2018 年 43 巻 1 号 p. 65-74
The use of midazolam in early stages of pregnancy has resulted in a high incidence of birth defects; however, the underlying reason is unknown. We investigated expression changes of the CYP3A molecular species and focused on its midazolam metabolizing activity from the foetal period to adulthood. CYP3A16 was the only CYP3A species found to be expressed in the liver during the foetal period. However, CYP3A11 is upregulated in adult mice, but has been found to be downregulated during the foetal period and to gradually increase after birth. When CYP3A16 expression was induced in a microsomal fraction of cells used to study midazolam metabolism by CYP3A16, its activity was suppressed. These results showed that the capacity to metabolize midazolam in the liver during the foetal period is very low, which could hence result in a high incidence of birth defects associated with the use of midazolam during early stages of pregnancy.
Midazolam and triazolam, drugs of the benzodiazepine family, are frequently used as sleeping medication or to induce anaesthesia. Benzodiazepines are reported to confer a high risk of teratogenic effects in foetuses when used during pregnancy (Wikner et al., 2007). These drugs are known to have a short half-life of 2 hr in human adults and are easily eliminated from the body (Eberts et al., 1981; Klotz et al., 1985; Handel et al., 1988). Specifically, they are rapidly metabolized into the 1’-OH or 4’-OH form, primarily by CYP3A4 in the human liver or CYP3A11 in the mouse liver (Kronbach et al., 1989; Thummel and Wilkinson, 1998; Hyland et al., 2009). It is currently unclear whether benzodiazepines are causally related to birth defects. We believe that these birth defects were caused by benzodiazepines accumulating at high concentrations in the foetus, owing to reduced benzodiazepine metabolism stemming from impaired CYP3A expression or function. Analysing the causal relationship between the use of benzodiazepines and birth defects may contribute to the proper use of benzodiazepines during pregnancy.
In testing our hypothesis, we identified the CYP3A molecular species expressed in the foetal mouse liver and studied its metabolizing activity on midazolam. There are various molecular species of mouse CYP3A, with various characteristics (Anakk et al., 2004; Nelson et al., 2004). In this study, we assessed CYP3A11, CYP3A13, CYP3A16, CYP3A25, CYP3A41, and CYP3A44. Mouse CYP3A11 is homologous to human CYP3A4 and is constitutively expressed in the liver of adult mice, wherein it plays a central role in drug metabolism (Sakuma et al., 2000; Li et al., 2009). CYP3A13 is upregulated in the small intestine and has important effects on drug metabolism in the gastrointestinal tract (Martignoni et al., 2006; Komura and Iwaki, 2011). Mouse CYP3A16 corresponds to human CYP3A7. It is highly expressed in the foetal stage, during which it is suggested to be involved in drug metabolism (Hart et al., 2009; Li et al., 2009). CYP3A25 is constitutively expressed in the liver of adult mice and is involved in metabolizing drugs and xenobiotic substances (Dai et al., 2001; Hart et al., 2009; Peng et al., 2012). Furthermore, CYP3A41 and CYP3A44 have been reported to be specifically expressed in female mice (Sakuma et al., 2000; Nelson et al., 2004; Hart et al., 2009).
In this study, we aimed to analyse the protein expression of mouse CYP3A species; hence, we first generated models of forced expression of CYP3A11, CYP3A13, CYP3A16, CYP3A25, CYP3A41, and CYP3A44. Further, with each model of CYP3A species as indicators, we used western blotting to analyse levels of protein expression of CYP3A species in the liver at all stages from the foetal stage to adulthood, utilizing 2 types of antibodies. We also analysed the midazolam metabolizing activity of CYP3A species during the foetal period, as indicated by hydroxylation of midazolam in the 1’ position (Takenaka et al., 2017).
Midazolam was purchased from Wako Pure Chemicals (Osaka, Japan). α-Hydroxymidazolam solution, α-hydroxymidazolam-d4 solution and TRI reagent were purchased from Sigma-Aldrich Corp. (St. Louis, MO, USA). Zero Blunt TOPO PCR Cloning Kit was purchased from Invitrogen (Carlsbad, CA, USA). NADPH Regenerating System was purchased from Corning Inc. (Corning, NY, USA). TaKaRa Ex Taq, 10 × Ex Taq buffer, dNTP mixture and Trans IT-LT1 were purchased from Takara Bio Inc. (Shiga, Japan). High capacity cDNA synthesis kit was purchased from Applied Biosystems (Foster City, CA, USA). KOD Plus and KOD FX Neo were purchased from TOYOBO (Osaka, Japan). Rabbit anti-rat CYP3A2 antibody was purchased from Nosan Corporation (Kanagawa, Japan). Goat anti-mouse CYP3A antibody (L-14) was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Rabbit Anti-Goat IgG H&L (HRP) was purchased from abcam (Tokyo, Japan). Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey and enhanced chemiluminescence system (ECL) plus Western blotting detection reagents were purchased from GE Healthcare (Chalfont St. Giles, UK). All of the other reagents were of the highest commercially available grade.
Animal handlingPregnancy ICR mice (E12) and male and female mice (2, 4, 6, 8-week-old) were purchased from Japan SLC, Inc. (Tokyo Laboratory Animals Science Co. Ltd., Tokyo, Japan). The mice were kept at room temperature (24 ± 1°C) and 55 ± 5% humidity with 12 hr of light (artificial illumination; 8:00-20:00). Food and water were available ad libitum. Each animal was used only once. The present study was conducted in accordance with the Guiding Principles for the Care and Use of Laboratory Animals, as adopted by the Committee on Animal Research at Hoshi University.
Extraction of Total RNARNA was extracted from the mouse liver using the TRI reagent. A high-capacity cDNA synthesis kit was used to synthesize cDNA from 1 µg of RNA.
PCRTarget gene expression was analyzed with RT-PCR using the primers listed in Table 1. The following reagents were added to each well of the PCR 8 Strip Tube: 0.1 µL TaKaRa Ex Taq (TaKaRa Bio.), 2.5 μL of 10 × Ex Taq buffer, 2.0 μL dNTP mixture, 1.25 µL dimethyl sulfoxide (DMSO), 1 µL cDNA solution, 2.5 μL forward primer (20 pmol/µL), 2.5 μL reverse primer (20 pmol/µL) and 13.15 µL ultrapure water. Using a CFX Connect™ (Bio-Rad, Hercules, CA, USA), samples were first denatured at 94°C for 2 min and then at 98°C for 10 sec; then primer annealing was performed at 55 to 58°C for 30 sec, followed by elongation at 72°C for 30 sec. These steps constituted one cycle. After 30 to 35 cycles, an extension step was performed at 72°C for 1 min and 30 sec to amplify the cDNA.
| Target | Primer (5' to 3') | Product Size (bp) |
NCBI Reference Sequence |
|
|---|---|---|---|---|
| CYP3A11 | Forward | GAG GAG GAT CAC ACA CAC AGT TG | 324 | NM_007818.3 |
| Reverse | GTC TGT GAC AGC AAG GAG AGG CG | |||
| CYP3A13 | Forward | CCT CTG CCT TTC TTG GGG ACG AT | 192 | NM_007819.4 |
| Reverse | CCG CCG GTT TGT GAA GGT AGA GT | |||
| CYP3A16 | Forward | GGAGAATGCCAAGAAGGTTTTAAG | 1010 | NM_007820.2 |
| Reverse | GTTAAGCACCATTTCATCTTG | |||
| CYP3A25 | Forward | GTGGGATTCATGAAAAAGGCC | 898 | NM_019792.2 |
| Reverse | CTGGCCAGTACTCAGGATTTCGG | |||
| CYP3A41 | Forward | TTCTTCAGCTGATGATGAACG | 727 | AB033414.1 |
| Reverse | CAGCAGAACTCCTTGAGGGAAAC | |||
| CYP3A44 | Forward | GGAGGAAGCCAAAAAGTTTTTAAG | 518 | NM_177380.3 |
| Reverse | CTCTCTCAAGTCTAGTAAC | |||
After the PCR was completed, 5 μL of 6 x Loading Buffer Orange G (Nippon Gene, Tokyo, Japan) was added to the 25 μL PCR products, and the solution was mixed well. Agarose gel electrophoresis was performed with a 1.5% agarose gel and Tris acetate EDTA (TAE) buffer with 15 v of PCR product/lane at 25ºC for 30 min (Mupid-2 plus, TaKaRa-Bio). After electrophoresis, the agarose gel was soaked in EtBr solution (Nippon Gene), a nucleic acid stain solution, in the dark at 25ºC for 15 min. The agarose gel was photographed using a cooled CCD camera (LAS-3000mini, FUJIFILM Corporation, Tokyo, Japan). Intensities of each band were quantified by the Image J analysis software version 1.42q. (Wayne Rasband, NIH, USA) (Schneider et al., 2012).
Plasmid DNApEF-BOS were by inserting the XhoI mouse CYP3As cDNA fragment amplified by PCR into the SalI site of pEF-BOS (Mizushima and Nagata, 1990). The forward and reverse primers are listed in Table 2.
| Target | Primer (5' to 3') | Product Size (bp) |
NCBI Reference Sequence |
|
|---|---|---|---|---|
| CYP3A11 | Forward | TCT CGA GCT ACC ATG GAC CTG GTT TCA GCT CTC TCA | 1,533 | NM_007818.3 |
| Reverse | CTC GAG TCA TGC TCC AGT TAT GAC TGC ATC | |||
| CYP3A13 | Forward | TCT CGA GCT ACC ATG GAC CTG ATC CCA AAC TTT TCC | 1,530 | NM_007819.4 |
| Reverse | CTC GAG TCA TTC ATC ACT TAC AGT CTC ATC | |||
| CYP3A16 | Forward | TCT CGA GCT ACC ATG AAC CTA TTT TCA GCG CTC TCA | 1,533 | NM_007820.2 |
| Reverse | CTC GAG TCA CGC TCC AGT TAT GAC TGC ATC | |||
| CYP3A25 | Forward | TCT CGA GCT ACC ATG GAG CTC ATC CCC AAC CTT TCT | 1,530 | NM_019792.2 |
| Reverse | CTC GAG TCA TGA TCC AGT TCT GGG TTT ATC | |||
| CYP3A41 | Forward | TCT CGA GCT ACC ATG AAC CTG TTT TCA GCT CTC TCA | 1,533 | AB033414.1 |
| Reverse | CTC GAG TCA TGC TCC AGT TAT AAC TAC ATC | |||
| CYP3A44 | Forward | TCT CGA GCT ACC ATG AAC CTA TTT TCA GCT CTC TCA | 1,533 | NM_177380.3 |
| Reverse | CTC GAG TCA TGC TCC AGT TAT AAC TGC ATC | |||
In total, 1.0 x 105 COS7 cells were dispensed into a 6-cm dish, and after 24 hr, a method similar to transfection was carried out to transfect each vector with 2 µg of the plasmid containing the CYP3A gene. Twenty-four hours later, the culture medium was suctioned and cells were washed with 1 mL of PBS (-)3 times on ice. Three hundred microlitres of RIPA buffer (Tris-HCl, 25 mM; NP-40, 0.1%; NaCl, 150 mM; SDS, 0.1%; SDC, 0.1%; Protease Inhibitor Cocktail, 1%) was added, and cells were resuspended in a 1.5-mL microtube. The microtube was then vortex-mixed and sonicated for 1 min each, it was centrifuged at 21,500 g for 10 min at 4ºC, and the supernatant was collected. This solution was used as the standard protein of each CYP3A species.
Preparation of microsomal fractionOne millilitre of dissecting buffer (sucrose, 300 mM; imidazole, 25 mM; EDTA, 1 mM; Protease Inhibitor Cocktail, 1%) was added to the liver extracts and homogenized on ice. Nine-thousand grams of the homogenate was centrifuged for 20 min at 4ºC, and then 800 µL of the supernatant was collected, 105,000 g of which were centrifuged for 1 hr at 4ºC. After discarding the supernatant, an appropriate quantity (300 to 1,000 µL) of RIPA buffer was added to the pellet, which was dispersed with a sonicator and used as the microsomal fraction sample.
Protein concentration was measured by the bicinchoninic acid method, with BSA as the standard product.
SDS-PAGE and western blottingAn equivalent amount of sample buffer was added to the sample solution, mixed well, and boiled for 5 min at 95ºC. Further, electrophoresis was performed on 10% polyacrylamide gel (5.0 g/lane, 110 min, 20 mA). The proteins were then electroblotted onto a polyvinylidene difluoride (PVDF) membrane and blocking (skim milk, 5%; 10 min) was performed. Thereafter, the PVDF membrane was placed in a primary antibody solution (anti-rat CYP3A2 Ab 1/10,000; anti-mouse CYP3A Ab 1/500) for 1 hr at 25ºC. After washing well with TBS-Tween, the membrane was placed in a second antibody solution (donkey anti-rabbit IgG-HRP Ab 1/10,000; donkey anti-goat IgG-HRP Ab 1/2,000) for 1 hr at 25ºC. After washing the PVDF membrane with TBS-Tween, it was exposed to ECL prime western blot detection reagents. An image of the PVDF membrane was captured with a cooled CCD camera.
CYP3A activity assayThe expression vectors of each CYP3A species were transfected into the COS7 cells. After 24 hr, cells were harvested using a buffer (Tris-HCl, 10 mM; KCl, 1.5 mM; MgCl2, 1.5 mM; Protease Inhibitor Cocktail, 1%), and microsomal fractions were prepared. The activity of CYP3A, as indicated by the 1’ hydroxylation of midazolam, was evaluated. Buffer (potassium phosphate buffer, 0.1 mM; MgCl2, 3 mM; pH 7.4), the microsomal fractions (50 ng) of each CYP3A species, and midazolam (final concentration, 0.2 µM) were added to a 1.5-mL microtube and pre-incubated for 5 min at 37ºC. NADPH regeneration system A (Corning Inc.) was added to the reaction mixture and incubated for 60 min at 37ºC. The reaction was terminated with an equivalent quantity of a 4% aqueous phosphoric acid solution. The sample was pre-processed by solid phase extraction (SPE) columns Oasis HLB PRiME 3 cc (60 mg) (Waters, Milford, MA, USA). The SPE columns were washed with 1 mL of methanol and 500 µL of ultrapure water containing 2% phosphoric acid. The samples were applied to the SPE columns. The sample was washed with a 5% methanol/ ultrapure water solution, then eluted with a 1 mL of 90% acetonitrile/methanol. The solvent was distilled off under N2 reflux. Finally, it was redissolved in mobile phase. And liquid chromatog- raphy-mass spectrometry (LC-MS) was performed for qualitative analysis of midazolam metabolites (1’-OH-midazolam) (Takenaka et al., 2017).
LC-MS analysisLC-MS analysis was performed using a combination of an LC-20A high-performance liquid chromatography (HPLC) system (SIMADZU, Kyoto, Japan) and LCMS-2010 (SIMADZU). The analytical column that was used was an XBridge C18 (Waters). The analysis was performed at a column temperature of 40ºC. Ultrapure water containing 0.1% formic acid was used as mobile phase A. Acetonitrile containing 0.1% formic acid was used as mobile phase B. The analysis was performed in binary gradient mode, as shown below. (Gradient condition (% of B); 0.00 min 10%, 10.00 min 70%, 12.00 min 70%, 12.01 min 10%, 16.00 min 40%) The flow rate was constant at 0.2 mL/min.
For the interface, positive mode electrospray ionization (ESI) was used. The nebulizer gas flow rate was set at 1.5 L/min. The CDL and heat block temperatures were 250ºC and 200ºC, respectively. The voltage of the detector was set at 1.5 V. Measurement was performed by the selected ion monitoring (SIM) method based on an m/z value of 342 for 1’-hyrdroxymidazolam.
The LCMSsolution (SIMADZU) was used for HPLC system control and MS chromatogram analysis.
CYP is known to be expressed at different levels in male and female individuals. Thus, genomic DNA was extracted from the tails of mouse foetuses at each stage, and the sex-determining region Y (SRY) gene was used as an indicator to distinguish the sex (data not shown) (Nakagome et al., 1991). The forward and reverse primers are listed in Table 3. Thereafter, the expression of CYP3A species (CYP3A11, CYP3A13, CYP3A16, CYP3A25, CYP3A41, and CYP3A44) mRNA in the liver was quantified by RT-PCR for each mouse.

Experimental design of the study.
| Target | Primer (5' to 3') | Product Size (bp) |
NCBI Reference Sequence |
|
|---|---|---|---|---|
| SRY | Forward | CCA TGT CAA GCG CCC CAT GA | 132 | NC_000087.7 |
| Reverse | GTA AGG CTT TTC CAC CTG CA | |||
CYP3A13 was the predominantly expressed CYP3A species at the mRNA level. As for CYP3A species other than CYP3A13, CYP3A16 and CYP3A41 were expressed only slightly in the liver of female foetuses 13.5 days after embryo development. Expression levels of molecular species other than CYP3A13 began to increase between 1 and 14 days postpartum (Fig. 2).

Variations in mRNA expression of CYP3A species in the livers of mice in the course of their development. Total RNA was extracted from the liver of mice in the course of their development and the levels of CYP3A molecular species (CYP3A11, CYP3A13, CYP3A16, CYP3A25, CYP3A41, and CYP3A44) mRNA were quantified using RT-PCR. A: Male mice, B: Female mice. In addition, changes in expression levels are shown in a graph (C).
Using two types of commercially available antibodies (anti-rat CYP3A2 Ab) and anti-mouse CYP3A Ab (L-14) and the prepared standard proteins of the CYP3A molecular species, the CYP3A species in the microsomal fractions from the liver of the mice were identified by western blotting. Fig. 3 shows an example of the western blot of the liver of a 6-week-old (42 days postpartum) male mouse. Two primary bands were detected for anti-rat CYP3A2 Ab. When the migration of these bands was compared with that of the standard protein, the migration of the bands on the high-molecular-weight side matched that of the standard protein CYP3A11. Furthermore, the migration of the bands on the low-molecular-weight side matched that of the standard protein CYP3A13 or CYP3A25. Meanwhile, although CYP3A16, CYP3A41, and CYP3A44 were detected at a location between standard proteins CYP3A11 and CYP3A13, their levels were low in the microsomal fraction (Fig. 3A).

Identification of CYP3A species in the livers of 6-week-old male mice. CYP3A molecular species expressed in microsomal fractions prepared from the liver of 6-week-old male mice were analysed via western blotting, using CYP3A standard proteins and anti-rat CYP3A2 Ab (A) or anti-mouse CYP3A Ab (B).
In contrast with anti-rat CYP3A2 Ab, for anti-mouse CYP3A Ab, a single band matching the migration of the standard protein CYP3A11 was detected. Although this antibody was found to strongly detect CYP3A13, no bands corresponding to CYP3A13 were observed in the microsomal fraction of the liver. Moreover, this antibody weakly interacted with CYP3A16 and CYP3A25 (Fig. 3B).
Bands matching standard proteins CYP3A11 and CYP3A25 were present in the liver fractions of 6-week-old male mice.
Changes in expression patterns of CYP3A species in the liverBased on the characteristics of the CYP3A standard proteins and 2 types of antibodies, expression levels of CYP3A species proteins in the liver of mice were analysed using western blotting. The predominant species expressed in the liver of male mice during the foetal stage was CYP3A16, with the expression of other CYP3A species unable to be confirmed. Meanwhile, the predominant CYP3A species was CYP3A11 from 7 days postpartum, and CYP3A25 was also strongly expressed from day 28 postpartum (Fig. 4A, B). The expression patterns of CYP3A11, CYP3A16, and CYP3A25 are almost the same in the liver of female and male mice. In addition, CYP3A41 and CYP3A44, specific to female mice, was observed in the initial 28 days postpartum (Fig. 4C, D).

Changes in the amount of CYP3A expressed in the mouse liver at each stage. Changes in the amount of CYP3A molecular species expressed in microsomal fractions prepared from the livers of mice at different stages were analysed via western blotting by using (A) (C) anti-rat CYP3A2 antibodies, or (B) (D) anti-mouse CYP3A Ab (L-14) antibodies. A, B: Male mice, C, D: Female mice.
Since CYP3A16 was found to be the predominant CYP3A species expressed during the foetal stage, we investigated its metabolic activity on midazolam. We studied the metabolic activity of CYP3A16, as indicated by the quantity of the midazolam metabolite 1’-OH-midazolam produced. LC-MS analysis revealed a peak in 1’-OH-midazolam at a retention time of 9 min, and the molecular mass was 342.0. As shown in the LC-MS profile in Fig. 5B, CYP3A16 had low midazolam metabolizing activity. Notably, 1’-OH-midazolam was detected in the CYP3A11 sample used as a positive control (Fig. 5A).

Identification of 1’-OH-midazolam by LC-MS. The metabolic activity of standard proteins CYP3A11 (A) and CYP3A16 (B) on midazolam were analysed. Metabolic activities were measured and evaluated by LC-MS in accordance with the amount of 1’-OH-midazolam in the reaction solution.
This study focused on the increased risk of birth defects when benzodiazepine drugs containing midazolam are used during pregnancy. The authors formulated and tested the hypothesis that the cause of this increased risk to be the reduced expression and function of CYP3A molecules in the liver during the foetal stage.
The amino acid sequences of each of the CYP3A molecular species share high homology. Hence, we adequately confirmed that the primer used in the mRNA analysis did not bond non-specifically to molecular species other than the target. We generated expression vectors of the highly homologous CYP3A molecular species (CYP3A11, CYP3A13, CYP3A16, CYP3A25, CYP3A41, and CYP3A44), amplified them using PCR, and evaluated primer specificity (data not shown). Consequently, CYP3A13 was the predominant CYP3A species that was expressed at the mRNA level in the liver of mice during the foetal stage (Fig. 2).
Further, we attempted to analyse the protein levels of CYP3A molecular species expressed in the liver of mice during the foetal stage. Very few studies have analysed the protein levels of CYP3A molecular species in mice, and most analyses have been performed at the mRNA level. One possible reason for this is the protein-protein interactions among CYP3A species, which could have occurred during western blot analyses, owing to the high homology among the amino acid sequences. Thus, we attempted to prepare antibodies for each CYP3A species, but we were unable to prepare antibodies that could specifically identify them. Therefore, we generated an expression system of CYP3A molecular species, prepared CYP3A species standard proteins, and used these standard proteins and 2 commercially available anti-CYP3A antibodies to study the variation in expression of CYP3A species in the liver of mice from the foetal stage to 8 weeks of age.
The standard proteins of the CYP3A species were separated into three different mobilities using SDS-PAGE (Fig. 3). CYP3A species with almost identical molecular quantities differ in mobility probably because the positively charged amino acids such as lysine, arginine, and histidine decrease the migration rate in SDS-PAGE. When the ratio of lysine, arginine, and histidine of CYP3A molecular species were compared, CYP3A11 had the highest ratio, and hence CYP3A11 was detected at the highest on the high-molecular-weight side. The migration of the other species of CYP3A is thought to have changed for similar reasons.
In an mRNA-level analysis, no CYP3A16 mRNA was detected, and CYP3A13 mRNA was predominantly expressed during the foetal stage (Fig. 2). However, in a protein-level analysis, only CYP3A16 was expressed in the liver of both male and female mice during the foetal stage (Fig. 4). CYP3A16 mRNA is suggested to be expressed during the foetal period (Hart et al., 2009). However, in our analysis, CYP3A16 mRNA was not detected in the liver of male mice during the foetal stage and was transiently observed on day E13.5 in female mice. In addition, CYP3A16 mRNA was also transiently expressed in male mice postpartum (Fig. 2). These findings suggest that the expression of CYP3A16 mRNA oscillates in the liver during the foetal stage. Indeed, some CYP3A species exhibit oscillation in their expression (Sugihara et al., 2002; Takiguchi et al., 2007). We believe that this must be analysed in more detail. Meanwhile, post-transcription gene silencing is believed to occur in CYP3A13, but this issue is still unresolved, and must be analysed in detail in the future.
Furthermore, we used a standard protein of CYP3A16, the predominant CYP3A species expressed in mouse liver during the foetal stage, to determine whether it metabolizes midazolam. The results showed that CYP3A16 has very low metabolizing activity on midazolam. This suggested that midazolam is metabolized at a very low rate in the liver of mice during the foetal stage. Incidentally, CYP3A7 is predominantly expressed in the human liver during the foetal stage. Human CYP3A7 is also homologous with mouse CYP3A16, and its metabolizing activity on midazolam has been reported to be low, approximately 1/6 that of CYP3A4 (Sakuma et al., 2000; Vyhlidal et al., 2015). This must be analysed in detail in the future, but metabolic activity on midazolam is believed to be very low in humans during the foetal period as it is in mice. The fact that there is a postpartum increase in the molecular species capable of metabolizing midazolam, such as CYP3A11, suggests that accumulation of midazolam in neonates decreases.
In previous studies of CYP3A, the discussion is mostly based on mRNA-level analyses. Furthermore, in protein-level studies, the molecular species of CYP3A were analysed as CYP3As, without distinguishing them. However, the results of the present study showed that expression patterns and midazolam metabolizing activities differ greatly among the different molecular species of CYP3A. Therefore, we believe that the metabolic activities of CYP3A species in the body must be analysed at the protein level to accurately evaluate them.
In this study, the CYP3A molecular species expressed in the livers of foetal and adult mice were compared in terms of expression levels and metabolic activity at the protein level. The results showed that metabolizing activity on midazolam was significantly lower in the foetal-stage liver than in the adult liver. This is believed to be the reason birth defects develop in the foetus when midazolam is used during pregnancy. The results of this study can help contribute to the proper use of benzodiazepine drugs during pregnancy.
We thank Ms Misa Iizuka, Mr Osamu Kosaka, Ms Saori Tomita, Ms Tomoka Yasukawa and Mr Hiroyuki Yoshida (Department of Clinical Pharmacokinetics, Hoshi University) for their technical assistance. This work was supported by the MEXT-Supported Program for the Strategic Research Foundation at Private Universities 2014-2018 [MEXT, Grant S1411019]. We would like to thank Editage (www.editage.jp) for English language editing.
Conflict of interestThe authors declare that there is no conflict of interest.