid (Kanto Chemical Co, Tokyo, Japan). Tissues were heated until dried. The dried samples were heated again in nitric acid and hydrogen peroxide (Wako Pure Chemical Industries) until they were dried. The inorganic residues were dissolved in ultrapure water and metal analysis was performed by inductively coupled plasma mass spectrometry (ICP-MS; 4500, Agilent Technologies, Santa Clara, CA, USA).

Extraction of RNA

Total RNA was isolated from the fetal liver using the SV total RNA isolation system (Promega, Madison, WI, USA) according to the manufacturer’s protocol.

Reverse transcription and real time qPCR

One microgram aliquot of total RNA was reverse-transcribed by Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA) with Oligo (dT) 12 to 18 primer (Invitrogen) and dNTP mix (Invitrogen), in accordance with the manufacturer’s instructions. An aliquot of cDNA was used in real time qPCR using a SYBR Green Supermix (Bio Rad Laboratories, Hercules, CA, USA) and Light Cycler (Bio Rad Laboratories). Primer details are provided in Table 1. Hepatic gene expression was calculated as a ratio to β-actin mRNA expression.

Table 1. Primer sequences used for Ubc and β-actin for real time qPCR.
Gene name Sequence (5'-3') Product size (bp)
Ubc Forward accaccaagaaggtcaaacagg 89
Reverse cacacccaagaacaagcacaa
β-actin Forward gatctggcaccacaccttc 138
Reverse ggggtgttgaaggtctcaaa

Western blot analysis

An aliquot of fetal liver was homogenized in RIPA buffer and sonicated. After samples were centrifuged, supernatants were collected and protein concentrations measured. Samples were heated at 95°C for 5 min and diluted with 5 × sodium dodecyl sulfate (SDS) sample buffer. Fifty micrograms of protein was used for SDS-polyacrylamide gel electrophoresis (SDS-PAGE). For separating high molecular weight proteins, we used the Laemmli SDS-PAGE method. Briefly, acrylamide gels were prepared with two layers for stacking and separating protein samples, which were electrophoresed using a glycine-based buffer and 40 mA for 1 hr. To separate small molecular weight proteins (approximately 6 kDa), we used the Tricine SDS-PAGE method (Schägger and von Jagow, 1987). We prepared acrylamide gels with three layers for stacking, spacing and separating the sample proteins, which were electrophoresed using two buffers [anode buffer: 0.1 M Tris-HCl pH 8.9 (Nacalai Tesque Inc., Kyoto, Japan), cathode buffer: 0.1 M Tris, 0.1 M Tricine (Nacalai Tesque Inc), 0.1% SDS (Nacalai Tesque Inc.)] and 10 mA for 15 hr. Gels were blotted to Immun-Blot PVDF membrane (Bio Rad Laboratories) at 90 mA for 30 min. The blotted membrane was incubated in 5% skim milk (BD Biosciences, San Jose, CA, USA) at room temperature for 1 hr. Primary antibody, anti-ubiquitin mouse monoclonal IgG (1:500, Santa Cruz Biotechnology, Santa Cruz, CA, USA) was applied and incubated at 4°C overnight. The second antibody, anti-mouse goat polyclonal IgG HRP conjugated (1:1000, Santa Cruz Biotechnology), was applied at room temperature for 1 hr. The antigen-antibody complexes were visualized with a 0.02% DAB solution (Nacalai Tesque Inc.).

Statistical analysis

Data were expressed as mean ± S.D. Statistical comparisons were performed using one-way ANOVA followed by a Bonferroni’s test.

RESULTS AND DISCUSSION

To determine if Cd exposure induced FGR in mice, we exposed pregnant C57BL/6J mice to Cd and measured fetal body weights and lengths. No dead fetuses were observed in any experimental groups. The body weight and length of pups were significantly decreased by 10 mg/kg Cd administration in comparison with those of vehicle and 5 mg/kg Cd exposed groups (Fig. 1). However, Cd concentrations in fetal liver after gestational exposure exhibited increasing tendency without significant differences (Fig. 2). Several previous studies showed that Cd disturbed UPS in several cell lines (Tokumoto et al., 2011; Yu et al., 2011; Du et al., 2014; Lee et al., 2016). Therefore, we investigated whether gestational Cd exposure disrupted whole UPS in the fetal liver. Western blot analysis showed that gestational Cd exposure increased the level of polyubiquitinated proteins and decreased monoubiquitin proteins (Fig. 3).

Fig. 1

Effect of gestational Cd exposure on fetal mouse body weights and lengths. Body weight (A) and length (B) of fetuses from each pregnant mouse exposed to 0 (n = 4), 5 (n = 10) and 10 (n = 3) mg/kg Cd during gestation. A daily single dose of CdCl2 solution was orally administrated to the pregnant mice from GD1 to GD18. Body weight and length were measured on GD19. Body length was measured from crown to neck of tail. Body weight and length of fetuses were presented as averaging those per litter. Values are the means ± S.D. *P < 0.05.

Fig. 2

Cd levels in fetal mouse liver after gestational Cd exposure. Pregnant mice were exposed to 0 (n = 4), 5 (n = 10) and 10 (n = 3) mg/kg Cd during gestation. Fetal livers were pooled for each litter on GD19. Aliquots of the fetal livers were used for Cd analysis by inductively coupled plasma mass spectrometry. Values are the means ± S.D.

Fig. 3

Effect of gestational Cd exposure on the level of polyubiquitinated and monoubiquitin protein levels in fetal liver. Pregnant mice were exposed to 0 (n = 4), 5 (n = 10) and 10 (n = 3) mg/kg Cd during gestation. Fetal livers were pooled for each litter on GD19. Fifty micrograms of fetal liver protein from each group was used for western blot analysis. Laemmli SDS-PAGE separated the high molecular weight ubiquitinated proteins, and Tricine SDS-PAGE separated low molecular weight monoubiquitin proteins (approximately 6 kDa). The two blots were run using the same experimental conditions.

In our previous study, the expression of 1,669 genes was increased more than 2-fold, and the expression of 194 genes was decreased more than 50% in fetal liver by 5 mg/kg Cd exposure during gestation (Kurita et al., 2016). In the present study, fetal mice exposed to 10 mg/kg Cd exhibited FGR. Therefore, certain genes with expression altered by 5 mg/kg Cd exposure during gestation may be involved in Cd-induced FGR. Our previous microarray analysis showed that the expression of polyubiquitin coding gene, Ubc, was decreased in fetal liver by gestational Cd exposure (Kurita et al., 2016). In the current study, real time qPCR showed that the level of Ubc mRNA in fetal liver was significantly decreased by Cd exposure (Fig. 4). The Ubc gene encodes a polyubiquitin C protein which is cut into monoubiquitins (Kessler, 2013). Therefore, the decreased Ubc expression may be involved in the reduced monoubiquitin levels in fetal livers of mice exposed to Cd during gestation. In previous research, disruption of the Ubc gene leads to embryonic lethality and abnormal liver development in mice (Ryu et al., 2007; Park et al., 2013), which suggests Ubc has essential roles during fetal development. Taking these results together, we propose that decreased Ubc expression caused by Cd exposure impaired the development of fetal liver, which may be correlated with alteration of fetal growth. The disruption of UBC triggered cytotoxicity in HK-2 human proximal tubular cells, and Cd increased UBC mRNA levels in HK-2 cells (Lee et al., 2015). Moreover, polyubiquitin coding genes were reported to be stress-induced (Bond and Schlesinger, 1986; Fornace et al., 1989). We showed that Ubc mRNA levels and protein levels of monoubiquitin were both decreased by Cd exposure (Figs. 3 and 4). Therefore, the change in Ubc expression induced by Cd may vary between different tissues or cells.

Fig. 4

Effect of gestational Cd exposure on Ubc mRNA levels in fetal liver. Pregnant mice were exposed to 0 (n = 4), 5 (n = 10) and 10 (n = 3) mg/kg Cd during gestation. Fetal livers were pooled for each litter on GD19. The fetal liver expression level of Ubc mRNA was measured by real time qPCR. The Ubc mRNA levels were expressed as a ratio to β-actin mRNA expression. Values are the means ± S.D. *P < 0.05.

In the present study, polyubiquitinated protein level was increased by Cd exposure in parallel with Cd-induced fetal body weight and length change (Figs. 1 and 3). Our previous microarray analysis showed that the fetal hepatic expression of many UPS-related genes were increased by Cd exposure (Kurita et al., 2016). Therefore, several UPS-related proteins may be involved in the induction of ubiquitination of proteins. The accumulation of abnormal high molecular weight ubiquitinated proteins caused aberrant events such as apoptosis (Yu et al., 2011). Another possibility for Cd-induced FGR related to UPS disruption may involve the disruption of important proteins that maintain fetal growth. In fact, excessive polyubiquitinated protein accumulation followed by disruption of UPS leads fetal death in Rpn10 (19S proteasome subunit) mutant mice (Hamazaki et al., 2007). Therefore, disruption of UPS, such as overaccumulation of ubiquitinated proteins and decrease of monoubiquitin level, may be one of the critical mechanisms of Cd-induced FGR. To date, there are no reports describing the relationship between Cd-induced FGR and UPS. Our study has provided the first clue for a novel mechanism of Cd-induced FGR regulated by UPS. Further studies are required to confirm our results, and our global gene expression analysis would be helpful to define future directions to study the molecular mechanisms of Cd-induced FGR.

ACKNOWLEDGMENTS

This study was supported by Study of the Health Effects of Heavy Metals Organized by the Ministry of Environment, Japan.

Conflict of interest

The authors declare that there is no conflict of interest.

REFERENCES
 
2018 The Japanese Society of Toxicology
feedback
Top