The Journal of Toxicological Sciences
Online ISSN : 1880-3989
Print ISSN : 0388-1350
ISSN-L : 0388-1350
Letter
Arsenite induces tissue factor synthesis through Nrf2 activation in cultured human aortic smooth muscle cells
Tsuyoshi Nakano, Tsutomu Takahashi, Chika Yamamoto, Toshiyuki Kaji, Yasuyuki Fujiwara
著者情報
ジャーナル フリー HTML

2021 年 46 巻 4 号 p. 187-192

詳細
Abstract

Tissue factor (TF) is the initiator of the coagulation cascade, constitutively expressed in subendothelial cells such as vascular smooth muscle cells and initiating rapid coagulation when the vascular vessel is damaged. TF has been shown to be involved in the development and progression of atherosclerosis. Arsenic, an environmental pollutant, is related to the progression of atherosclerosis, although the pathogenic mechanisms are not fully elucidated. In the present study, we investigated the effect of arsenite on the expression of TF in human aortic smooth muscle cells (HASMCs) and the underlying molecular mechanisms. We found that (1) arsenite stimulated TF synthesis and activated the nuclear factor erythroid 2-related factor 2 (Nrf2) pathway in HASMCs, (2) sulforaphane, an Nrf2 activator, also stimulated TF synthesis in HASMCs, and (3) arsenite-induced upregulation of TF synthesis was prevented by Nrf2 knockdown in HASMCs. These results suggest that arsenite promotes TF synthesis by activating the Nrf2 pathway in HASMCs and that the induction of TF expression by arsenite may be related to the progression of atherosclerosis.

INTRODUCTION

Tissue factor (TF) is the high-affinity receptor for the coagulation factor VII/VIIa and the formation of a TF-factor VIIa complex triggers blood coagulation (Grover and Mackman, 2018, 2020). The TF-factor VIIa complex activates factor X and factor IX, resulting in thrombin generation and, ultimately, the generation of a thrombus (Steffel et al., 2006; Grover and Mackman, 2018). Vascular smooth muscle cells express TF and contribute to the rapid initiation of coagulation when vascular tissue and vascular endothelial cells are damaged (Steffel et al., 2006). Previous reports have suggested that blood coagulation proteins are actively involved in the pathogenesis of atherosclerosis (Borissoff et al., 2011; Loeffen et al., 2012; Kleinegris et al., 2012). TF has also been shown to be involved in the pathogenesis of several vascular diseases, including atherosclerosis and atherothrombosis (Steffel et al., 2006; Grover and Mackman, 2020), and to accumulate in foam cell-rich areas within atherosclerotic plaques (Wilcox et al., 1989). This finding suggests that in the event of atherosclerotic plaque rupture, the TF accumulated in the plaque may contribute to the hyperthrombogenic state.

Arsenic is a toxic metalloid ubiquitously present in the environment. Epidemiological studies have shown that there is a correlation between arsenic exposure and cardiovascular diseases, including atherosclerosis (Moon et al., 2013; Chen et al., 1988; Engel et al., 1994). Animal studies have also demonstrated that exposure to arsenite, an inorganic arsenic compound, accelerates the progression of arteriosclerosis (Simeonova et al., 2003; Makhani et al., 2018). Because dysfunction of the blood coagulation/fibrinolytic system is known to contribute to the development of atherosclerosis (Tanaka and Sueishi, 1993; Sueishi et al., 1998; Juhan-Vague and Collen, 1992), we previously investigated the effect of arsenite on fibrinolytic activity in vascular endothelial cells and found that arsenite inhibits the tissue-type plasminogen activator (t-PA)-mediated fibrinolytic activity through the selective inhibition of t-PA synthesis (Nakano et al., 2021). Furthermore, we examined the effect of arsenite on the expression of proteoglycan with anti-thrombin activity, heparan sulfate proteoglycan perlecan (Mertens et al., 1992), and chondroitin/dermatan sulfate proteoglycan biglycan (Whinna et al., 1993) in vascular endothelial cells, and found that arsenite inhibits the synthesis of both perlecan and biglycan (Wu et al., 2020; Fujiwara et al., 2008). These findings indicate that arsenite can reduce both fibrinolytic and anticoagulant activity of vascular tissue by suppressing the synthesis of t-PA and proteoglycans such as perlecan and biglycan in vascular endothelial cells.

TF is expressed in vascular smooth muscle cells within atherosclerotic plaques (Thiruvikraman et al., 1996) and TF expression in rat arterial smooth muscle cells has been shown to be upregulated after balloon injury (Marmur et al., 1993). In addition, the expression of TF in cultured vascular smooth muscle cells has been shown to be induced by several mediators, such as thrombin, platelet-derived growth factor, and aggregated low-density lipoprotein (Schecter et al., 1997; Llorente-Cortés et al., 2004; Taubman et al., 1993; Kamimura et al., 2004; Herkert et al., 2002). However, the effect of arsenite on the expression of TF in vascular smooth muscle cells is unclear. The present study was undertaken to identify the influence of arsenite on the expression of TF in vascular smooth muscle cells and its molecular mechanisms.

MATERIALS AND METHODS

Cell culture

Human aortic smooth muscle cells (HASMCs, Cell Systems, Kirkland, WA, USA) were cultured until confluent in HuMedia-SG2 (Kurabo, Osaka, Japan) using collagen-coated 24- or 6-well culture plates (AGC Techno Glass, Shizuoka, Japan) at 37°C in a humidified incubator under 5% CO2. The cells were treated with sodium arsenite (0, 1, 2, or 5 µM) or sulforaphane (0, 1, 2, 5, or 10 µM) at 37°C for 24 hr in fresh HuMedia-SG2.

siRNA-mediated knockdown

Transfection of HASMCs with control siRNA (Sigma-Aldrich, St. Louis, MO, USA) or nuclear factor erythroid 2-related factor 2 (Nrf2) siRNA (CAAACUGACAGAAGUUGACAAUUAU; Thermo Fisher Scientific, Waltham, MA, USA) was performed using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific) according to the manufacturer’s protocol, as described previously (Nakano et al., 2021).

Total RNA extraction and real-time polymerase chain reaction

Total RNA was extracted from HASMCs treated with sodium arsenite or sulforaphane using ISOGEN II (Nippon Gene, Tokyo, Japan). First-strand cDNA synthesis and real-time polymerase chain reaction were performed in accordance with methods described previously (Nakano et al., 2021). Oligonucleotide sequences of the primers (forward and reverse, respectively) were 5′-TGAAGCAGACGTACTTGGCAC-3′ and 5′-GGGGAGTTCTCATACAGAGGC-3′ for the human TF gene, 5′-TCGTCTGTATTCCCACTTCCTTC-3′ and 5′-AGCATCTACTTCATCAGCACCATC-3′ for the human NAD(P)H quinone dehydrogenase 1 (NQO1) gene, 5′-GGTTCCAAGTCCAGAAGCCA-3′ and 5′-GGTTGGGGTCTTCTGTGGAG-3′ for the human Nrf2 gene, and 5′-TGGCACCCAGCACAATGAA-3′ and 5′-CTAAGTCATAGTCCGCCTAGAAGCA-3′ for the human β-actin gene.

Immunoblotting

Immunoblotting was performed as described previously (Takahashi et al., 2020). Briefly, HASMCs were lysed by RIPA buffer (1 mM Tris-HCl [pH7.4], 1% NP-40, 0.1% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 150 mM NaCl, and 1 mM EDTA) supplemented with protease inhibitors (cOmplete™ ULTRA Tablets, Mini; Roche, Basel, Switzerland). Protein concentrations in the cell lysates were determined using a DC protein assay kit (Bio-Rad, Hercules, CA, USA). Aliquots of lysates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to an Immobilon-P membrane (Merck KGaA, Darmstadt, Germany). The membrane was reacted with primary antibodies against TF/CD142 (Thermo Fisher Scientific), Nrf2 (Novus Biologicals, Littleton, CO, USA), β-actin (Fujifilm Wako Pure Chemical Co., Ltd., Osaka, Japan), and horseradish peroxidase-coupled secondary antibodies (SeraCare Life Sciences, Inc., Milford, MA, USA).

Statistical analysis

Data were analyzed for statistical significance by one-way analysis of variance with the post-hoc Bonferroni/Dunn’s multiple comparison test. Differences between groups were considered significant at p < 0.05.

RESULTS AND DISCUSSION

We previously showed that arsenite reduces t-PA fibrinolytic activity by selective inhibition of t-PA synthesis in vascular endothelial cells and that inhibition of t-PA synthesis is mediated by activation of the Nrf2 pathway (Takahashi et al., 2020; Nakano et al., 2021). In the present study, we investigated the induction of TF mRNA and protein by arsenite in HASMCs and its possible involvement in the Nrf2 pathway. First, transcriptional induction was determined by evaluating the mRNA expression of TF and NQO1, a downstream target of Nrf2. Figure 1a shows that arsenite upregulated mRNA expression of TF in a concentration-dependent manner. Similarly, the expression of NQO1 mRNA was upregulated by arsenite (Fig. 1b). In addition, the expression of TF and Nrf2 proteins was upregulated by arsenite (Fig. 1c). These results indicate that arsenite promotes TF synthesis and activates the Nrf2 pathway in HASMCs. Since induction of TF expression in vascular smooth muscle cells increases TF activity (Schecter et al., 1997), it is possible that arsenite may increase coagulation activity through TF synthesis in vascular smooth muscle cells. TF has been shown to induce the migration and proliferation of vascular smooth muscle cells and was suggested to be involved in atherogenesis, hemostasis, and thrombosis (Sato et al., 1996; Cirillo et al., 2004). Thus, arsenite may promote the migration and proliferation of vascular smooth muscle cells via TF synthesis, thereby progressing atherosclerosis. However, whether arsenite stimulates migration and proliferation through TF synthesis in vascular smooth muscle cells requires further study.

Fig. 1

Expression of tissue factor (TF) in human aortic smooth muscle cells (HASMCs) incubated with arsenite (0, 1, 2, or 5 µM) for 24 hr. (a) Expression of TF mRNA in HASMCs after exposure to arsenite. (b) Expression of NQO1 mRNA in HASMCs after exposure to arsenite. Data are means ± S.D. of three replicates. *p < 0.05, **p < 0.01 from controls. (c) Immunoblots of TF and Nrf2 protein expression in HASMCs after exposure to arsenite.

Next, we examined the effect of sulforaphane, an Nrf2 activator, on the induction of TF mRNA and protein in HASMCs, because activation of the Nrf2 pathway by arsenite in the cells was confirmed. Sulforaphane increased TF mRNA and protein levels (Fig. 2a and c). NQO1 mRNA and Nrf2 protein levels were also elevated by sulforaphane (Fig. 2b and c). These results suggest that activation of the Nrf2 pathway may be involved in TF expression in HASMCs. To confirm this involvement of the Nrf2 pathway in the stimulation of TF synthesis by arsenite, we prepared Nrf2-knockdown HASMCs by Nrf2 siRNA transfection. In the transfected cells, both Nrf2 mRNA and protein levels decreased significantly; arsenite treatment did not increase Nrf2 mRNA or protein levels (Fig. 3a and d). In addition, arsenite did not increase NQO1 mRNA in Nrf2-knockdown HASMCs (Fig. 3b). Moreover, the elevation of TF mRNA and protein levels in HASMCs by arsenite was prevented by Nrf2 knockdown (Fig. 3c and d). These results indicate that arsenite stimulates TF synthesis by activating the Nrf2 pathway in HASMCs, and suggest that arsenite not only inhibits fibrinolytic activity by activating the Nrf2 pathway in vascular endothelial cells (Nakano et al., 2021) but also promotes coagulation in vascular smooth muscle cells by that mechanism, resulting in blood coagulation and subsequent thrombotic vascular lesions, including atherosclerosis.

Fig. 2

Expression of tissue factor (TF) in human aortic smooth muscle cells (HASMCs) incubated with sulforaphane (0, 1, 2, 5, or 10 µM) for 24 hr. (a) Expression of TF mRNA in HASMCs after exposure to sulforaphane. (b) Expression of NQO1 mRNA in HASMCs after exposure to sulforaphane. Data are means ± S.D. of three replicates. **p < 0.01 from controls. (c) Immunoblots of TF and Nrf2 protein expression in HASMCs after exposure to sulforaphane.

Fig. 3

Possible involvement of the nuclear factor erythroid 2-related factor 2 (Nrf2) pathway in the induction of tissue factor (TF) expression by arsenite in human aortic smooth muscle cells (HASMCs). Cells transfected with control siRNA (siCon) or Nrf2 siRNA (siNrf2) were incubated with arsenite (0, 2, or 5 µM) for 24 hr. (a) Expression of Nrf2 mRNA in HASMCs after exposure to arsenite. (b) Expression of NQO1 mRNA in HASMCs after exposure to arsenite. (c) Expression of TF mRNA in HASMCs after exposure to arsenite. Data are means ± S.D. of three replicates. *p < 0.05, **p < 0.01 from controls; ##p < 0.01 from corresponding siCon. (d) Immunoblots of TF and Nrf2 protein expression in HASMCs after exposure to arsenite.

In human vascular smooth muscle cells, p38 and PI 3-kinase have been shown to relate to thrombin-induced TF expression (Herkert et al., 2002). In addition, in rat vascular smooth muscle cells, the Src family kinases/ERK/Egr-1 signaling pathway is involved in platelet-derived growth factor-induced TF expression (Kamimura et al., 2004). In the present study, we found that the Nrf2 pathway is also involved in TF expression in vascular smooth muscle cells, although more detailed mechanisms contributing to the arsenite-induced stimulation of TF synthesis by this pathway are still unclear. Exposure to the toxic metals lead and cadmium is a known risk factor for cardiovascular disease (Nigra et al., 2016) and induces atherosclerosis in laboratory animals (Revis et al., 1981; Messner and Bernhard, 2010). We previously showed that lead and cadmium decrease fibrinolytic activity (Kaji et al., 1992; Yamamoto et al., 1993) and activate the Nrf2 pathway (Shinkai and Kaji, 2012; Shinkai et al., 2016) in vascular endothelial cells. Thus, it is possible that lead and cadmium also stimulate TF synthesis by activating the Nrf2 pathway, similar to arsenite, in vascular smooth muscle cells. Research on the effects of lead and cadmium on coagulation in vascular smooth muscle cells should be performed to determine the cytotoxic effects and molecular mechanisms that mediate the toxicity of these metals.

The present study revealed that (1) arsenite stimulates TF synthesis and activates the Nrf2 pathway in HASMCs, (2) sulforaphane, an Nrf2 activator, also stimulates TF synthesis in HASMCs, and (3) arsenite-induced upregulation of TF synthesis is prevented by Nrf2 knockdown in HASMCs. These results clearly indicate that arsenite promotes TF synthesis by activating the Nrf2 pathway in HASMCs. Because TF has been implicated in the pathogenesis of atherosclerosis (Steffel et al., 2006; Grover and Mackman, 2020), the induction of TF expression by arsenite in vascular smooth muscle cells may be related to atherosclerosis progression under conditions associated with vascular damage, such as during atherosclerotic plaque rupture. Further studies should be performed to clarify whether there are differences in the activity and induction of TF in vascular smooth muscle cells after exposure to cadmium and lead, which are known as risk factors for atherosclerosis and activate the Nrf2 pathway.

ACKNOWLEDGMENTS

This research was funded by JSPS KAKENHI (C) Grant Numbers 17K08391 (to T.T.) and 20K12185 (to Y.F.) We thank Edanz Group (https://en-author-services.edanz.com/) for editing a draft of this manuscript.

Conflict of interest

The authors declare that there is no conflict of interest.

REFERENCES
 
2021 The Japanese Society of Toxicology
feedback
Top