The Journal of Toxicological Sciences
Online ISSN : 1880-3989
Print ISSN : 0388-1350
ISSN-L : 0388-1350
Original Article
Effects of intragastric administration of La2O3 nanoparticles on mouse testes
Lu Yuan, Disi Bai, Lijun Meng, Hong Wang, Zhaoyu Sun, Tianyang An, Zhenfei Chen, Xuenan Deng, Xiujun Zhang
著者情報
ジャーナル フリー HTML

2020 年 45 巻 8 号 p. 411-422

詳細
Abstract

Lanthanum oxide (La2O3) nanoparticles (NPs) have been widely used in photoelectric and catalytic applications. However, their exposure and reproductive toxicity is unknown. In this study, the effect of the intragastric administration of two different-sized La2O3 particles in the testes of mice for 60 days was investigated. Although the body weight of mice treated or not treated with La2O3 NPs was not different and La2O3 NPs were distributed in the organs including the testis, liver, kidney, spleen, heart and brain. La2O3 NPs accumulate more than micro-sized La2O3 (MPs) in mice testes. The histopathological evaluation showed that moderate reproductive toxicity induced by La2O3 NPs in the testicle tissues. Furthermore, increased MDA, 8-OHdG levels and decreased SOD activities were detected in the La2O3 NP-treated groups. Moreover, qRT-PCR and western blotting data indicated that La2O3 NPs affecting the blood–testis barrier (BTB)-related genes in mice testes. Taken together, these findings suggested that La2O3 NPs activated inflammation responses and cross the BTB in the murine testes. This study provided useful information for risk analysis and regulation of La2O3 NPs by administrative agencies.

INTRODUCTION

Metal nanoparticles have been widely used in medical treatment and diagnosis, and human beings can be exposed to NPs by drinking polluted water and food chain transmission (Gerber et al., 2012; Yue et al., 2017; Ma et al., 2015; Servin and White, 2016; De la Torre Roche et al., 2015). In recent years, La2O3 NPs have been widely used in various fields such as water treatment, magnetic data storage, fuel cells and catalysis, which can be released into the natural environment, causing the contact of plants and animals (Brabu et al., 2015; Guha and Basu, 2014; Sisler et al., 2016a). Studies have shown that La2O3 NPs can accumulate from lower organisms to higher organisms along the food chain (Giovanni et al., 2015; Priester et al., 2012; Balusamy et al., 2015; Liu et al., 2018).

Many studies have shown that La2O3 NPs can pose adverse effects on animals. The toxicity and side effects of La2O3 NPs observed in previous studies are mainly exemplified by evidence of pulmonary and hepatic toxicity. Lim et al. indicated that La2O3 NPs were absorbed into the lungs and caused toxicity in the rat lungs (Lim, 2015). La2O3 NPs could induce lung inflammation and irreversible fibrosis in male SD rats (Shin et al., 2017). Moreover, published data showed that La2O3 NPs could induce the increase of interleukin-1β (IL-1β) in BALF of mice (Sisler et al., 2016b). Furthermore, La2O3 NPs increased expression of IL-1β and transforming growth factor-β1, and ultimately resulted in pulmonary fibrosis (Li et al., 2014). In addition, gastrointestinal tract could absorb La2O3 NPs, and La2O3 NPs could be transported to liver by circulatory system, leading to hepatotoxicity (Brabu et al., 2015).

At present, studies on the bio-distribution/bio-accumulation, and potential toxic mechanisms following exposure to La2O3 NPs in mice testes have not been reviewed, whether La2O3 NPs can cause human health hazards with potential underlying mechanisms is still unclear. Furthermore, the effects of different-sized La2O3 particles on testicular injury and BTB-related genes in mice have not been studied yet. Consequently, the present study employed a mice model to simulate human beings exposed to La2O3 NPs and assessed the oxidative stress, inflammation and apoptosis in mice. In addition, sperm parameters, testicular histology, and immunohistochemistry were determined, and La2O3 particles of different sizes and doses on BTB-related genes and testis-specific genes in mice were evaluated.

MATERIALS AND METHODS

Characterization of La2O3 NPs

La2O3 NPs (manufacturer number: Aldrich-634271) used in this experiment were purchased from Sigma-Aldrich (St. Louis, MO, USA). Micro-sized La2O3 (La2O3 MPs) was purchased from Maclin Chemical Reagent Co., Ltd. (Shanghai, China). These particles were produced under laboratory practices and preserved in the dark until use. The sizes of La2O3 NPs were examined using a transmission electron microscope (TF20 Jeol 2100F, Tokyo, Japan). The morphology and structure of the nanoparticles were tested by scanning electron microscope (Zeiss Gemini 300, Jena, Germany). The crystalline phase of La2O3 NPs was characterized by X-ray diffraction (XRD, Ultima IV, Tokyo, Japan). Scans were performed over the angular range 20-70◦ 2θ at a scan rate of 0.25◦/min at r.t. NPs and MPs suspensions were freshly prepared in ultrapure water. Ultrasonic vibration (100 W, 30 kHz) was performed for 30 min before testing. The hydrodynamic diameters were measured using the dynamic light scattering method (Malvern Nano-ZS90, Malvern, UK) to examine the aggregate or distributed status of La2O3 NPs in acidic solution at various pH values (Fed: stomach pH 2.98 and duodenum pH 4.04; Fasted: stomach pH 4.04 and duodenum pH 4.74 in mice) (McConnell et al., 2008).

Establishment of animal model

50 male Kunming mice (20 ± 2 g) were purchased from the Laboratory Animal Center of North China University of Science and Technology. Animal protocols were approved by the North China University of Science and Technology Institutional Animal Care Committee (Ethical review number: LX-2019-053) and conformed to the Institutes of Health Guide for the Care and Use of Laboratory Animals. The mice were kept in plastic cages with a metal top and sawdust as bedding in a controlled environment at 22-26°C, with 55-60% humidity and a 12-hr light/dark cycle. Standardized granular food and tap water were provided ad libitum. To test whether La2O3 NPs could induce reproductive toxicology, mice were divided into 5 groups (control, nano-sized with 2.5, 5, 10 mg/Kg BW and micro-sized with 10 mg/Kg BW), named as CON, NL, NM, NH and WM, and treated with La2O3 NPs by repeated intragastric administration for 60 days. For dose selection, we consulted the Organisation for Economic Co-operation and Development (OECD) of 401. According to that report, the LD50 of orally administered La2O3 NPs in rats is > 12 g/kg BW. These doses were approximately equal to 0.15-0.7 g La2O3 NPs exposure in humans with 60-70 kg body weight, which is considered a relatively safe dose range. The control group was treated with de-ionized water without La2O3 NPs, which was prepared by the same process to prepare La2O3 NPs suspension. The nanoparticles were freshly prepared every day based on the mice body weights and used immediately, ultrasonic vibration (100 W, 30 kHz) was performed for 30 min before intragastric administration. The animals were sacrificed at the end of the last exposure. Testes and other organs were immediately isolated, weighted and stored at -80°C.

Effects of La2O3 NPs and MPs on sperm parameters

The sperm motility (%), sperm count (million/mL), and the rates of sperm survival (%) were investigated in this study. The testis and epididymis were collected after mice were sacrificed, and immediately placed in the centrifuge tube with 37°C preheated physiological saline and cut up, put into 37°C water-bath, then incubated for 20 min; sperm motility was detected visually with a light microscope at 37°C (400×). Semen were collected, pretreated at 60°C for 10 min, added as a suspension to the hemocytometer, and sperm count observed with a light microscope (200 ×). One drop of sperm suspension was placed on a pre-warmed glass slide for light microscopic observation of sperm motility. A total of 200 sperms per sample were evaluated. The percentage of sperms with forward and progressive activity was counted to assess sperm motility.

The content of lanthanum in various parts of the body

All tissues and organs were removed from -80°C strage. After thawing, approximately 0.1-0.3 g of the organs was weighed, digested and analyzed for lanthanum content. Inductively coupled plasma-mass spectrometry (ICP-MS, Thermo Elemental X7, Thermo Electron Co. Waltham, MA, USA) was used to analyze the lanthanum concentration in the samples. The data were expressed as micrograms per gram fresh tissues.

Histological assessment

The fixed testis samples were embedded in paraffin, 5 µm thick testes histological sections were cut and stained with hematoxilin-eosin to detect morphological alterations by a light microscope (Olympus IX71, Tokyo, Japan).

Immunohistochemistry for NF-κB-p65 and Occludin

Formalin-fixed paraffin-embedded testicular tissue sections from animals of all groups were deparaffinised and soaked in graded concentrations of ethanol. The procedures were performed following the manufacturers’ instructions. After dewaxing, sections were incubated in solution containing rabbit NF-κB-p65 (10745-1-AP, diluted at 1:200; Proteintech, USA) and anti-Occludin (sc-133256, diluted at 1:100; Santa Cruz, CA, USA) for 3 hr at 37°C. Next, biotin-labelled anti-rabbit secondary antibody (Boster Bioengineering Co., Ltd., Wuhan, China) was added, and the sections were incubated for 30 min at room temperature. Thereafter, reactions were visualized with 3, 3’-diaminobenzidine-tetrahydrochloride (DAB) and counterstained in haematoxylin.

Measurement of superoxide dismutase (SOD) activity, malondialdehyde (MDA) and 8-hydroxy-2’-deoxyguanosine (8-OHdG) levels

To evaluate the oxidative stress caused by La2O3 NPs and MPs, kits for the testing of SOD activity, MDA and 8-OHdG levels generated in testes were measured using the commercial assay kits (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China). The steps were based on the manufacturer’s introduction. MDA content was determined by measuring the levels of thiobarbituric acid reactive substances (TBARS) at 532 nm and expressed as nmol per milligram protein (nmol/mg prot). The SOD activity was expressed as units per nanogram protein (U/ng prot), and the 8-OHdG level was expressed as mg/g tissue. All assays were conducted in triplicate, and the mean activity or level was calculated.

Quantitative real-time PCR

Total RNA of the testis samples was extracted using the RNeasy mini kit (Qiagen, Tokyo, Japan) according to the manufacturer’s protocol. The cDNA was synthesized from total RNA 5 μg using murine leukemia virus reverse transcriptase and oligo-dT primers (BGI, Beijing, China). Quantitative real-time RT-PCR was used to quantify the expression levels of different genes, using β-actin mRNA as the normalization standard. The probes for genes, including ZO-1, Occludin, Vim, N-cad, XRCC1, Tesmin, 3β-HSD, Amh, Bcl-2, BAX and Caspase-3 were designed and synthesized by Beijing Genomics Institute (BGI). Sequences of the forward and reverse primers were listed in Table 1. Amplification was performed under the following conditions: (1) 1 min at 95°C; (2) 5 sec at 95°C; (3) 30 sec at 60°C with plate read; (4) 40 cycles for (2) and (3); Melt Curve 65 to 95°C. qRT-PCR of mRNAs was performed using Platinum SYBR Green qPCR Super Mix UDG Kit, and real-time PCR experiments were carried on the Thermo system (7900HT). Gene expression levels were calculated as a ratio to the expression of the reference gene, β-actin and data were analyzed using the 2 -ΔΔCt method.

Table 1. List of primers used for real time RT-PCR.
Function Gene Name Primer Sequence (5’-3’) Product (bp)
BTB-related genes ZO-1 F: GCCGCTAAGAGCACAGCAA
R: GCCCTCCTTTTAACACATCAGA
172
Occludin F: TGAAAGTCCACCTCCTTACAGA
R: CCGGATAAAAAGAGTACGCTGG
128
Vim F: CGTCCACACGCACCTACAG
R: GGGGGATGAGGAATAGAGGCT
74
N-cad F: AGGACCCTTTCCTCAAGAGC
R: ATAATGAAGATGCCCGTTGG
117
testis-specific genes XRCC1 F: CCAGCCCCAGAGGAGAATG
R: TGAAAGCGGTCACGTAGCG
193
Tesmin F: TCCCAGTTGAAATCAAAGAAGC
R: GGAGTCTTTCTTCCGAGGGC
172
3β-HSD F: GGTTTTTGGGGCAGAGGATCA
R: GGTACTGGGTGTCAAGAATGTCT
168
Amh F: CCACACCTCTCTCCACTGGTA
R: GGCACAAAGGTTCAGGGGG
151
Apoptosis Bcl-2 F: GGTCTTCAGAGACAGCCAGG
R: GATCCAGGATAACGGAGGCT
113
BAX F: GATCAGCTCGGGCACTTTAG
R: TTGCTGATGGCAACTTCAAC
120
Caspase-3 F: CTCGCTCTGGTACGGATGTG
R: TCCCATAAATGACCCCTTCATCA
201
Reference β-actin F: GTGCTATGTTGCTCTAGACTTCG
R: ATGCCACAGGATTCCATACC
174

Western blotting analysis

Expression of ZO-1, Vim, Occludin, N-cad, XRCC1, Tesmin, 3β-HSD, Amh, Bcl-2, BAX and Caspase-3 were assayed by western blotting. Testis tissue extracts were obtained by homogenizing sample in RIPA Buffer (Beyotime, Shanghai, China) supplemented with a protease inhibitor PMSF for 10 min. The homogenates were placed on ice for about 1 hr and then centrifuged at 10,000 × g for 10 min at 4°C. The protein concentrations in the supernatant were determined using the BCA Protein Assay Kit (Sangon Biotech, Shanghai, China). Each sample containing 40 µg protein was electrophoretically resolved on 8% SDS-polyacrylamide gels, and then transferred to polyvinylidine difluoride membranes (PVDF, Pall, Gelman Laboratory, New York, USA). The membranes were first blocked with 5% non-fat milk in TBST for 2 hr at RT and then incubated with specific primary antibodies: anti-NF-κB-p65 (10745-1-AP, 1:1000; Proteintech, USA), anti-ZO-1 (66452-1-Ig, diluted at 1: 2000; Proteintech), anti-Vim (PB0378, diluted at 1:400, BOSTER, Wuhan, China), anti-Occludin (sc-133256, diluted at 1:500; Santa Cruz), anti-N-cad (ab18203, diluted at 1:5000; Abcam, Cambridge, UK), anti-XRCC1 (ab9147, diluted at 1:5000; Abcam), anti-3β-HSD (ab93926, diluted 1:1000; Abcam), anti-Amh (sc-6886, diluted at 1:12000; Santa Cruz) and anti-Tesmin (diluted at 1:500; Santa Cruz Biotechnology), anti-BAX (ab32503, diluted at 1:1000, Abcam), anti-Bcl-2 (ab196495, diluted at 1:1000, Abcam) and anti-Caspase-3 (ab13847, diluted at 1:500, Abcam) overnight at 4°C, washed 3 times with TBST for 10 min and incubated with goat anti-mouse IgG antibody (1:1000; ASR1037, Abgent, San Diego, CA, USA) for 1 hr. Densitometric analysis was normalized using β-actin as internal controls. Bands were visualized using the ECL kit (Sangon Biotech, Shanghai, China). Quantity One software was used to quantify each band area and density in blots. Quantified band intensities were presented as fold of control. Triplicate experiments were performed independently.

Statistical analysis

All differentiation experiments were done using at least three independent groups. Data were shown as the mean ± SD. Group comparisons were made using one-way ANOVA followed by post hoc Tukey test. A P-value < 0.05 was considered statistically significant.

RESULTS

Characteristics of La2O3 NPs and MPs

The irregular sheet structure and sizes of La2O3 MPs and NPs could be seen in Fig. 1. The SEM images in Fig. 1A indicated that NPs were consistent in size of approximately 500 nm (Fig. 1Aa), while most MPs were flake-shaped and approximately 1000 nm (Fig. 1Ab). The TEM images of NPs and MPs in Fig. 1B showed aciniform aggregates and agglomerates in Fig. 1Ba-b and confirm that the size of most NPs was about 500 nm. Agglomerates of La2O3 MPs (Fig. 1Bc) were about 1000 nm. To further understand how La2O3 NPs behave and where they translocate across the digestive tract and then to testes, the hydrodynamic sizes and zeta potential of La2O3 NPs were examined using a Zetasizer to examine the aggregate or distributed status of La2O3 NPs in acidic solution at various pH values (Fed: stomach pH2.98 and duodenum pH4.04; Fasted: stomach pH4.04 and duodenum pH4.74 in mice) and DI water and PBS. The agglomeration of La2O3 NPs at pH of 2.98, 4.04, and 4.74 was approximately 739.72 nm (Fig. 1Ca), 462.38 nm (Fig. 1Cb), and 361.83 nm (Fig. 1Cc), respectively. The measurements in DI H2O and PBS were approximately 284.32 nm (Fig. 1Cd) and 395.71 nm (Fig. 1Ce). The results showed that they accumulate to different size in solutions of different pH values. More importantly, the agglomeration of the La2O3 NPs is decreased with the increase of pH environment. In addition, it could be observed in XRD spectrum that there were sharp characteristic diffraction peaks and no other impurity peaks, which indicated that La2O3 NPs and MPs had high purity and crystallinity (Fig. 1D).

Fig. 1

The characterization of the La2O3 NPs and La2O3 MPs. (A) The SEM images of La2O3 NPs (a) and La2O3 MPs (b) at high magnification, and the particles were in irregular sheet structure. Scale bar = 500 nm. (B) The TEM images of La2O3 NPs (a-b) and La2O3 MPs (c) at high magnification, showing aciniform aggregates and agglomerates. (C) The agglomeration of the La2O3 NPs showed 739.72 nm in pH 2.98 (a), 462.38 nm in pH 4.04 (b), and 361.83 nm in pH 4.74 (c), 284.32 nm in DI H2O (d), and 395.71 nm in PBS (e). (D) The XRD patterns of the La2O3 NPs (a) and La2O3 MPs (b).

The effect of La2O3 NPs and MPs on sperm parameters

As shown in Fig. 2A, after intragastric administration of La2O3 NPs the percentage of sperm count, sperm motility and sperm survival percentages were significantly decreased (P < 0.05), but no statistical significance was attained in the NL and WM groups compared to the controls (P > 0.05). These results demonstrate that La2O3 NPs may induce reproduce toxicity.

Fig. 2

Effects of La2O3 NPs and MPs on mouse on sperm parameters and testicular histology. Changes in sperm count (Aa) and sperm motility percentages (Ab) and sperm survival percentages (Ac) of the mice. Histopathological changes in murine testes caused by intragastric administration of La2O3 NPs for 60 days. The testes from control (Ba), NL (Bb) and WM (Be) groups showed normal morphology and spermatogenesis. In the NM and NH (Bc and Bd) groups, the testes exhibited vacuole-like changes in the spermatogenic epithelium, as indicated by arrows. Moreover, moderate Leydig cells edema (asterisk) were also observed in NM and NH groups (× 400). (Bf) Histogram shows the proportion of seminiferous tubule in mice testes. *Significantly different from vehicle control at P < 0.05; #Significantly different from NH vs. WM group at P < 0.05. The data are presented as the mean ± S.D. for 10 mice per group.

Measurement of lanthanum levels

Organs of testis, liver, kidney, spleen, lung, brain, heart and whole blood were measured for lanthanum contents. As shown in Table 2, compared with the control, the La levels in the testes of mice in the NM and NH groups were significantly higher (P < 0.01). These results suggested that La2O3 NPs could be absorbed and distributed to tissues through the circulatory system and deposited in the testis, liver, kidney, spleen, lung, brain, heart and whole blood.

Table 2. Tissue content of lanthanum from mice treated with La2O3 for 60 days.
Con La2O3 NPs La2O3 MPs
NL NM NH WM
Liver (μg/g) 2.32 ± 0.67 19.37 ± 3.85** 30.37 ± 7.16** 53.65 ± 8.73** 28.42 ± 6.42**∆
Kidney (μg/g) 2.29 ± 0.81 14.74 ± 2.63** 21.62 ± 3.29** 34.82 ± 5.79** 24.85 ± 6.48**∆
Spleen (μg/g) 1.95 ± 0.45 12.47 ± 2.48** 17.82 ± 3.81** 27.32 ± 5.39** 19.68 ± 2.84**∆
Testis (μg/g) 2.56 ± 0.58 9.85 ± 1.12** 15.93 ± 4.75** 27.12 ± 6.95** 16.19 ± 2.74**∆
Lung (μg/g) 3.07 ± 0.93 10.32 ± 2.91** 14.57 ± 2.53** 23.53 ± 6.94** 11.39 ± 3.54**∆
Brain (μg/g) 2.78 ± 0.63 8.49 ± 1.58** 12.49 ± 3.39** 19.51 ± 3.74** 4.28 ± 1.72*∆
Heart (μg/g) 1.65 ± 0.48 8.81 ± 1.23** 10.81 ± 2.21* 16.56 ± 3.13** 10.11 ± 1.45**∆
Whole Blood (μg/mL) 1.12 ± 0.85 19.31 ± 1.86** 37.30 ± 4.82** 61.31 ± 6.39** 29.28 ± 0.66**∆

Values are expressed as mean ± SD for 5 mice per group. *,**Significantly different from vehicle control at P < 0.05 and P < 0.01; ∆ Significantly different from NH vs. WM group at P < 0.05.

Effect of La2O3 NPs and MPs on mice growth, testes coefficient and histopathology

After intragastric administration of La2O3 NPs (2.5, 5, and 10 mg/kg BW) and La2O3 MPs (10 mg/kg BW) for 60 days, mice did not show any apparent changes in growth, activity or performance as compared with control group. The body weight gain across all five groups increased but did not show statistically significant differences in Table 3. Mice in the control (Fig. 2Ba), NL (Fig. 2Bb) and WM (Fig. 2Be) groups had normal testicular architecture and germinal cell arrangement. NM (Fig. 2Bc) and NH (Fig. 2Bd) groups showed vacuolation with disorganized germinal epithelium and disorganization of germ cell layers including sloughing, detachment and vacuolization were markedly increased.

Table 3. Gain of bodyweight and testes coefficient.
Groups N Gain of bodyweight (g) Coefficient
(mg/g)
Con 10 22.47 ± 2.85 3.38 ± 0.31
NL 10 21.68 ± 2.12 3.12 ± 0.47
NM 10 20.65 ± 1.08 3.22 ± 0.42
NH 10 20.76 ± 2.72 3.25 ± 0.29
WM 10 21.22 ± 2.56 3.19 ± 0.23

Effects of La2O3 NPs and MPs on SOD activity, MDA and 8-OHdG levels

The oxidative stress was evaluated by detecting the SOD, MDA and 8-OHdG (Table 4). The enzymatic activities of SOD, as a frontline of antioxidant defense, were significantly reduced in NH group relative to the corresponding control group. In addition, as a lipid peroxidation marker, the MDA levels in the NM and NH groups were markedly elevated (P < 0.05), while the levels in the NL and WM groups were almost equivalent to that of the control group. As 8-OHdG level was an indicator of DNA damage to testes, significant increases were detected in the NH groups compared with that in the control group (P < 0.05).

Table 4. Effects of La2O3 NPs and MPs on SOD activity, MDA and 8-OHdG levels.
Groups N SOD
(U/ng prot)
MDA
(nmol/mg prot)
8-OHdG
(mg/g tissue)
Con 10 85.12 ± 4.11 0.96 ± 0.13 0.42 ± 0.05
NL 10 82.88 ± 8.64 1.01 ± 0.09 0.41 ± 0.08
NM 10 78.75 ± 7.88 1.16 ± 0.15 0.54 ± 0.07
NH 10 67.25 ± 6.62* 1.42 ± 0.17* 0.63 ± 0.06*
WM 10 81.75 ± 5.78 1.06 ± 0.19∆ 0.44 ± 0.07

Values are expressed as mean ± SD for 5 mice per group *Significantly different from vehicle control at P < 0.05; ∆Significantly different from NH vs. WM group at P < 0.05

Effect of La2O3 NPs and MPs on testicular inflammation and apotosis

Compared with the control group (Fig. 3Aa), the number of NF-κB-p65 positive cells was significantly increased in the NM and NH groups (Fig. 3Ac-d, P < 0.05). However, in the NL and WM groups, no significant differences were found compared with the control group (Fig. 3Ab and Fig. 3Ae, P > 0.05). Histogram showed percentages of testis tissues containing NF-κB-p65 cells (Fig. 3Af). La2O3 NPs administration also triggered up-regulation of BAX and C-Caspase-3 (active form (cleaved form, 17 kDa) of caspase-3), and down-regulation of Bcl-2 at the mRNA level in mice testes (Fig. 3B). Compared with the control group, Bcl-2 was down-regulated by 48.38% in the NH group, and BAX and Caspase-3 were up-regulated by 46.76% and 39.72% in the gene levels in NH groups. Likewise, the protein expression in NH groups of Bcl-2 was down-regulated by 39.65%, BAX and Caspase-3 were up-regulated by 37.97% and 32.19% compared with the control groups (Fig. 3Ca-b, P < 0.05). These results indicated that La2O3 NPs could induce inflammation and apoptosis in mouse testis.

Fig. 3

Effects of La2O3 NPs and MPs on mice testicular inflammation and apoptosis. Mice were treated with La2O3 NPs by intragastric administration for 60 days. (A) Immunohistochemical staining of NF-κB-p65 (brown) in testis tissues at × 400 magnification. Intense nuclei staining were detected in the testes of mice under La2O3 NPs exposure at the NM and NH groups. (B) The genes on the mRNA expressions of apoptosis were analyzed by qRT-PCR. (C) Effects of La2O3 NPs and MPs on protein expressions of NF-κB-p65, Bcl-2, BAX and cleaved-caspase-3 (C-caspase-3). β-actin was used as the internal control. The statistical difference is indicated as follows: The data are presented as the mean ± S.D. for 6 mice per group. *Significantly different from vehicle control at P < 0.05; #Significantly different from NH vs. WM group at P < 0.05.

Effects of La2O3 NPs and MPs on immunohistochemistry, BTB and testis-specific genes expressions

To further confirm effects of La2O3 NPs and MPs on immunohistochemistry, BTB and testis-specific genes expressions, the results were exhibited in Fig. 4. As shown for occludin, immunoreactivity was localized along the basal lamina in controls (Fig. 4Aa). An irregular immunoreactivity of the basal lamina was present in La2O3 NPs and MPs-treated mice (Fig. 4Ab-e). qRT-PCR results showed that the mRNA expressions of the BTB-related (Fig. 4Ba-d) and testes-specific genes (Fig. 4Ce-h) were dose-dependently changed. Compared to control group, the experimental groups treated with La2O3 NPs concentrations of 2.5, 5, and 10 mg/kg BW and 10 mg/kg BW MPs, the Occludin, Vim, N-cad, Tesmin, 3β-HSD and Amh mRNA expression levels were decreased by and 36.83%, 46.28%, 41.97%, 53.35%, 47.61% and 52.29% the NH group, respectively (P < 0.05). However, ZO-1 and XRCC-1 genes showed no obvious change (P > 0.05). In addition, the protein expressions of Occludin, Vim, N-cad, Tesmin, 3β-HSD and Amh were decreased in NH groups compared to control group (Fig. 4C).

Fig. 4

Effects of La2O3 NPs and MPs on BTB-related genes and testis-specific genes expressions. Mice were treated with La2O3 NPs and MPs by intragastric administration for 60 days. (A) In the control group (Aa), Occludin immunoreactivity along the basal lamina could be observed (arrow); in the La2O3 NPs and MPs treated groups (Ab-Ae), an irregular Occludin immunoreactivity of the basal lamina was present (arrow). (B) The BTB-related genes (a-d) and testis-specific genes (e-h) were analyzed by qRT-PCR in treated and control testis samples (n = 6). *P < 0.05 vs. control. (C) The results of ZO-1, Occludin, Vim, N-cad, XRCC-1, Tesmin, 3β-HSD and Amh expressions in mouse testicular tissue exposed to La2O3 NPs and MPs were determined by Western blotting. β-actin was used as the internal control. *Significantly different from vehicle control at P < 0.05; #Significantly different from NH vs. WM group at P < 0.05.

DISCUSSION

Nanomaterials are widely used in production and life, and can easily be released and enter human body (Mao et al., 2019; Li et al., 2018). Consequently, the risk of human exposure to La2O3 NPs has increased. The gastrointestinal tract is a route by which these nanoparticles are absorbed, but there is a serious lack of information concerning the effects of NPs on human health and the environment. Several studies have shown that gain in body weight in mice can be used to evaluate adverse reactions to drugs and chemicals (Yang et al., 2018), and organ coefficients are important indices reflecting the injury or influence of foreign substances on organs (Bai et al., 2018). In this study, gain in body weight and the testicular coefficient of animals exposed to La2O3 NPs and MPs did not significantly change (Table 3), but sperm count, sperm motility, and the rate of sperm survival and pathological analysis revealed cytotoxic effects on testicular germ cells, testicular cell apoptosis and structural damage in testicular tissue after exposure to 10 mg/kg La2O3 NP (Fig. 2A-B). It was previously reported that small-sized particles have a greater active surface area than the large-sized particles and they are more active to exert biological or toxicological responses (Johnston et al., 2010), and in consistent with our results that La2O3 NPs had stronger biological toxicity than La2O3 MPs. La levels in the mouse testes significantly increased after the oral administration of La2O3 NPs at different doses and became the material basis for subsequent testicular injury. Based on all these findings, we can deduce that La2O3 NPs were less toxic substances and relevant to their size.

Oxidative stress is an important factor of reproductive toxicity. Testicular damage occurs once the ROS content exceeds the capacity of the antioxidant defence mechanisms. It was further confirmed that NPs induced ROS and inflammatory body activation, thus inducing oxidative stress in the testis, leading to apoptosis of spermatogenic cells (Tsugita et al., 2017). MDA and SOD are important markers of lipid peroxidation and regulators of responses to oxidative stress (Hasgul et al., 2014). 8-OHdG is the marker for oxidatively damaged proteins and DNA in mice (Zhang et al., 2017a). Previous studies reported that administration of NPs to mice could induce oxidative stress, resulting in decreased SOD activity and increased MDA levels in the testes. Ansar et al. (2017) found that NPs caused oxidative stress, as illustrated by a decrease in GSH levels and SOD activities compared with those in the control group. The present study demonstrated that high-dose La2O3 NPs (10 mg/kg) increased MDA and 8-OHdG levels and decrease SOD activity in testes (Table 4). This finding was in accordance with previous reports and indicates that oxidative DNA damage might occur early after exposure (Tuğcu et al., 2010; Ryu et al., 2008; Kinoda et al., 2016). These results suggested that the exposure to La2O3 NPs might cause oxidative stress in mouse testes.

Toxicity of nanoparticles is manifested by inflammation resulting from oxidative stress (Zhang et al., 2017b). Guo et al. (2017) demonstrated that the activation of NF-κB was involved in inflammation in testicular cells. Additionally, NF-κB regulates testicular cell inflammation, and the activation of NF-κB affecting spermatogenesis and testicular functions had been significantly reported (Hedger, 2011; Reyes et al., 2012). As the transcription factor NF-κB plays a critical role in the development of inflammatory response by regulating the expressions of inflammation-associated genes at the transcriptional level, the protein expression and immunohistochemical examination of NF-κB, with an antibody to the activated p65 subunit (Bai et al., 2018). This study demonstrated that NF-κB-p65 was activated in the testes by immunohistochemistry (Fig. 3A). We also examined the activation of apoptotic pathways in the testes using BAX and Caspase-3 as the proapoptotic proteins and Bcl-2 as the antiapoptotic protein (Guo et al., 2017; Lou et al., 2016). Herein, BAX and cleaved-caspase-3 levels increased, while Bcl-2 levels decreased, confirming the enhanced apoptosis of testicular cells induced by La2O3 NPs (Fig. 3B-C). These results demonstrated that repeated exposure to high doses of La2O3 NPs could induce inflammatory response and apoptosis of mouse testes, which was a physiological response and adapting mechanism for alien invasion.

Many recent in vivo and in vitro studies indicated that most NPs had adverse or toxic effects on germ cells (Braydich-Stolle et al., 2010; Khorsandi et al., 2017). The administration of NPs to mice resulted in their accumulation in testes, indicating that they easily pass through the BTB (Orazizadeh et al., 2014). The BTB prevented the entry of harmful endogenous substrates and exogenous contaminants, thereby providing a suitable environment for spermatogenesis. To further investigate the cause of changes in testicular histology in La2O3 NP-treated mice, we performed qRT-PCR to assess the expression of genes related to the BTB in mouse testes in response to La2O3 NP exposure. Tight junctions were composed of several different proteins such as ZO-1, occludin, Vim and N-cad (Abbott, 2013; Birukova et al., 2011; Li et al., 2015). The tight junction protein ZO-1 regulated cell proliferation and gene expression (Georgiadis et al., 2010). Occludin was associated with the formation of epididymal tight junctions (Long et al., 2017; Fang et al., 2017). Vim provided physical support to the BTB and mainly contributed to controlling cell shape changes and cell mechanisms. The sperm quantity and quality was influenced by the changes in expression and distribution of Vim (Somanath et al., 2004). N-cad was a junction adhesion molecule that was mainly distributed between the SC in the basal portion of the testis and involved in cell adhesion and signal transduction. A study had shown that the lack of N-cad could affect sperm production causing germ cell apoptosis (Carette et al., 2013). Our results indicated that administration of high-dose (10 mg/Kg BW) La2O3 NPs could downregulate the expressions of Occludin, Vim and N-cad both in gene and protein levels, suggesting that the exposure to La2O3 NPs may influence BTB in mice.

Furthermore, we examined the mRNA levels of testis-specific genes such as XRCC1, Tesmin, 3β-HSD and Amh. XRCC1 was involved in the efficient repair of single-strand breaks in the DNA caused by exposure to DNA-damaging agents, and it may play a role in DNA processing during meiogenesis and recombination in germ cells (Carette et al., 2013). Tesmin was expressed in all stages of meiotic prophase I excluding preleptonema and leptonema in male mouse spermatocytes and involved in stress response, sperm maturation, and/or morphogenesis (Olesen et al., 2004). 3β-HSD was mainly found in the Leydig cells from which steroid hormones were biosynthesized in the testes (Kim et al., 2007). Amh was a homodimeric glycoprotein of the transforming growth factor-β superfamily and synthesized by SCs in the mouse testis (Garcia et al., 2014). The present study suggested that significant decreases in the expression levels of Tesmin, 3β-HSD and Amh in mice testes, supporting the alterations of testis-specific gene expressions in La2O3-exposed mice, and resulted in testicular dysfunction in mice.

In conclusion, repeated exposure to high-dose (10 mg/Kg BW) La2O3 NPs for 60 days resulted in BTB and testis-specific related genes changes, moderate oxidative stress, inflammatory responses and apoptosis in testicle tissue. However, repeated low doses (2.5 mg/Kg BW) of La2O3 NPs had no significant reproductive toxicity. To have a better understanding of the mechanism of the La2O3 NPs toxicity in the testis, further studies involving different administrations must be assessed as well.

ACKNOWLEDGMENTS

This work was supported by National Natural Science Foundation of China (Nos. 81302323), The Natural Science Foundation of Hebei Province of China (C2019209478), Key Projects of Hebei Province (ZD2016007); and the PhD Research Startup Foundation of North China University of Science and Technology.

Conflict of interest

The authors declare that there is no conflict of interest.

REFERENCES
 
2020 The Japanese Society of Toxicology
feedback
Top