The Journal of Toxicological Sciences
Online ISSN : 1880-3989
Print ISSN : 0388-1350
ISSN-L : 0388-1350
Original Article
Oxycodone alleviates LPS-induced neuroinflammation by regulating the CREB/miR-181c/PDCD4 axis
QingYun Tan, Kai Zhang, QingDong Wang, Rongjia Zang
著者情報
ジャーナル フリー HTML
電子付録

2024 年 49 巻 10 号 p. 435-446

詳細
Abstract

Background: Neuroinflammation plays a critical role in various neurological disorders. Oxycodone has anti-inflammatory properties. The purpose of this work was to look into the effect of oxycodone in controlling lipopolysaccharide (LPS)-induced neuroinflammation in microglia. Methods: LPS-induced HMC3 cells were subjected to oxycodone (2.5, 5, 10 and 20 μg/mL). The mRNA and protein expressions were examined by qRT-PCR and western blotting. TNF-α, IL-1β, IL-6, and IL-8 levels were assessed by ELISA. MTT assay was adopted to measure cell viability. The interactions between CREB, miR-181c and PDCD4 were analyzed by dual-luciferase reporter assay, ChIP and/or RIP assays. Results: Oxycodone treatment alleviated LPS-induced inflammation in HMC3 cells and increased p-CREB level, but reduced PDCD4 and iNOS levels in LPS-treated cells. Mechanistically, oxycodone mitigated LPS-induced neuroinflammation by upregulating miR-181c. In addition, CREB promoted miR-181c expression by directly binding to the MIR181C promoter, and miR-181c inhibited PDCD4 expression by directly binding to PDCD4 3’UTR. As expected, oxycodone alleviated LPS-induced neuroinflammation by regulating the CREB/miR-181c/PDCD4 axis. Conclusion: Oxycodone attenuated LPS-induced neuroinflammation in microglia by regulating the CREB/miR-181c/PDCD4 axis. These findings proved that oxycodone is a potential drug for treating neuroinflammation and elucidate the mechanisms involved.

INTRODUCTION

Neuroinflammation generally denotes an inflammatory response in the peripheral and central nervous system, triggered by various pathological factors such as infection, trauma, ischemia, and exposure to toxins (Gao et al., 2021). Neuroinflammation is a complex innate immune response characterized by the generation of pro-inflammatory cytokines and chemokines to eliminate pathogens or damaged cells (Leng and Edison, 2021; Smith et al., 2012). Understanding the cellular and molecular controls of neuroinflammation may give useful hints for creating new treatments for central nervous system (CNS) diseases. Microglia are the resident phagocytic cells of the innate immune system and the most active cells in the CNS, which are responsible for regulating brain development, maintaining neural networks, and regulating CNS injury and infection (Colonna and Butovsky, 2017). Prolonged activation of microglia can lead to excessive and chronic inflammation, causing damage to surrounding neurons and promoting neurodegeneration (Lyman et al., 2014). Therefore, a deeper understanding of the role of microglia in neuroinflammation and the molecular mechanisms involved is of great help in developing new therapeutic strategies for neuroinflammation.

Oxycodone is a semi-synthetic opioid analgesic prescribed for the management of acute pain, pain associated with cancer and chronic nonmalignant pain (Kinnunen et al., 2019). As widely described, oxycodone presents anti-inflammatory properties under different pathological conditions. As evidence, Li et al. revealed that oxycodone attenuated lung inflammation in acute lung injury rats (Li et al., 2021). Notably, a previous study showed that oxycodone reduced lipopolysaccharide (LPS)-mediated neuroinflammation in Sprague-Dawley rats through downregulation of nuclear factor-κB (NF-κB) (Zhou et al., 2020). However, the anti-inflammatory properties of oxycodone in microglia have not been fully understood, which deserves further research.

MicroRNAs (miRNAs) refer to non-coding RNAs with a length of about 22 nucleotides (nts) that regulate gene expression post-transcriptionally (Hill and Tran, 2021). It has been widely illustrated that miRNAs are involved in regulating neuroinflammation. For example, miR-155-5p upregulation exacerbated neuroinflammation in a chronic migraine mouse model (Wen et al., 2021). MiR-181c was overexpressed in the brain and has been reported to be associated with apoptosis and inflammation (Chen et al., 2004). As revealed by Zhang et al., miR-181c upregulation markedly inhibited hypoxia and glucose deficiency induced inflammation in microglia (Zhang et al., 2015). Additionally, miR-181c was downregulated in activated microglia (Zhang et al., 2012). Nevertheless, the involvement of miR-181c in oxycodone-mediated anti-inflammatory effects in microglia remains unknown. Cyclic adenosine effector element binding protein (CREB) is a transcription factor that governs neuronal development and neurogenesis (Sharma and Singh, 2020). CREB activation has been shown to attenuate neuroinflammation in BV2 microglial cells (Park et al., 2022). More importantly, oxycodone induced phosphorylation of CREB and ERK in the nucleus ambiguous and hippocampus (Liu et al., 2009). It is suggested that oxycodone may exert anti-neuroinflammatory effects by regulating CREB. In the current research, from the prediction of the hTFtarget database (http://bioinfo.life.hust.edu.cn/hTFtarget), CREB could transcriptionally regulate miR-181c. Therefore, it’s speculated that oxycodone may play an anti-neuroinflammatory role by phosphorylating CREB and thus upregulating miR-181c.

Programmed cell death factor 4 (PDCD4) is a newly discovered tumor suppressor gene related to cell cycle and apoptosis (Cai et al., 2022). PDCD4 has been confirmed as a central regulatory molecule to promote microglia inflammatory activation in the CNS (Chen et al., 2022; Lu et al., 2020). Herein, PDCD4 was predicted to have a possible binding site with miR-181c using the starbase database (https://rnasysu.com/encori/). It is suggested that miR-181c may target and regulate PDCD4 to inhibit microglial cell neuroinflammation.

Based on these findings, we proposed the hypothesis that oxycodone exerted its anti-neuroinflammatory effects by phosphorylating CREB, leading to the upregulation of miR-181c, which subsequently inhibits PDCD4 expression. Our study provides a potential drug for treating neuroinflammation and elucidates its mechanism of action.

MATERIALS AND METHODS

Cell culture

The Cell Bank of the Chinese Academy of Medical Science (Shanghai, China) provided the human microglia (HMC3 cells). Cells were grown in DMEM (Gibco, MD, USA) containing 10% FBS (Gibco) and 1% penicillin-streptomycin (Gibco) at 37°C with 5% CO2. HMC3 cells were pre-treated with 100 ng/mL LPS (Sigma-Aldrich, MO, USA) for 24 hr and then subjected to different concentrations of oxycodone (2.5, 5, 10, and 20 μg/mL). Cells in the control group were treated with serum-free media. Besides, in order to inhibit CREB, cells were incubated with 100 nM 653-47 (Absin, Shanghai, China, abs828572) for 3 hr following LPS induction. In addition, in order to promote CREB phosphorylation, cells were incubated with 5 μg/mL protein kinase A (PKA) (Sigma-Aldrich; P5511) for 6 hr following LPS induction.

Cell transfection

GenePharma (Shanghai, China) provided miR-181c mimics/inhibitor, the overexpression plasmids of PDCD4 (oe-PDCD4) and the short hairpin RNA (shRNA) targeting PDCD4 (sh-PDCD4) as well as their negative controls. They were transfected into HMC3 cells using Lipofectamine 3000 (Invitrogen, CA, USA). In brief, cells were plated 24 hr before transfection in 24-well culture plates at a density of 3 × 104 cells per/well. Cells were switched to growth medium with 10% FBS without antibiotics before transfection. 2.5 pmol of shRNAs, or 25 nM miRNA miR-181c mimics/inhibitor was first mixed with the reagent P3000 in Opti-MEM™ Reduced Serum Medium, and then added to Opti-MEM™ Reduced Serum Medium containing Lipofectamine 3000. Cells were washed with PBS, and 500 µL transfection mixture was added to each well. After 48 hr, the transfection efficiency was detected using real-time quantitative polymerase chain reaction (RT-qPCR). The sequences of miR-181c inhibitor were (5' to 3'): TCTCCTGGGTGTCCAAAAAG. The sequences of sh-PDCD4 were listed as follows (5' to 3'): AATTGCCTCCATTAACGAAGCTAGAATCAAGAGTTCTAGCTTCGTTAATGGAGGTTTTTT.

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay

Cells were seeded into 96-well plate at a density of 5 × 103 cell/well. After 24 hr of culture, cells were incubated with 10 µL MTT reagent (Sangon, Shanghai, China) for another 4 hr. Thereafter, 100 µL dimethyl sulfoxide was added to dissolve the formazan. The optical density was measured at 490 nm using a spectrophotometer (Thermo Fisher Scientific, MA, USA).

RT-qPCR

Cells were lysed in TRIzol (Invitrogen), and the NanoDrop 2000 was applied for RNA concentration and quality quantification. RNA was reverse transcribed into cDNA using the Total RNA (1 μg) was reversely transcribed into cDNA with PrimeScript™ RT Kit (Takara, Tokyo, Japan). RT-qPCR was performed in an ABI7500 system using the SYBR (ThermoFisher Scientific, A25743). RT-qPCR was performed in triplicate with the following protocol: 2 min at 94°C, followed by 35 cycles (30 sec at 94°C and 45 sec at 55°C). As the reference gene, U6 was employed. The data were analyzed using the 2−ΔΔCT method. The primers were listed as follows (5' to 3'):

miR-181c (F): TCTCCTGGGTGTCCAAAAAG,

miR-181c (R): ACCCACCGACAACAATGAAT;

U6 (F): CTCGCTTCGGCAGCACA,

U6 (R): AACGCTTCACGAATTTGCGT.

Western blot

The proteins were separated using RIPA (Beyotime, Shanghai, China), and protein concentration was measured using a BCA kit (Beyotime). Subsequently, total protein (20 μg) was isolated by 10% SDS-PAGE and transferred to a PVDF membrane (Millipore, MA, USA). The membranes were blocked with 5% non-fat milk and incubated overnight with antibodies against anti-CREB (ab32515), anti-p-CREB (ab32096), anti-PDCD4 (ab80950), anti-iNOS (ab178945) and anti-β-actin (ab8226), then hybridized for 60 min with the secondary antibody. ECL (Beyotime) was used to evaluate the bands. Image J was used to evaluate the grayscale of the protein bands. All antibodies were purchased from Abcam (Cambridge, UK) and diluted according to the instructions.

Enzyme-linked immunosorbent assay (ELISA)

TNF-α, IL-1β, IL-6 and IL-8 levels in cell supernatant were measured using the human TNF-α ELISA kit (Abcam, ab181421), the human IL-1β ELISA kit (Abcam, ab214025), the human IL-6 ELISA kit (Abcam, ab178013) and the human IL-8 ELISA kit (Abcam, ab214030). All operations were strictly performed according to the instructions. In brief, diluted samples were supplemented into the reaction well of the enzyme label plate with 100 μL/well. Negative and positive controls were set up. Each well was diluted with 100 μL diluted enzyme conjugates at 37ºC for 30 min. After washing and patting, the samples were added with 100 μL horseradish peroxidase substrate solution at 37ºC for 10 to 20 min, avoiding exposure to light. When the positive control presented evident color change or the NC presented mild color change, 50 μL termination solution was added to stop the reaction. The optical density was measured at 450 nm using a spectrophotometer (Thermo Fisher Scientific).

Dual-luciferase reporter assay

Wild-type (WT) and mutant (MUT) promoter sequence fragments of MIR181C containing CREB binding site were amplified by PCR and inserted into the pGL3 reporter plasmids (Promega, WI, USA). Then, cells were co-transfected with the above plasmids and oe-NC or oe-CREB. To detect the interaction between PDCD4 3’UTR and MIR181C, WT and MUT PDCD4 3’UTR sequence fragments containing MIR181C binding site were amplified by PCR and inserted into the pGL3 reporter plasmids (Promega). Then, cells were co-transfected with the above plasmids and mimics NC or MIR181C mimics by Lipofectamine™ 3000. After incubating for 24 hr, the luciferase activity was measured with Dual-Luciferase Reporter Assay System (Promega). The Renilla luciferase activity is used for internal normalization.

Chromatin immunoprecipitation (ChIP)

HMC3 cells were fixed with 1% formaldehyde for 5 min to induce DNA–protein cross-linking. Cell lysate was then ultrasonically treated to produce chromatin fragments, and incubated with anti-CREB antibody (1:500, ab32515, Abcam) or IgG control. Pierce protein A/G beads (Thermo Fisher Scientific) were used to isolate chromatin-antibody complexes. DNA was purified and analyzed using RT-qPCR.

RNA immunoprecipitation (RIP)

RIP assay was performed using the MagnaRIP RNA-binding Immunoprecipitation Kit (Millipore). In brief, a complete RIP lysis buffer (Millipore) was used to lyse the cells. Cells were lysed with a complete RIP lysis buffer. Cell extract was incubated with anti-Ago2 antibody (Millipore) or negative control IgG (Millipore) at 4°C for 6 hr, and then incubated with protein A/G magnetic beads (Thermo Fisher Scientific) for 1 hr. RNA was purified from the mRNA-bead-antibody complex and subjected to RT-qPCR analysis.

Statistical analysis

GraphPad Prism 7 software (CA, USA) was used for all statistical analyses. For two-group comparisons with normal and non-normal distributions, the two-tailed Student's t-test and Mann-Whitney U test were employed. For non-parametric and parametric multi-group comparisons, the Kruskal-Wallis test and one-way ANOVA with Tukey's multiple comparison test were employed, respectively. P-values less than 0.05 were deemed statistically significant.

RESULTS

Oxycodone alleviated LPS-induced inflammation in microglia cells

To investigate the role of oxycodone in regulating neuroinflammation, LPS was employed to induce inflammation in microglia cells, and then cells were treated with different concentrations of oxycodone (2.5, 5, 10 and 20 μg/mL). As shown in Fig. 1A, oxycodone treatment didn’t affect LPS-treated HMC3 cell viability. The expression of miR-181c in HMC3 cells was significantly reduced by LPS, but oxycodone addition increased miR-181c level concentration independently (Fig. 1B). Simultaneously, the release of inflammatory factors (TNF-α, IL-1β, IL-6, and IL-8) were markedly increased by LPS stimulation, while these results were eliminated by oxycodone treatment (Fig. 1C). Furthermore, LPS stimulation markedly reduced p-CREB level while elevated PDCD4 and iNOS levels in HMC3 cells, which were reversed by oxycodone treatment (Fig. 1D). Collectively, LPS-induced inflammation in microglia cells was mitigated by oxycodone administration.

Fig. 1

Oxycodone antagonized LPS-induced inflammatory responses in HMC3 cells. HMC3 cells were co-treated with 100 ng/mL LPS and different concentrations of oxycodone (2.5, 5, 10, and 20 μg/mL). (A) Cell viability was assessed using MTT assay. (B) qRT-PCR was employed to examine the expression of miR-181c. (C) ELISA was utilized to determine the concentrations of pro-inflammatory cytokines, including TNF-α, IL-1β, IL-6, and IL-8. (D) The protein levels of p-CREB, CREB, PDCD4, and iNOS were evaluated through Western blotting. β-Actin was used as a loading control. The measurement data was presented as mean ± SD. All data was obtained from at least three replicate experiments. *P < 0.05, **P < 0.01, and ***P < 0.001.

Oxycodone alleviated LPS-induced neuroinflammation by upregulating miR-181c

To examine whether oxycodone is involved in LPS-induced neuroinflammation by regulating miR-181c, LPS-treated (100 ng/mL) HMC3 cells transfected with miR-181c mimics and/or administrated with oxycodone (10 μg/mL), both miR-181c mimics and oxycodone could increase miR-181c expression in LPS-induced HMC3 cells (Fig. 2A). Notably, a further elevation in miR-181c expression was observed in miR-181c overexpression cells treated with oxycodone (Fig. 2A). ELISA subsequently revealed that both miR-181c overexpression and oxycodone treatment ameliorated LPS-mediated rise in TNF-α, IL-1β, IL-6, and IL-8 secretion levels in HMC3 cells, while the combination of oxycodone and miR-181c overexpression demonstrated a further reduction in inflammatory cytokine levels in LPS-induced HMC3 cells (Fig. 2B). As illustrated in Fig. 2C, oxycodone administration led to an upregulation of p-CREB, along with downregulation of PDCD4 and iNOS in LPS-activated HMC3 cells. Similar observations were noted when transfecting LPS-activated HMC3 cells with miR-181c mimics, but miR-181c overexpression did not affect the p-CREB level. Furthermore, a further reduction of PDCD4 and iNOS protein levels was observed upon combining oxycodone treatment with miR-181c overexpression (Fig. 2C). Taken together, oxycodone alleviated LPS-induced inflammation in LPS-induced microglia cells by elevating miR-181c.

Fig. 2

Oxycodone upregulated miR-181c to inhibit LPS-induced neuroinflammation in HMC3 cells. HMC3 cells were transfected with miR-181c mimics or mimics NC, respectively, and HMC3 cells were treated with 100 ng/mL LPS and 20 μg/mL oxycodone for 24 hr after transfection. (A) RT-qPCR was used to detect miR-181c expression. (B) ELISA was used to detect TNF-α, IL-1β, IL-6, and IL-8 in the cell culture supernatant of HMC3 cells. (C) Western blotting was applied to detect the expression levels of p-CREB, CREB, PDCD4, and iNOS. β-Actin was used as a loading control. The measurement data was presented as mean ± SD. All data was obtained from at least three replicate experiments. *P < 0.05, **P < 0.01, and ***P < 0.001.

CREB transcriptionally regulated miR-181c, and miR-181c directly bound with PDCD4 promoter

As predicted by the JASPAR (http://jaspar.genereg.net/) database, CREB had a potential binding site with the MIR181C promoter (Fig. 3A). To validate this prediction, ChIP analysis was performed. The results revealed that MIR181C was more abundant in the anti-CREB group than in the anti-IgG group (Fig. 3B). Furthermore, dual-luciferase reporter assay proved that CREB overexpression increased the luciferase activity presented by MIR181C-WT but didn’t affect that of MIR181C-MUT (Fig. 3C), indicating that CREB directly bound with the upstream promoter region of MIR181C. Meanwhile, utilizing the starbase database, it was predicted that miR-181c might harbor a binding site in the 3’ (untranslated region) UTR of PDCD4 (Fig. 3D). As shown in Fig. 3E, miR-181c overexpression markedly repressed the luciferase activity presented by PDCD4-WT but didn’t affect that of PDCD4-MUT. Furthermore, as revealed by the RIP assay, PDCD4 3’UTR was more abundant in the anti-Ago2 group than the anti-IgG control (Fig. 3F). These findings confirmed that CREB transcriptionally activated miR-181c, and miR-181c could directly bind with PDCD4 promoter.

Fig. 3

CREB transcriptionally regulated miR-181c, and miR-181c directly bond with the PDCD4 promoter. (A) Predicted CREB binding sites in the promotor of MIR181C according to the JASPAR database. (B-C) ChIP and dual-luciferase reporter assays were used to confirm the relationship between CREB and MIR181C. (D) The potential binding site between MIR181C and 3’UTR of PDCD4 was predicted by starbase (E-F) The interaction between PDCD4 and miR-181c was detected by dual-luciferase reporter and RIP assays. The measurement data was presented as mean ± SD. All data was obtained from at least three replicate experiments. **P < 0.01.

Oxycodone relieved LPS-induced microglial neuroinflammation by regulating the CREB/miR-181c axis

To study the interaction between miR-181c and CREB in oxycodone-mediated relief of LPS-induced microglial neuroinflammation, miR-181c overexpression was induced in LPS-treated HMC3 cells combined with PKA (CREB activator; 5 μg/mL) and oxycodone (10 μg/mL) treatments. It was first observed that PKA treatment increased miR-181c expression in LPS-treated HMC3 cells (Fig. 4A). Meanwhile, miR-181c inhibition markedly reduced miR-181c expression in LPS-treated HMC3 cells combined with PKA, and oxycodone treatment elevated miR-181c expression in cells (Fig. 4A). Additionally, PKA treatment reduced TNF-α, IL-1β, IL-6, and IL-8 secretion levels in LPS-activated HMC3 cells (Fig. 4B). It was also observed that miR-181c knockdown significantly elevated the levels of these inflammatory cytokines in LPS and PKA co-treated HMC3 cells, and oxycodone treatment reduced TNF-α, IL-1β, IL-6, and IL-8 levels in the above-treated cells (Fig. 4B). Furthermore, PKA treatment elevated CREB phosphorylation and reduced PDCD4 and iNOS protein levels in LPS-treated HMC3 cells (Fig. 4C). However, the inhibitory effects of PKA on PDCD4 and iNOS levels were notably reversed upon miR-181c inhibition, and subsequent treatment with oxycodone promoted CREB phosphorylation and reduced the expression of PDCD4 and iNOS (Fig. 4C). Meanwhile, we used 653-47 (CREB inhibitor; 100 nM) to inhibit CREB activity and conducted the experiment again. The results showed that 653-47 treatment reduced miR-181c expression in LPS-treated HMC3 cells (Fig. S1A). Meanwhile, miR-181c overexpression markedly increased miR-181c expression in LPS-treated HMC3 cells combined with 653-47, and oxycodone treatment further elevated miR-181c expression in cells (Fig. S1A). Additionally, CREB inhibitor increased TNF-α, IL-1β, IL-6, and IL-8 secretion levels in LPS-activated HMC3 cells (Fig. S1B). It was also observed that miR-181c upregulation significantly reduced the levels of these inflammatory cytokines in LPS and 653-47 co-treated HMC3 cells, which was further reduced by oxycodone treatment in the above-treated cells (Fig. S1B). Furthermore, 653-47 treatment inhibited CREB phosphorylation and increased PDCD4 and iNOS protein levels in HMC3 cells under LPS conditions (Fig. S1C). However, the promoting effects of 653-47 on PDCD4 and iNOS levels were notably reversed upon miR-181c overexpression, and subsequent treatment with oxycodone promoted CREB phosphorylation and further reduced the expression of PDCD4 and iNOS (Fig. S1C). These findings collectively indicated that oxycodone could inhibit LPS-induced neuroinflammation in microglia through the modulation of the CREB/miR-181c axis.

Fig. 4

Oxycodone relieved LPS-induced microglial neuroinflammation by regulating the CREB/miR-181c axis. miR-181c overexpression was induced in LPS-treated HMC3 cells combined with PKA (CREB activator; 5 μg/mL) and oxycodone (10 μg/mL) treatments. (A) qRT-PCR was used to detect the expression levels of miR-181c. (B) ELISA was employed to detect TNF-α, IL-1β, IL-6, and IL-8 levels in the cell culture supernatant of HMC3 cells. (C) Western blotting was performed to detect p-CREB, CREB, PDCD4, and iNOS expression. β-Actin was used as a loading control. The measurement data was presented as mean ± SD. All data was obtained from at least three replicate experiments. *p < 0.05, **p < 0.01, ***p < 0.001.

Oxycodone relieved LPS-induced microglial neuroinflammation by regulating the CREB/miR-181c/PDCD4 axis

Both PDCD4 and miR-181c overexpression were induced in LPS-treated HMC3 cells combined with oxycodone (10 μg/mL) treatment. It was first observed that miR-181c mimics transfection significantly increased miR-181c expression in LPS-treated HMC3 cells, and PDCD4 overexpression had no significant effect on miR-181c level in HMC3 cells, which was further elevated by oxycodone treatment (Fig. 5A). Additionally, miR-181c overexpression prevented LSP-induced increase in TNF-α, IL-1β, IL-6, and IL-8 levels in HMC3 cells, whereas these changes were partially eliminated by PDCD4 overexpression, which was restored by oxycodone treatment (Fig. 5B). Moreover, LPS induced an upregulation of p-CREB in HMC3 cells, and overexpression of miR-181c or PDCD4 could not affect p-CREB level, but oxycodone alleviated the inhibitory effect of LPS on p-CREB expression. miR-181c mimics reduced iNOS, PDCD4 and p-CREB levels in LPS-treated HMC3 cells, while this effect was reversed by PDCD4 overexpression, which was further mitigated by oxycodone (Fig. 5C). In addition, both PDCD4 and miR-181c inhibition were induced in LPS-treated HMC3 cells combined with oxycodone (10 μg/mL) treatment. As shown in Fig. S2A, PDCD4 knockdown had no significant effect on miR-181c expression in LPS-treated HMC3 cells significantly, and the miR-181c level was reduced by miR-181c inhibitor, which was restored by oxycodone treatment. It also turned out that TNF-α, IL-1β, IL-6, and IL-8 levels in LPS-treated HMC3 cells were diminished following PDCD4 downregulation, while miR-181c inhibitor reversed this trend, and these above effects were eliminated by administration of oxycodone (Fig. S2B). Furthermore, PDCD4 silencing also reduced iNOS and PDCD4 protein levels in LPS-treated HMC3 cells, while this effect was reversed by miR-181c inhibition (Fig. S2C). However, additional oxycodone treatment reduced PDCD4 and iNOS levels but elevated p-CREB level in LPS-treated HMC3 cells following sh-PDCD4 and miR-181c inhibitor co-transfections (Fig. S2C). In summary, oxycodone inhibited LPS-induced neuroinflammation in microglia by regulating the CREB/miR-181c/PDCD4 axis.

Fig. 5

Oxycodone relieved LPS-induced microglial neuroinflammation by regulating the CREB/miR-181c/PDCD4 axis. HMC3 cells were transfected with miR-181c mimics and/or oe-PDCD4, then treated with LPS and oxycodone (10 μg/mL). (A) qRT-PCR was used to detect the expression levels of miR-181c. (B) ELISA was used to detect TNF-α, IL-1β, IL-6, and IL-8 in the cell culture supernatant of HMC3 cells. (C) Western blotting was performed to detect p-CREB, CREB, PDCD4, and iNOS expression. β-Actin was used as a loading control. The measurement data was presented as mean ± SD. All data was obtained from at least three replicate experiments. *p < 0.05, **p < 0.01, ***p < 0.001.

DISCUSSION

Neuroinflammation is recognized as a crucial contributor to the pathogenesis of various neurological disorders (DiSabato et al., 2016). Microglia are the main resident endogenous immune cells of the CNS and are known as the main mediators of neuroinflammation (Hanisch and Kettenmann, 2007). It’s suggested that targeting microglia-mediated neuroinflammatory response is an effective strategy to alleviate neuroinflammation. Oxycodone is a semisynthetic μ-and κ-opioid receptor, which has been extensively studied for its role in pain management (Kalso, 2005). Recently, emerging evidence suggests that oxycodone may exert additional effects beyond its analgesic properties, particularly in the context of neuroinflammation (Zhou et al., 2020). Nevertheless, the role of oxycodone in regulating inflammatory responses in microglia remains unclear. Herein, our findings showed that oxycodone administration markedly alleviated LPS-induced inflammation in microglia. Oxycodone presents anti-inflammatory properties, potentially involving modulation of inflammatory signaling pathways (Zhou et al., 2020). One such pathway that has gained considerable attention in the field is the CREB pathway (Xiao et al., 2021). Activated CREB controls the transcription of numerous genes and is involved in a variety of physiological functions, including inflammation and neuronal survival (Wen et al., 2010). Recent studies have shown a potential link between CREB and neuroinflammation, suggesting that targeting the CREB pathway may offer therapeutic benefits for neuroinflammatory conditions (Li et al., 2022; Newton and Dixit, 2012). In this study, it was observed that LPS treatment reduced p-CERB level in microglia, which was abrogated by oxycodone treatment. In addition, our findings provided evidence that oxycodone attenuated inflammation in microglia by modulation of the CREB/miR-181c/PDCD4 axis.

MiRNAs are short non-coding RNA molecules that play an important function in gene control after transcription (Lu and Rothenberg, 2018). miR-181c, a member of the miR-181 family, has emerged as a key regulator of various biological processes, including neuroinflammation (Ge et al., 2019; Song et al., 2019; Yu et al., 2021). As evidence, miR-181c downregulation promoted NF-κB activity and inflammatory responses in microglia (Yin et al., 2017). Herein, the role of oxycodone-mediated relief of neuroinflammation was studied. Our findings demonstrated that oxycodone treatment upregulated miR-181c in LPS-activated microglia. This upregulation of miR-181c was accompanied by a decrease in the release of pro-inflammatory cytokines induced by LPS, including TNF-α, IL-1β, IL-6, and IL-8. These results indicated that oxycodone exerted anti-inflammatory effects in microglia by upregulating miR-181c. Furthermore, we identified CREB as a potential regulator of miR-181c. Subsequent experiments provided evidence supporting the involvement of the CREB/miR-181c axis in the anti-inflammatory effects of oxycodone in microglia. Therefore, our results confirmed that oxycodone may exert anti-neuroinflammatory effects by upregulating CREB phosphorylation and promoting its combination with the MIR181C promoter region, consequently upregulating miR-181c.

PDCD4 is a tumor-suppressor gene implicated in various cellular processes, including inflammation and cell survival. Dysregulation of PDCD4 expression was often observed in neuroinflammatory conditions (Chen et al., 2022; Yan et al., 2017). In this study, it was observed that oxycodone treatment suppressed PDCD4 and iNOS expressions in LPS-activated microglia. We subsequently identified PDCD4 as a target of miR-181c. In this study, it was observed that oxycodone treatment suppressed PDCD4 and iNOS expressions in LPS-activated microglia. We subsequently identified PDCD4 as a target of miR-181c. However, as shown in Fig. S2, LPS treatment significantly increased PDCD4 expression in HMC3 cells, while this effect of LPS was weakened by PDCD4 knockdown. In addition, the level of PDCD4 in the LPS + sh-PDCD4 group was slightly upregulated compared to the Control group. This may be due to the induction of LPS on the non-knockout part of PDCD4. We used sh-PDCD4 to knock down the gene in HMC3 cells but did not completely knock out its expression. The expression of PDCD4 that could not be knocked out was upregulated due to the downregulation of miR-181c, which relieved the inhibitory effect of miR-181c on PDCD4 expression. Similar research can also be found in a previous study (Yang et al., 2023). Collectively, the miR-181c/PDCD4 axis acted as a regulatory mechanism for the anti-neuroinflammation effects of oxycodone.

In conclusion, our study unveiled that oxycodone modulates the CREB/miR-181c/PDCD4 axis to attenuate neuroinflammation in microglia activated by LPS. Oxycodone treatment promoted CREB phosphorylation, restored miR-181c expression, inhibited the expression of PDCD4 and iNOS, and reduced the release of pro-inflammatory cytokines.

While our study provided valuable insights into the role of oxycodone in modulating the CREB/miR-181c/PDCD4 axis to exert anti-neuroinflammatory effects, it was important to acknowledge certain limitations that should be addressed in future research. Our study relied primarily on in vitro experiments to investigate the effects of oxycodone on neuroinflammation. Although these models lay a solid foundation for understanding the underlying mechanisms, translating these findings to human subjects may pose complexities. Thus, conducting clinical studies involving human participants is crucial to validate the relevance and applicability of our results. Additionally, the intricate interplay between various cellular and molecular pathways involved in neuroinflammation suggests that other signaling molecules and regulatory factors might influence the CREB/miR-181c/PDCD4 axis. Exploring these additional factors and their interactions may offer a more complete knowledge of the underlying processes driving the anti-neuroinflammatory effect of oxycodone.

Funding

The research was surportted by Basic scientific research funds for colleges and universities in Heilongjiang Province (2023-KYYWF-0602) to QingDong Wang and Heilongjiang Provincial Health Commission scientific research topic (2020-344) to Rongjia Zang.

Conflict of interest

The authors declare that there is no conflict of interest.

REFERENCES
 
2024 The Japanese Society of Toxicology
feedback
Top