The Journal of Toxicological Sciences
Online ISSN : 1880-3989
Print ISSN : 0388-1350
ISSN-L : 0388-1350
Original Article
Rosmarinic acid alleviates di-2-ethylhexyl phthalate (DEHP) -induced thyroid dysfunction via multiple inflammasomes activation
Haoyu Wu, Kun Ma, Xiaolin Na
著者情報
ジャーナル フリー HTML
電子付録

2020 年 45 巻 7 号 p. 373-390

詳細
Abstract

DEHP (di-2-ethylhexyl phthalate), an environmental endocrine disruptor, is widely used in industrial products, particularly as plasticizers and softeners which could disrupt the function of the hypothalamic-pituitary-thyroid (HPT) axis. Rosmarinic acid (RA) possesses potential antioxidant and anti-inflammatory capacities in disease models. Nevertheless, evidence on the association between DEHP-induced thyroid dysfunction and inflammation, as well as the molecular mechanism underlying the protective effects of RA-mitigated DEHP-induced thyroid injury remains inconclusive. Male Sprague Dawley (SD) rats were intragastrically administered DEHP (150 mg/kg, 300 mg/kg, 600 mg/kg) once a day for 90 consecutive days. Also, FRTL-5 cells were treated with a wide range of DEHP concentrations (10-8, 10-7, 10-6, 10-5, 10-4, 10-3, 10-2 M) for 24 hr. Subsequently, RA (50 μM) was administered for 24 hr before 10-4 M DEHP challenge. We found that DEHP induced thyroid damage and inflammatory infiltration in vivo. In addition, we showed that DEHP triggered inflammatory cell death, which is mediated by multiple inflammasomes. Moreover, RA, pyroptosis inhibitor (Ac-YVAD-cmk) and antioxidant inhibitor (NAC) treatment significantly alleviated DEHP-induced thyrocyte death, suppressing pro-inflammatory cytokine production, inhibiting multiple inflammasomes activation and attenuating thyrocyte death, respectively. Collectively, our results reveal that a critical role of inflammasomes activation in DEHP-induced thyroid injury, and suggest that RA confers protection against DEHP-induced thyroid inflammation, and facilitating control of the effects of DEHP after given pyroptosis inhibitor or antioxidant inhibitor. These results indicate that it should be possible to provide novel insights into toxicologically and pharmacologically targeting this molecule to DEHP-induced inflammation.

INTRODUCTION

Di-(2-ethylhexyl) phthalate (DEHP), the most common phthalate ester, is widely used in various consumer products such as food packaging, medical devices and toys, to impart flexibility and durability to polyvinyl chloride-based plastics (Gao and Wen, 2016). DEHP is not covalently bound to the plastic matrix and can be released from the substrates into the environment that endangers vertebrates’ health (Erythropel et al., 2014). The main routes of DEHP exposure include the intake of contaminated food, water and dermis (Net et al., 2015). As a widespread environmental pollutant and an endocrine disruptor, DEHP has been provoked extensive public concerns regarding its potential deleterious effects (Skinner, 2016). The thyroid is one of the primary and sensitive target organs of DEHP exposure (Kim et al., 2019a). Epidemiological and clinical data revealed that DEHP exposure results in aberrant expression or dysregulated function of inflammasomes inflammatory response and thyroid dysfunction (Engel et al., 2018). However, the molecular mechanisms of DEHP-induced thyroid inflammation have not been clearly identified.

Rosmarinic acid (3,4-dihydroxyphenyllactic acid, RA) is a natural polyphenol present in many herbal aromatic plants such as species of the Boraginaceae family, and has multiple potential therapeutic properties, possessing antioxidant and anti-inflammatory capabilities (Nunes et al., 2017). Accumulating evidence has demonstrated that RA exhibits safety, lack of toxicity and protective effect on the liver (Elufioye and Habtemariam, 2019), kidney (Zhang et al., 2015) and other tissues (Zhang et al., 2018; Luan et al., 2013), but the thyrotoprotective effect is still limited. According to the involvement of oxidative stress and inflammation in DEHP-induced thyroid injury (Mancini et al., 2016), RA may have potential therapeutic effects on the DEHP-induced thyrotoxicity (Habza-Kowalska et al., 2019). However, the molecular mechanism of RA to ameliorate DEHP-induced thyroid injury and inflammation remains needs to be studied.

Previous studies reveal that signaling involves in thyroid injury and inflammation (Panveloski-Costa et al., 2016; Guo et al., 2018). Inflammasomes are intracellular protein complexes that drive the activation of inflammatory Caspases (Broz and Dixit, 2016). Heretofore, four inflammasomes involving NLR family pyrin domain-containing 1 (NLRP1), NLR family pyrin domain-containing 3 (NLRP3), NLR family CARD (Caspase activation and recruitment domain) domain-containing protein 4 (NLRC4), are absent in melanoma 2 (AIM2) and have been described as recruiting the common adaptor apoptosis-associated speck-like protein (ASC) to activate Caspase-1, leading to the secretion of mature interleukin-1β (IL-1β) and interleukin-18 (IL-18) (He et al., 2016b). Activation of inflammasomes leads to proteolytical activation of the cysteine protease Caspase-1 and production of a tetramer of its two active subunits p20 and p10 (Ren et al., 2014). Therein, Caspase-1 p20 (considered as an indicator of inflammasome activity) mediates maturation of pro IL-1β and pro IL-18 (Du et al., 2019). In addition to Caspase-1, NLRP3 inflammasomes engage Caspase-8 as an essential effector of innate immune signaling responses, and Caspase-8 is activated within NLRP3 inflammasome signaling platforms (Antonopoulos et al., 2015). In addition, Gasdermin D (GSDMD) mediated programmed inflammatory cell death or pyroptosis, and controlled the release of active cytokines subsequently, such as tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) (Xu et al., 2018). Furthermore, some findings also provide new insights into how cyclooxygenase-2 (COX-2) regulates the activation of the NLRP3 inflammasome and suggest that it may be a new potential therapeutic target in NLRP3 inflammasome-related diseases (Hua et al., 2015). Moreover, NIMA-related kinase 7 (NEK7), a new component of the NLRP3 inflammasome and proposed to sense ROS, is binded directly to NLRP3 and required for inflammasome activation to all known NLRP3 activators (He et al., 2016b). In addition, NEK7 was shown to control NLRP3 oligomerization, ASC speck formation and Caspase-1 activation downstream of K+ (potassium) efflux (Sharif et al., 2019). Further evidence suggested that NEK7 is also dispensable for the activation of NLRC4 or AIM2 inflammasomes (He et al., 2016b). Additionally, Thioredoxin-interacting protein (TXNIP), a negative regulator of cell growth and metabolism, modulates cellular redox status by binding to and inhibiting thioredoxin, a principal component of the cell antioxidant system (Shi et al., 2015). The inflammasomes have been implicated in the pathogenesis of several acquired inflammatory diseases (Guo et al., 2018). However, the role of inflammasomes in DEHP-induced thyroid injury and inflammation remains unknown.

For this reason, we conducted this study to investigate whether DEHP-induced thyrocyte inflammatory injury in the thyroid is through the inflammasomes pathway. Meanwhile, we further tested the hypothesis that RA could confer thyroid protection via inhibiting TXNIP-mediated NLRP3 inflammasome activation.

MATERIALS AND METHODS

Reagents

DEHP (C24H38O4, CAS: 117-81-7, purity 99.0%) was purchased from the National Institute of Standards and Technology (Gaithersburg, MD, USA). Rosmarinic acid (RA, Molecular Formula: C21H20O10; CAS No.: 32769-01-0, purity > 99.5%) and other reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA), unless specifically stated elsewhere.

Animals and treatments

Forty healthy male SD rats weighing 70 ± 10g were obtained from Vital River Laboratory Animal Technology Co. Ltd. (Beijing, China). The rats were randomly assigned into 4 groups (n = 10): the control group; 150 mg/kg/day DEHP group (about five times the “No Observed Adverse Effect Level”, NOAEL); 300 mg/kg/day DEHP group (about ten times the NOAEL); 600 mg/kg/day DEHP group (about twenty times the NOAEL). The NOAEL was obtained from a 104-week study, which was from the 2000 chronic toxicity assessment of DEHP in rats (David et al., 2000). The basis for selecting the highest concentration is that 600 mg/kg/d is 1/40 of the rats half lethal dose of DEHP (Reagan-Shaw et al., 2008). DEHP was given to the rats via gavage. The rats received peanut oil through the same way in the control group. DEHP was daily intragastric administered to rats continually for 90 days.

Cell culture and in vitro stimulation

The growth and maintenance of the continuous Fisher Rat Thyroid Cell Strain (FRTL-5) was purchased from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences (Shanghai, China). FRTL-5 cells were cultured in Coon’s modified Ham’s F12 medium supplemented with 2 mM Glutamine, 10 µg/mL Insulin, 10 nM Hydrocortisone, 5 µg/mL Transferrin, 10 ng/mL gly-his-lys acetate, 10 ng/mL somatostatin, 5% Foetal Bovine Serum (Gibco, Grand Island, NY, USA), 10 mU/mL TSH, 100 U/mL penicillin and 100 mg/mL streptomycin, and incubated at 37°C in a humidified atmosphere containing 5% CO2.

The cell counting kit-8 (CCK8, Dojindo, Kumamoto, Japan) was used to test the effects of DEHP on the proliferation of FRTL-5 cells according to the manufacturer’s instructions. Briefly, FRTL-5 cells were seeded in 96-well plates and were treated with increasing wide range of DEHP concentrations (10-8, 10-7, 10-6, 10-5, 10-4, 10-3, 10-2 M) for the different times (6 hr, 12 hr, 24 hr, 48 hr, 72 hr). After incubation, each well was added with 10 μL CCK-8, incubated for another 2 hr, and the absorbance was measured at a wavelength of 450 nm.

Next, the appropriate time point was selected, when the FRTL-5 cells cultures reached 70-80% confluence, the culture medium was removed and the cells were then incubated for 24 hr in the presence of various doses of isoflavones, resveratrol, quercetin, curcumin, green tea polyphenols or RA (5, 10, 20, 50, and 100 μM). After 24 hr, the cultures were washed three times with PBS and cultured for 24 hr with 10-4 μM DEHP. At the indicated time after treatment, the CCK-8 reagent (0.5 mg/mL) was then added to the cell culture medium and incubated at 37°C for 2 hr. The absorbance was evaluated at 450 nm using a microplate reader (Bio-Tek Elx800, Bio-Tek, Norcross, CA, USA).

For further quantified protect effect, cells were induced by RA (50 μM) with and without pretreatment, and then were exposed to DEHP at a concentration of 10-4 M for the indicated 24 hr and were randomly divided into four groups: control group; RA group; DEHP group; and RA+ DEHP group. Next, we further investigated the effect of pyroptosis inhibitor Ac-YVAD-cmk (YVAD) (20 μM) on FRTL-5 cells for indicated time and cells were randomly divided into four groups: control group; YVAD group; DEHP group; and YVAD + DEHP group.

Cell Transfection

The target sequence of siRNA targeting TXPIN was (sense: 5’- CUCCCUGCUAUAUGGAUGUTT -3’; anti-sense: 5’ -ACAUCCAUAUAGCAGGGAGTT -3’), the target sequence of siRNA targeting NLRP3 was (sense: 5’ -GGUGUUGGAAUUAGACAAC -3’; antisense: 5’- UUCUCCGAACGUGUCACGUTT -3’) or the control siRNA target sequence was (sense: 5’- ACGUGACACGUUCGGACAATT -3’; anti-sense: 5’- ACGUGACACGUUCGGAGGAGAATT -3’). Lipofectamine 3000 was used to select stable transfectants at the gene and protein levels. FRTL-5 cells were transfected with control siRNA (si-Con) or TXNIP/NLRP3-targeted siRNA (si-TXNIP/NLRP3) for 24 hr. After transfection, cells were pretreated with or without RA (50 mM) and NAC (N-acetyl-L-cysteine, 5 mM) for 2 hr, and then were treated with DEHP (10-4 M) for 24 hr. Cells treated with non-silent scrambled siRNA and transfection reagents were used as controls.

Histology and histopathology

The thyroid samples treated with four DEHP doses were fixed in 10% paraformaldehyde, and were embedded in paraffin blocks. Multiple slices (4 μm thick) were deparaffinised with xylene and dyed with H&E (hematoxylin and eosin), and analysed by light microscopy.

Western blot analysis

Samples were processed to determine tissues protein concentrations as previously described (Ma et al., 2018). Proteins were separated by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) and were transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore, Bedford, MA, USA). The PVDF were then blocked with 1% bovine serum albumin in TRIS-buffered saline with Tween-20 (TBST) at room temperature for 1 hr, then incubated with NLRP1 antibody (dilution 1:1000, Abcam, Toronto, ON, Canada), NLRP3 (dilution 1:1000, Abcam), NLRC4 (dilution 1:1000, Abcam/ABclonal), AIM2 (dilution 1:1000, Abcam), ASC (dilution 1:1000, Abcam), Caspase-1/p10/p12 (dilution 1:1000, Abcam), Caspase-8 (dilution 1:1000, Abcam), Gasdermin-D (dilution 1:1000, CST), COX-2 (dilution 1:1000, Abcam), IL-1β (dilution 1:1000, Abcam), IL-18 (dilution 1:1000, CST), HMGB1 (dilution 1:1000, Proteintech Group), NEK7 (dilution 1:1000, CST), TXNIP (dilution 1:1000, Abcam/Proteintech Group), β-actin (dilution 1:2000, ZSGB-BIO) and Tubulin (dilution 1:1000, Abcam) overnight at 4°C. The following day, membranes were rinsed three times (10 min each) with 1% TBST and incubated with alkaline phosphatase (AP)-conjugated goat anti-rabbit IgG secondary antibody (1:1,000 dilution) or AP-conjugated rabbit anti-mouse IgG (1:1,000 dilution) for 1-2 hr at room temperature. After washing six times in TBST buffer, a chemiluminescence detection system (Tanon Science & Technology Co., Ltd., Shanghai, China) was used to detect the resultant signals. The individual protein bands were quantified by using ImageJ software (NIH, Bethesda, MD, USA). Each western blot was repeated at least three times.

Total RNA extraction and quantitative real-time PCR

Total RNA of tissues was extracted using TRIzol reagent and treated with genomic DNA (gDNA) wiper. Then, the RNA was reverse transcribed with a stem-loop RT primer (Takara Bio, Inc., Shiga, Japan) according to the manufacturer’s instructions. Next, the RT products were quantified using AceQ qPCR SYBR Green Master Mix. Expression levels of NLRP1, NLRP3, NLRC4, AIM2, ASC, Caspase-1, Caspase-8, GSDMD, COX-2, IL-1β,IL-18, HMGB1, NEK7 and TXNIP were measured. The primer (Table 1) was designed according to the cDNA sequence from GenBank. All reactions were run in triplicate. A melting curve was generated during amplification to verify the absence of primer dimers or incorrectly paired products. All primers were synthesised by Sangon Biotech, Co., Ltd. (Shanghai, China).

Table 1. Description of primers used in the present study.
Primer Type Primer Sequence
NLRP1 Forward
Reverse
5' - CCACAACCCTCTGTCTACATTAC - 3'
5' - GCCCCATCTAACCCATGCTTC - 3'
NLRP3 Forward
Reverse
5' - GATCTTCGCTGCGATCAACA - 3'
5' - GGGATTCGAAACACGTGCATTA - 3'
NLRC4 Forward
Reverse
5' - CCAGTCCCCTCACCATAGAAG - 3'
5' - ACCCAAGCTGTCAGTCAGACC - 3'
AIM2 Forward
Reverse
5' - CTGCAGTGATGAAGACCATTCGTA - 3'
5' - GGTGCAGCACGTTGCTTTG - 3'
ASC Forward
Reverse
5' - AACCCAAGCAAGATGCGGAAG - 3'
5' - TTAGGGCCTGGAGGAGCAAG - 3'
caspase-1 Forward
Reverse
5' - GCCTGTTCCTGTGATGTGGAG - 3'
5' - TGCCCACAGACATTCATACAGTTTC - 3'
caspase-8 Forward
Reverse
5′ - CTGGGAAGGATCGACGATTA- 3′
5′ - TGGTCACCTCATCCAAAACA- 3′
GSDMD Forward
Reverse
5′ - GGGGACTGCTGGGATGAAAA - 3′
5′ - GGAACAGGGAGGCATAGAGC - 3′
COX-2 Forward
Reverse
5′ - TCCTGGAACATGGACTC - 3′
5′ - GCTCGGCTTCCAGTATTGAG - 3′
IL-1β Forward
Reverse
5' - CCAGGGACAGGATATGGAGCA - 3'
5' - TTCAACACGCAGGACAGGTACAG - 3'
IL-18 Forward
Reverse
5' - CTGCCACCTGCTGCAGTCTA - 3'
5' - TCTACTGGTTCAGCAGCCATCTTTA - 3'
HMGB1 Forward
Reverse
5′ - CCAAGAAGTGCTCAGAGAGGTG - 3′
5′ - GTCCTTGAACTTCTTTTTGGTCTC - 3′
NEK7 Forward
Reverse
5′ - CCACTGGGATGGTAAAACTTG - 3′
5′ - AAGGACTTTGTAATGCAGCCAT - 3′
TXNIP Forward
Reverse
5' - AATTGGCAGCAGATCAGGTCTAAGC - 3'
5' - CATGTCATCTAGCAGAGGAGTGGTTG - 3'
GAPDH Forward
Reverse
5' - GCACCGTCAAGGCTGAGAAC - 3'
5' - TGGTGAAGACGCCAGTGGA - 3'
β-actin Forward
Reverse
5' - CCGTAAAGACCTCTATGCCAACA - 3'
5' - GGGGCCGGACTCATCGTA - 3'

Statistical analysis

Statistical analyses were performed by SPSS version 20.0 software. The correlation between either two variables was investigated using Pearson analysis. Statistical differences were calculated using one-way analysis of variance (ANOVA) followed by a least significant difference (LSD) test or Student’s t-test to compare the differences among groups. Data are expressed as the mean ± SEM of independent experiments, P < 0.05 was statistically significant.

RESULTS

DEHP induces thyroid inflammation and multiple inflammasomes activation

To determine the effects of DEHP on thyroid function, we first measured the activity of multiple inflammasomes activation. The western blotting analysis exhibited significantly enhanced protein levels of NLRP1, NLRP3, NLRC4, AIM2, ASC, Caspase-1, Caspase-8, GSDMD, COX-2, IL-1β,IL-18, HMGB1, NEK7 and TXNIP, as well as their corresponding activated forms after DEHP exposure (Fig. 1). In accordance with this result, an assessment of the thyroid also revealed a significant increase in above mentioned mRNA expression levels in DEHP-treated rats compared to control rats (Fig. 2). Consistent with the changes in thyroid function, the histopathological analysis showed that exposure to DEHP resulted in thyrocytes swelling and mild inflammatory infiltration (Fig. S2). Taken together, these data indicate that DEHP induces thyroid injury and thyrocyte death.

Fig. 1

DEHP induces thyroid inflammation and dysfunction. The protein expression levels of (A) NLRP1, (B) NLRP3, (C) NLRC4, (D) AIM2, (E) ASC, (F) Caspase-1, (G) Caspase-8, (H) GSDMD, (I) COX-2, (J) IL-1β, (K) IL-18, (L) HMGB1, (M) NEK7 and (N) TXNIP were analysed in thyroid tissues from rats. *P < 0.05, **P < 0.01, ***P < 0.001.

Fig. 2

DEHP induces thyroid inflammation and dysfunction. The mRNA expression levels of (A) NLRP1, (B) NLRP3, (C) NLRC4, (D) AIM2, (E) ASC, (F) Caspase-1, (G) Caspase-8, (H) GSDMD, (I) COX-2, (J) IL-1β, (K) IL-18, (L) HMGB1, (M) NEK7 and (N) TXNIP were measured in thyroid tissues from rats. *P < 0.05, **P < 0.01, ***P < 0.001.

DEHP-induced FRTL-5 cell viability changes and screening of candidate compounds after pretreatment

To determine the effect of DEHP on cell viability, cck-8 analysis was performed using a variety of DEHP concentrations (10-8, 10-7, 10-6, 10-5, 10-4, 10-3, 10-2 M) for 12, 24, 48 or 72 hr. Our results showed that DEHP has a proliferative effect in the range of 10-8 to 10-2 M, and the damage effect of DEHP on FRTL-5 cells is the strongest at a concentration of 10-4 M for 24 hr. Based on previous studies and our results, we used DEHP at 10-4 M dose at 24 hr for the following experiments (Wang et al., 2017) (Kim et al., 2019b) (Fig. S1A).

To further quantify the protective effect, the thyrocytes were pretreated with or without six candidate compounds (RA, resveratrol, quercetin, curcumin, green tea polyphenols, genistein). Interestingly, we found that the cells are affected by varying the concentration (5, 10, 20, 50, 100 μM). The results indicate that the protective effect of RA at all doses is superior to other candidate compounds. At the same time, several studies also mentions the optimal dose of RA, we chose to focus on RA (50 μM) for further experiments (Moon et al., 2010; Zhou et al., 2017) (Wei et al., 2018) (Zych et al., 2019; Rahbardar et al., 2018) (Fig. S1B).

DEHP triggers multiple inflammasomes activation and pyroptosis in thyrocytes

As mentioned above, multiple inflammasomes activation results in the cleavage of Caspase-1 into p20 and p10 subunits and maturation of inflammatory cytokines. Thus, to identify multiple inflammasomes activation, we determined the levels of multiple inflammasomes and pyroptosis using western blotting and RT-PCR in thyrocytes following treatment with DEHP for 24 hr. As shown in Fig. 3,4, the expression of multiple inflammasomes (NLRP1, NLRP3, NLRC4 and AIM2) increased with increasing concentrations of DEHP in thyrocytes. Moreover, the components level was also up-regulated by DEHP treatment in a dose-dependent manner. As expected, these results suggest that NLRP3 inflammasome activation mediates DEHP-induced thyroid inflammation and thyrocyte death.

Fig. 3

Protein expression of DEHP induced multiple inflammasomes and components activation in FRTL-5 thyrocytes. The protein expression levels of (A) NLRP1, (B) NLRP3, (C) NLRC4, (D) AIM2, (E) ASC, (F) Caspase-1, (G) Caspase-8, (H) GSDMD, (I) COX-2, (J) IL-1β, (K) IL-18, (L) HMGB1, (M) NEK7 and (N) TXNIP in thyrocytes. *P < 0.05, **P < 0.01, ***P < 0.001.

Fig. 4

The mRNA levels expression of DEHP induced multiple inflammasomes and components activation in FRTL-5 thyrocytes. The mRNA expression levels of (A) NLRP1, (B) NLRP3, (C) NLRC4, (D) AIM2, (E) ASC, (F) Caspase-1, (G) Caspase-8, (H) GSDMD, (I) COX-2, (J) IL-1β, (K) IL-18, (L) HMGB1, (M) NEK7 and (N) TXNIP in thyrocytes after treatment with DEHP. *P < 0.05, **P < 0.01, ***P < 0.001.

RA protects against DEHP-induced thyrocyte death in vitro

To evaluate the potential protective effect of RA against DEHP-induced thyrocytes injury and inflammation, RA was administered for 24 hr before DEHP treatment. As shown in Fig. 5, RA pretreatment markedly ameliorated NLRP1, NLRP3, NLRC4, AIM2, ASC, Caspase-1, Caspase-8, GSDMD, COX-2, IL-1β,IL-18, HMGB1, NEK7 and TXNIP protein levels which were caused by DEHP-induced thyrocyte injury and inflammatory. In addition, further analysis demonstrated RA attenuated the DEHP-induced gene expression as shown in Fig. 6. Collectively, these results indicate that RA confers protection against DEHP-induced thyrocyte injury.

Fig. 5

Rosmarinic acid alleviated DEHP-induced thyrocyte inflammation and multiple inflammasomes activation. (A) NLRP1, (B) NLRP3, (C) NLRC4, (D) AIM2, (E) ASC, (F) Caspase-1, (G) Caspase-8, (H) GSDMD, (I) COX-2, (J) IL-1β, (K) IL-18, (L) HMGB1, (M) NEK7 and (N) TXNIP protein expression levels in the thyroid were analysed. *P < 0.05, **P < 0.01, ***P < 0.001.

Fig. 6

Rosmarinic acid alleviated DEHP-induced thyrocyte inflammation and multiple inflammasomes activation. (A) NLRP1, (B) NLRP3, (C) NLRC4, (D) AIM2, (E) ASC, (F) Caspase-1, (G) Caspase-8, (H) GSDMD, (I) COX-2, (J) IL-1β, (K) IL-18, (L) HMGB1, (M) NEK7 and (N) TXNIP mRNA expression levels in the thyroid were examined. *P < 0.05, **P < 0.01, ***P < 0.001.

Pyroptosis inhibitor (ac-YVAD-cmk) blocks thyroid multiple inflammasomes activation caused by DEHP in thyrocytes

To further confirm whether the thyrocyte death induced by DEHP treatment was pyroptosis, the pyroptosis inhibitor, ac-YVAD-cmk, was used. As shown in Fig. 7 and 8, ac-YVAD-cmk notably abolished DEHP-induced multiple inflammasomes. As a result, the inhibitor significantly reduced multiple inflammasomes activation, such as NLRP1, NLRP3, NLRC4, AIM2 and ASC, Caspase-1, Caspase-8, GSDMD, COX-2, IL-1β,IL-18, HMGB1, NEK7 and TXNIP in protein (Fig. 7) and mRNA (Fig. 8) levels. As expected, these results demonstrate that thyrocyte pyroptosis induced by DEHP is ameliorated by the pyroptosis inhibitors ac-YVAD-cmk.

Fig. 7

Role of pyroptosis inhibitor Ac-YVAD-cmk (YVAD) in DEHP-induced thyrocyte inflammation and multiple inflammasomes activation. Effect of YVAD in protein expression levels on DEHP-induced thyrocytes. (A) NLRP1, (B) NLRP3, (C) NLRC4, (D) AIM2, (E) ASC, (F) Caspase-1, (G) Caspase-8, (H) GSDMD, (I) COX-2, (J) IL-1β, (K) IL-18, (L) HMGB1, (M) NEK7 and (N) TXNIP *P < 0.05, **P < 0.01, ***P < 0.001.

Fig. 8

Role of pyroptosis inhibitor Ac-YVAD-cmk (YVAD) in DEHP-induced thyrocyte inflammation and multiple inflammasomes activation. Effect of YVAD in mRNA expression levels on DEHP-induced thyrocytes. (A) NLRP1, (B) NLRP3, (C) NLRC4, (D) AIM2, (E) ASC, (F) Caspase-1, (G) Caspase-8, (H) GSDMD, (I) COX-2, (J) IL-1β, (K) IL-18, (L) HMGB1, (M) NEK7 and (N) TXNIP. *P < 0.05, **P < 0.01, ***P < 0.001.

NAC antagonizes DEHP-induced NLRP3 activation in thyrocytes

Reactive oxygen species (ROS) production has been shown to be one of the mechanisms by which NLRP3 inflammasome is activated (Abais et al., 2015). Therefore, we investigated the potential mechanism of DEHP-induced ROS in inflammasome activation. After 24 hr of 10-4 M DEHP treatment, intracellular ROS was successfully inhibited by NAC (total ROS scavenger). The results showed that DEHP-induced TXNIP, NLRP3, Caspase-1 and IL-1β protein expression increased and NAC inhibited these protein expressions. Additionally, NAC pre-treatment and siRNA TXNIP/NLRP3-transfection significantly reversed the activation of DEHP-induced inflammasome activation, Caspase-1 production and IL-1β release of FRTL-5 cells (P < 0.05) (Fig. 9). These data indicated that ROS is involved in DEHP-induced thyrocyte injury, and NLRP3 inflammasome participate in DEHP-mediated inflammation through the ROS-TXNIP pathway. Moreover, NAC can reduce DEHP-induced thyrocyte pyrolysis and TXNIP-NLRP3 inflammasome pathways.

Fig. 9

The role of NAC in DEHP-induced activation of TXNIP-NLRP3 inflammasome. NAC, siRNA-TXPIN/NLRP3 reduces the activation of DEHP-induced thyrocyte inflammation. *P < 0.05 compared with the control group; #P < 0.05 compared with the DEHP treatment group.

siRNA TXNIP alleviates TXNIP-NLRP3 inflammasome activation in FRTL-5 cells treated with DEHP

We hypothesized that RA counteracts DEHP-induced NLRP3 inflammasome activation by down-regulating TXNIP. To test this, we first transfected the thyrocytes with siRNA TXNIP. As shown in Fig. 10, siRNA TXNIP largely reversed the protective effects of RA on DEHP-induced NLRP3, Caspase-1 expression and IL-1β maturation. Under the action of RA, the expression levels of TXNIP, NLRP3, Caspase-1, IL-1β were significantly attenuated by treatment with siRNA TXNIP in DEHP-exposed thyrocytes. Taken together, these results indicate that the protective effect of RA is mediated by the TXNIP-NLRP3 inflammasome pathway in DEHP-induced thyrotoxicity.

Fig. 10

siRNA TXNIP alleviated the activation of NLRP3 inflammasome inhibited by rosmarinic acid of DEHP-induced thyrocyte inflammation. Protein expression levels of TXNIP, NLRP3, Caspase-1 and IL-1β, respectively. *P < 0.05 compared to si-Con; #P < 0.05 compared to si-Con + DEHP treatment group.

DISCUSSION

As an environmental endocrine disruptor, DEHP has toxic effects in vertebrates. Increasing evidence manifested that DEHP can cause oxidative stress, inflammation and dysfunction in different glands (Zhao et al., 2019; Bahrami et al., 2018). Inhibition of oxidative stress and inflammation by regulating their corresponding signaling pathways would be an effective therapeutic treatment assuaging DEHP-induced thyrotoxicity in inflammasomes activation. Furthermore, we found that RA exerts antioxidant and anti-inflammatory properties and conferred protection against DEHP-induced thyroid inflammation, thus eliciting pharmacological potential in preventing the toxic effects of DEHP. Finally, we report that suppression of multiple inflammasomes pathway contributes to the antagonism of DEHP-induced thyroid injury by RA.

Pyroptosis is characterized by an early destruction of the plasma membrane integrity, and is mediated by Caspase-1 and inflammasomes activation, resulting in extracellular spilling of the intracellular contents, including diverse pro-inflammatory cytokines (IL-1β, IL-18 and HGMB1) (Wang et al., 2020). Simultaneously, after cleaving by activated Caspase-1, the amino- and carboxyl-terminal linkers of GSDMD (as a generic substrate for Caspase-1/4/5/11) could release N-terminal fragment, subsequently facilitating the N-terminal fragment’s binding to phosphoinositide in the plasma membrane to form oligomeric asymptotic pores, which serve as a gate for extracellular release of mature IL-1β (Shi et al., 2015). In our series of experiments, we found that DEHP causes aberrant expression and activity of multiple inflammasomes (NLRP1, NLRP3, NLRC4 and AIM2), marked up-regulation of pro-inflammatory mediator levels as well as induced mild inflammatory infiltration. This suggests that NLRP1/NLRP3/NLRC4/AIM2-ASC-Caspase-1-IL-18/IL-1β axis may play an important role in the pathogenesis of DEHP-induced thyroid diseases. Here, we proved that all results that DEHP causes and exacerbates thyroid dysfunction and inflammation, the inflammatory responses have been considered as one of the main factors in the occurrence of thyroid injury (Ferrari et al., 2019). To the best of our knowledge, this is the first demonstration that the multiple inflammasomes mediated DEHP-induced thyroid inflammation and dysfunction.

Interestingly, the increased expression of pro-inflammatory cytokines in the thyroid induced by DEHP suggests that it may be participate in the pathogenesis of thyroid disease. The accumulation of IL-1β also acts as a pro-inflammatory mediator by recruiting neutrophils and accelerating thyroid pathology, and inflammasomes are required for converting pro-IL-1β into biologically active IL-1β (Wang et al., 2020). In addition, RA reduced the levels of the pro-inflammatory cytokines in the DEHP-induced group. This suggests that the inhibition of IL-1β, IL-18 and HMGB1 by RA is likely associated with a decrease of tissue injury by attenuating the inflammatory response. What’s more, the inhibitor ac-YVAD-cmk mitigates multiple inflammasomes priming and sensing mediated by DEHP-induced thyrocytes injury, and inhibits Caspase-1 activation and inflammatory cytokines processing and secretion. These results make RA as a promising candidate for future studies in animal models and clinical trials for treatment of DEHP-induced inflammatory disorders.

NEK7 has emerged as an essential regulator of NLRP3 inflammasome activation. Here, we established that NEK7, by direct interaction with NLRP3, is response to stimulation with DEHP (He et al., 2016a). The observation that binding NEK7 to NLRP3 requires ROS, a mediator for multiple activators of NLRP3, supports a broad role for NEK7 in NLRP3 inflammasome activation (Shi et al., 2016). Results from our experiments show that NEK7 is up-regulated under DEHP treatment, and is assuaged after RA treatment obviously. Therefore, these results certainly reveal that NEK7 is a positive regulator of NLRP3 inflammasome activation, and RA has anti-inflammatory properties (Shi et al., 2016). Revealing the signaling mechanism of NEK7 in response to NLRP3 activators will provide new insight into the molecular mechanism of NLRP3 inflammasome activation.

Caspase-8 is an upstream activator of Caspase-3 and controls apoptotic cell death (Vince et al., 2018). The “apoptotic” Caspase-8 can cleave GSDMD, leading to pyroptosis-like cell death and IL-1β release (Orning et al., 2018). In our present study, we found that Caspase-8 is up-regulated after DEHP-induced in vivo and in vitro definitely. Growing evidence indicates important roles of Caspase-8 in inflammatory responses in xenobiotic compounds induced with diverse pathogens (Sarhan et al., 2018). In addition, Caspase-8 activation can trigger NLRP3 inflammasome activation which attributes to different pore-forming proteins GSDMD and can interact with the Caspase-1–ASC adaptor complex and to promote ASC self-assembly (Vince and Silke, 2016). Moreover, The newly discovered GSDMD opens up a new pathway to specifically inhibit pyroptosis in dysfunctional or damaged cells (Rathkey et al., 2020). Changes in GSDMD may be due to partial control of potassium efflux, and these signals direct NLRP3 activation, ASC oligomerization, and IL-1β release, ultimately (Banerjee et al., 2018). However, researchers have not yet reached a consensus on the downstream molecular mechanisms involved in GSDMD-mediated cytotoxicity. Therefore, it means that GSDMD cleavage is induced by not only Caspase-1 but also Caspase-8, and Caspase-8 may represent the molecular switch that controls DEHP-induced thyrotoxicity by pyroptosis (Mazumdar et al., 2013). Hence, We do not rule out the occurrence of DEHP-induced thyrotoxicity by apoptosis or other forms of cell death, which requires further exploration.

Some evidence also suggests that TXNIP could directly activate the NLRP3 inflammasome under oxidative stress (Xu et al., 2019). Therefore, we speculate that targeting the TXNIP-NLRP3 inflammasome pathway may be an effective therapeutic approach to attenuate DEHP-induced thyroid injury. Our experimental data showed that RA and inhibitor efficiently inhibited DEHP-induced TXNIP expression, which decreased the interaction between TXNIP and NLRP3. These results suggest that inhibition of the TXNIP-NLRP3 inflammasome pathway is required for RA to ameliorate thyroid inflammation during DEHP-induced thyroid injury.

In conclusion, we propose an intriguing mechanism of DEHP-induced thyroid injury via multiple inflammasomes-dependent inflammation. Most importantly, our study is the first time to document that the protective effect of RA is mediated by multiple inflammasomes. Taken together, our findings provide new insights as pharmacological and toxicological evidence for the application of RA as an antagonist for DEHP toxicity. Future study is needed to evaluate RA efficacy in the population of endocrine disrupting chemicals.

ACKNOWLEDGMENTS

This project was supported by the National Natural Science Foundation of China (Grant No. 81273079).

Conflict of interest

The authors declare that there is no conflict of interest.

REFERENCES
 
2020 The Japanese Society of Toxicology
feedback
Top