The Journal of Toxicological Sciences
Online ISSN : 1880-3989
Print ISSN : 0388-1350
ISSN-L : 0388-1350
Original Article
Mechanism of luteolin induces ferroptosis in nasopharyngeal carcinoma cells
Zhiyi Wu, Qingsong Qu
著者情報
ジャーナル フリー HTML

2024 年 49 巻 9 号 p. 399-408

詳細
Abstract

Nasopharyngeal carcinoma (NPC) originates from the nasopharynx epithelium, and luteolin is recognized as an important anti-cancer agent. This study investigated the effects of luteolin on ferroptosis in NPC cells. NPC cells were cultured and exposed to varying concentrations of luteolin. Cell viability, malondialdehyde (MDA) levels, superoxide dismutase (SOD) activity, glutathione (GSH) levels, Fe2+ concentration, and glutathione peroxidase 4 (GPX4) protein level were assessed. Additionally, SRY-related high-mobility-group box 4 (SOX4) expression was measured. Subsequently, the binding of SOX4 to the growth differentiation factor-15 (GDF15) promoter and GDF15 mRNA levels were evaluated. The impact of the SOX4/GDF15 axis on luteolin-induced ferroptosis in NPC cells was assayed. Luteolin treatment induced cell ferroptosis, evidenced by decreased cell viability, increased MDA and Fe2+ levels, and reduced SOD, GSH, and GPX4 levels. Furthermore, luteolin downregulated SOX4 expression, while overexpression of SOX4 reversed luteolin’s pro-ferroptotic effects in NPC cells. SOX4 was found to up-regulate GDF15 transcription by directly binding to its promoter. Conversely, overexpression of GDF15 mitigated the ferroptotic effects induced by luteolin in NPC cells. Therefore, luteolin induces ferroptosis in NPC cells via modulation of the SOX4/GDF15 axis. In conclusion, luteolin reduces the binding of SOX4 to the GDF15 promoter by suppressing SOX4 expression, thereby down-regulating GDF15 transcription levels and inducing ferroptosis in NPC cells.

INTRODUCTION

Nasopharyngeal carcinoma (NPC), a rare malignancy arising from the epithelial cells of the nasopharyngeal mucosal lining, is primarily influenced by a complex interplay of genetic, ethnic, and environmental factors (Chen et al., 2019). Ferroptosis, characterized by iron-dependent oxidative cell death, involves intracellular lipid peroxidation and the accumulation of reactive oxygen species (ROS) (Tang et al., 2021). Notably, luteolin may exert its anti-cancer effects by promoting a substantial increase in Fe2+ levels, thereby inducing ferroptosis and cancer cell death (Han et al., 2022). Despite the use of platinum-based multidrug chemotherapy as the standard treatment for NPC, chemotherapy resistance remains a significant obstacle for patients (Guan et al., 2020). Thus, gaining insights into the molecular mechanism of NPC and the role of ferroptosis is essential for improving treatment outcomes.

Luteolin is a phenolic phytochemical with notable anti-cancer properties, primarily functioning to induce apoptosis, activate cell cycle arrest, inhibit angiogenesis and metastasis, and prevent cell proliferation (Prasher et al., 2022). Several studies have underscored luteolin’s significant anti-cancer effects in lung cancer (Jiang et al., 2021), breast cancer (Tsai et al., 2021), colon cancer (Esmeeta et al., 2022), and NPC (Xiong et al., 2022). Research has indicated that promoting ferroptosis may offer a therapeutic approach for NPC (Li et al., 2022). Luteolin has been demonstrated to induce autophagy and enhance ferroptosis in prostate cancer cells (Fu et al., 2024). Nonetheless, the impact of luteolin on ferroptosis in NPC cells is not well-documented.

Luteolin treatment suppresses cancer cell growth by inhibiting the expression of oncogenes (Liu et al., 2017). In NPC, the SRY-box transcription factor 4 (SOX4) is highly expressed, but its levels decrease under drug treatment (Bissey et al., 2020; Xiong et al., 2021). SOX4 serves as a developmental transcription factor, overseeing cell differentiation and development, promoting the transition from stem cell and epithelial to mesenchymal cells, and aiding in the early differentiation of progenitor cells (Moreno, 2020). In cancer, SOX4 functions as an oncogenic factor, driving cancer cell proliferation, migration, and invasion (Hanieh et al., 2020). Furthermore, evidence suggests that SOX4 may be involved in cancer progression by regulating ferroptosis (Yu et al., 2019). However, the specific mechanism by which SOX4 contributes to ferroptosis in NPC has yet to be determined.

Importantly, the JASPAR database predicted that SOX4 can bind to the promoter region of growth differentiation factor-15 (GDF15). GDF15, part of the transforming growth factor ß superfamily, is a stress response cytokine that is significantly upregulated in malignant tumors (Siddiqui et al., 2022). GDF15 is implicated in cancer development by promoting cancer cell invasion, epithelial-mesenchymal transition, and metastasis (Spanopoulou and Gkretsi, 2020). Additionally, the knockout of GDF15 has been shown to enhance erstin-induced ferroptosis, thereby increasing the death of gastric cancer cells (Chen et al., 2020). Furthermore, knocking down GDF15 can increase the radiosensitivity of NPC cells and improve the effectiveness of chemotherapy (Chang et al., 2007).

This study explores the impact of luteolin on ferroptosis of NPC cells via the SOX4/GDF15 axis. We aimed to identify novel therapeutic approaches for NPC.

MATERIALS AND METHODS

Cell culture and treatment

Human NPC cell lines (NPC53, HNE3) obtained from ATCC (Manassas, VA, USA) were cultured in RPMI 1640 medium (Gibco, Grand Island, NY, USA). The medium was supplemented with 10% fetal bovine serum (FBS, Gibco), penicillin (100 U/mL), and streptomycin (100 μg/mL), and maintained at 37°C with 5% CO2.

After 24 hr of cell culture, the cells were seeded in a 96-well plate and transfected with oe-SOX4, oe-GDF15, and their respective negative controls using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. Subsequent experiments were conducted 24 hr after cell transfection. The full-length complementary DNA (cDNA) of SOX4 (Accession number NM_003107) and GDF15 (Accession number NM_004864) were cloned into the pcDNA3.1 vector (V79520, Invitrogen) to create overexpression vectors for SOX4 and GDF15 (oe-SOX4 and oe-GDF15), with the pcDNA3.1 empty vector (oe-NC) used as a negative control.

Luteolin (Sigma-Aldrich, St Louis, MO, USA; L9283-10MG, purity ≥ 98%) was dissolved in dimethyl sulfoxide (Sigma-Aldrich; purity 99.7%) and stored at a concentration of 100 mM at -20°C. The cells were seeded into a 96-well plate (density of 1.5 × 104 cells/well) and treated with luteolin at different concentrations (15-60 μM) for 24, 48, and 72 hr. The cells were divided into the following groups: Control group (cells without any treatment), Lut group (cells treated with 30 μM luteolin for 48 hr), Lut + oe-NC group (cells transfected with oe-NC for 24 hr followed by treatment with 30 μM luteolin for 48 hr), Lut + oe-SOX4 group (cells transfected with oe-SOX4 for 24 hr followed by treatment with 30 μM luteolin for 48 hr), and Lut + oe-GDF15 group (cells transfected with oe-GDF15 for 24 hr followed by treatment with 30 μM luteolin for 48 hr).

Cell counting kit-8 (CCK-8) method

The proliferation ability of cells was detected using the CCK-8 (KeyGEN, Nanjing, China). Briefly, cells were seeded into a 96-well plate (density of 2 × 103 cells/well) for 48 hr. Following this, 10 μL of CCK-8 reagent solution was added to each well, and the cells were incubated at 37°C for an additional 4 hr. The absorbance at 450 nm was then measured using a microplate reader (Bio-Rad, Hercules, CA, USA).

Measurement of iron content, glutathione (GSH), malondialdehyde (MDA), and superoxide dismutase (SOD)

Cells (1 × 105) were collected from each group, lysed, and centrifuged to obtain the supernatant. The supernatant was mixed with an iron detection agent and incubated for 30 min at room temperature. The iron content was determined using the intracellular iron colorimetric assay kit (ab83366, Abcam, Cambridge, MA, USA). SOD activity was assessed using the NBT SOD kit (S0109, Beyotime, Shanghai, China). Furthermore, MDA and GSH levels were measured using MDA (S0131S, Beyotime) and GSH (S0053, Beyotime) detection kits, respectively. Absorbance was read using a microplate reader (Perlong, Beijing, China). All reagent kits were used following the manufacturer's instructions.

Chromatin immunoprecipitation (ChIP)

The JASPAR database (https://jaspar.genereg.net/) (Castro-Mondragon et al., 2022) was utilized to predict the binding sites between SOX4 and the GDF15 promoter (Sequence ID: NC_000019.10:18384158-18386158, Start:1619, End:1628). The ChIP assay was performed using EZ-Magna ChIP kits (17-408, EMD Millipore, Billerica, MA, USA) following the manufacturer’s instructions. Cells (1 × 107) were treated with 1% formaldehyde (FB002, Thermo Fisher Scientific, Waltham, MA, USA) for 10 min prior to sonication. The supernatant was incubated with either an anti-SOX4 antibody (1:200, ab86809, Abcam) or an anti-immunoglobulin G antibody (1:100, ab172730, Abcam) at 4°C overnight, followed by a 3-hr incubation with protein A/G agarose beads (78609, Thermo Fisher Scientific) at 4°C. After elution, the enriched complex was collected, centrifuged at 12,000 × g for 5 min, and the supernatant was discarded. The non-specific complex was rinsed, followed by overnight de-crosslinking at 65°C and purification using phenol/chloroform extraction to recover DNA fragments. The enriched promoter fragments were purified for analysis. Quantitative polymerase chain reaction (qPCR) was performed using the primers shown in Table 1.

Table 1. PCR primer sequence

Gene Sequence (5’-3’)
SOX4 F: CCTTTCATTCGAGAGGCGGA
R: GTTGCCGGACTTCACCTTCT
GDF15 F: GCAAGAACTCAGGACGGTGA
R: TGGAGTCTTCGGAGTGCAAC
GAPDH F: GTCAAGGCTGAGAACGGGAA
R: TCGCCCCACTTGATTTTGGA
GDF15 promoter F: ACACATCAAGGTTGCCCTTCC
R: TCCCATGGGCATAGACAGCCA

Dual-luciferase assay

Based on the predicted results, oligonucleotides covering the wild-type (WT) (TCCTTTGTTT) or mutant (MUT) (TGGAAACAAT) binding sites in the GDF15 promoter were chemically synthesized, with SacI and XhoI restriction endonuclease cleavage sites at both ends. The sequences were subsequently inserted into the SacI and XhoI sites of the pGL3-Promoter Vector (E1751, Promega, Madison, WI, USA). The recombinant dual-luciferase reporter plasmids were designated as GDF15-WT and GDF15-MUT. Thereafter, 200 ng of the plasmid, 20 ng of the phRL-TK plasmid carrying the Renilla luciferase gene, and oe-SOX4 or oe-NC were co-transfected into the cells using Lipofectamine 3000 (Invitrogen). After 48 hr, luciferase activity was measured using a dual-luciferase reporter kit (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity.

Reverse-transcription-qPCR (RT-qPCR)

Total RNA was extracted from the cells using TRIzol reagent (Invitrogen). Subsequently, 2 µg of total RNA was reverse transcribed into cDNA using a cDNA synthesis kit (K1622, Thermo Fisher Scientific). Real-time PCR was performed using SYBR Green reagent (Applied Biosystems, Foster City, CA, USA). The reaction conditions were as follows: denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 30 sec, for a total of 39 cycles. RT-qPCR analysis was carried out using the ABI StepOne sequence detection system (Applied Biosystems). The PCR primer sequences are provided in Table 1. The results were calculated using the 2-ΔΔCt method (Livak and Schmittgen, 2001) with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) used as the control gene.

Western blot (WB) assay

Cells (1 × 105) were lysed in radioimmunoprecipitation assay lysis buffer (Thermo Fisher Scientific) and incubated at 4°C for 10 min. After sonication for 20 sec, the lysates were centrifuged to obtain the supernatant, and the protein concentration was determined using the Bio-Rad DC protein assay. Twenty micrograms (20 μg) of protein were loaded onto a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the separated proteins were transferred onto polyvinylidene fluoride membranes. Membranes were blocked with 5% skimmed milk in Tris-buffered saline Tween-20 and then probed with primary antibodies overnight at 4°C: anti-SOX4 (1:1000, MBS6010222, MyBioSource, San Diego, CA, USA), anti-GDF15 (1:100, ab180929, Abcam), anti-GPX4 (1:1000, ab125066, Abcam), and anti-β-actin (1:1000, ab8227, Abcam). Following primary antibody incubation, membranes were washed and incubated with secondary antibodies (1:2000, ab205718, Abcam). Protein bands were detected using Clarity Western enhanced chemiluminescence substrate reagent (Bio-Rad), imaged with a Bio-Rad Image Analysis system (Bio-Rad), and quantified using Quantity One v4.6.2 software (Bio-Rad). The relative protein content was determined by normalizing the intensity of each protein band to that of β-actin protein band.

Statistical analysis

Statistical analyses and data visualization were conducted using SPSS21.0 statistical Software (IBM, Armonk, NY, USA) and GraphPad Prism 8.0 software (GraphPad Software Inc., San Diego, USA). To ensure data robustness, normality and homogeneity of variance tests were performed, confirming adherence to normal distribution and variance homogeneity assumptions. Comparisons between two groups were assessed using the t test, whereas one-way or two-way analysis of variance (ANOVA) was employed for comparisons among multiple groups. Tukey’s multiple comparisons test was used for post hoc analyses, with statistical significance set at p < 0.01.

RESULTS

Luteolin induced ferroptosis in NPC cells

Luteolin is known for its cytotoxic effects on various cancer cells. In our study, NPC53 and HNE3 cells were exposed to luteolin concentration ranging from 15 to 60 μM for 24, 48, and 72 hr. The results demonstrate that luteolin significantly decreased cell proliferation in a dose- and time-dependent manner (p < 0.01, Fig. 1A). Based on these findings, we selected 30 μM luteolin for a 48-hr treatment of cells. Post-treatment, we observed significant increases in intracellular iron content (p < 0.01, Fig. 1B) and MDA levels (p < 0.01, Fig. 1C), along with decreased GPX4 expression (p < 0.01, Fig. 1D), as well as reduced SOD activity and GSH content (p < 0.01, Fig. 1E, F). These findings collectively suggest that luteolin induces ferroptosis in NPC cells.

Fig. 1

Luteolin induced ferroptosis in NPC cells. NPC cell lines NPC53 and HNE3 were treated with different concentrations of luteolin for different durations. (A): Cell viability under different treatments was detected by CCK-8 and the concentration and time for best efficiency was selected. (B): The iron content in cells was calculated by iron colorimetric assay kit. (C): The MDA level in cells was detected by the MDA detection kit. (D): The protein expression of GPX4 in cells was detected by WB assay. (E): The SOD activity in cells was detected by the NBT SOD kit. (F): The GSH level in cells was measured by the GSH detection kit. Experiments were repeated three times. Data are expressed as mean ± SD. Data comparisons among multiple groups were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons post hoc tests. ** p < 0.01.

Luteolin inhibited the expression of SOX4

Previous studies have demonstrated luteolin’s ability to inhibit gene expression (Liu et al., 2017), including the modulating of SOX4 by other drugs (Ge et al., 2017; Xiong et al., 2021). Notably, SOX4 is highly expressed in NPC (Bissey et al., 2020; Jiang et al., 2017; Shi et al., 2015). Given these observations, we hypothesized that SOX4 is a potential target gene of luteolin. Subsequently, we evaluated SOX4 expression following luteolin treatment and observed a significant decrease with increasing luteolin concentration and treatment duration (p < 0.01, Fig. 2A, B). These findings strongly suggest that luteolin inhibits SOX4 expression in NPC cells.

Fig. 2

Luteolin inhibited the expression of SOX4. NPC cell lines NPC53 and HNE3 were treated with different concentrations of luteolin for different durations. (A-B): The SOX4 expression was detected by RT-qPCR and WB assay. Experiments were repeated three times. Data are expressed as mean ± SD. Data comparisons among multiple groups were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons post hoc tests. ** p < 0.01.

Luteolin induced ferroptosis by inhibiting the expression of SOX4

To investigate whether luteolin affects ferroptosis in NPC cells by inhibiting the expression of SOX4, we upregulated SOX4 expression in NPC cells (p < 0.01, Fig. 3A, B) and subsequently treated the cells with 30 μM luteolin for 48 hr. Following SOX4 overexpression, we observed increased cell viability (p < 0.01, Fig. 3C), as well as decreased intracellular iron content and MDA level (p < 0.01, Fig. 3D, E). Additionally, GPX4 protein expression was increased (p < 0.01, Fig. 3B), and there was an enhancement in both SOD activity and GSH content (p < 0.01, Fig. 3F, G). These findings collectively suggest that luteolin induces ferroptosis in NPC cells by modulating SOX4 levels.

Fig. 3

Luteolin induced ferroptosis by inhibiting the expression of SOX4. NPC53 and HNE3 cells were transfected with oe-SOX4 and then treated with 30 μM luteolin for 48 hr. (A): The mRNA level of SOX4 in cells was detected by RT-qPCR. (B): The protein expression of SOX4 and GPX4 in cells was detected by WB assay. (C): Cell viability under different treatments was detected by CCK-8. (D): The iron content in cells was calculated by the iron colorimetric assay kit. (E): MDA level in cells was detected by the MDA detection kit. (F): The SOD activity was detected by the NBT SOD kit. (G): GSH level in cells was detected by GSH detection kit. Experiments were repeated three times. Data are expressed as mean ± SD. Data comparisons among multiple groups were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons post hoc tests. ** p < 0.01.

SOX4 up-regulated GDF15 transcription by binding to the GDF15 promoter

SOX4 exerts its transcriptional functions in gene activation (Lee et al., 2016; Li et al., 2020). Using the JASPAR database, we predicted the binding relationship between SOX4 and the GDF15 promoter (Fig. 4A). Previous studies have shown that GDF15 knockdown promotes erstin-induced ferroptosis (Chen et al., 2020) and enhances the radiosensitivity of NPC cells (Chang et al., 2007). Our ChIP assay demonstrated enrichment of SOX4 on the GDF15 promoter, with reduced enrichment following luteolin treatment, while overexpression of SOX4 increased enrichment (p < 0.01, Fig. 4B). This binding relationship was further confirmed by dual-luciferase assay, showing enhanced luciferase activity (p < 0.01, Fig. 4C). Furthermore, GDF15 transcription levels decreased with increasing luteolin concentration and treatment duration but increased upon SOX4 overexpression (p < 0.01, Fig. 4D). In conclusion, SOX4 up-regulates GDF15 transcription by directly binding to its promoter.

Fig. 4

SOX4 up-regulated GDF15 transcription by binding to the GDF15 promoter. (A): The binding site between SOX4 and the GDF15 promoter was predicted by JASPAR database. (B): The binding relationship between SOX4 and the GDF15 promoter was analyzed by ChIP. (C): The binding relationship between SOX4 and the GDF15 promoter was analyzed by dual-luciferase assay. (D): The mRNA level of GDF15 was measured by RT-qPCR. Experiments were repeated three times. Data are expressed as mean ± SD. Data comparisons among multiple groups were analyzed by two-way ANOVA, followed by Tukey’s multiple comparisons post hoc tests. ** p < 0.01.

Overexpression of GDF15 inhibited luteolin-induced ferroptosis

To investigate the role of GDF15 in luteolin-induced ferroptosis in NPC cells, we up-regulated GDF15 expression (p < 0.01, Fig. 5A-B), followed by treatment with 30 μM luteolin for an additional 48 hr. Upon GDF15 overexpression, we observed a significant increase in NPC cell viability (p < 0.01, Fig. 5C) and a decrease in ferroptosis (p < 0.01, Fig. 5B, D-G). These findings collectively suggest that luteolin induces ferroptosis in NPC cells by modulating the SOX4/GDF15 axis.

Fig. 5

Overexpression of GDF15 inhibited luteolin-induced ferroptosis. HNE3 cells were transfected with oe-GDF15 and then treated with 30 μM luteolin for 48 hr. (A): The mRNA level of GDF15 in cells was detected by RT-qPCR. (B): The protein expression of GDF15 and GPX4 in cells was detected by WB assay. (C): Cell viability under different treatments was measured by CCK-8. (D): The iron content was calculated by the iron colorimetric assay kit. (E): MDA level in cells was detected by the MDA detection kit. (F): SOD activity was detected by NBT SOD kit. (G): GSH level in cells was measured by GSH detection kit. Experiments were repeated three times. Data are expressed as mean ± SD; comparison between the two groups in panel A was analyzed by t test; comparisons among multiple groups in panel B were analyzed by two-way ANOVA; comparisons among multiple groups in panels C-G were analyzed by one-way ANOVA, followed by Tukey’s multiple comparisons post-hoc tests. ** p < 0.01.

DISCUSSION

The promotion of ferroptosis has the potential to eliminate radiation resistance in tumor cells, thereby increasing radiosensitivity and improving the efficacy of radiotherapy and the prognosis of NPC patients (Li et al., 2021). Luteolin’s anti-cancer mechanism primarily involves inhibiting tumor cell proliferation, metastasis, invasion, and angiogenesis, as well as inducing apoptosis in cancer cells (Çetinkaya and Baran, 2023). Our study is the first to elucidate the role and mechanism of luteolin in ferroptosis in NPC: luteolin induces ferroptosis in NPC cells by inhibiting SOX4 expression, diminishing SOX4 binding at the GDF15 promoter, and down-regulating GDF15 transcription.

Luteolin plays a significant anti-cancer role by enhancing lipid peroxide and reducing levels of SOD, GPX, and GSH (Kasala et al., 2016). Its effects on inducing ferroptosis in cancers have been substantiated by numerous studies. For example, a combination of luteolin and erastin was found to induce ferroptosis in colon cancer cells, as evidenced by reduced GPX4 expression and increased lipid peroxides (Zheng et al., 2023b). Furthermore, luteolin significantly inhibited the growth of clear cell renal cell carcinoma by increasing Fe2+ levels in tumor tissue, inducing MDA production, and depleting GSH and SOD (Han et al., 2022). In line with these observations, our study revealed that luteolin significantly inhibited the proliferation of NPC cells. Treatment with luteolin at 30 μM for 48 hr led to increased iron content and MDA levels in NPC cells, while the expression of ferroptosis-related proteins (GPX4, SOD, GSH), previously overexpressed in NPC cells, was reduced.

SOX4 is a tumor promoter that is highly expressed in NPC cells, facilitating epithelial-mesenchymal transition and reducing cisplatin sensitivity in these cells (Shi et al., 2015). Inhibiting SOX4 expression has been shown to decrease the viability, migration, and invasion of NPC cells, as well as suppress chemoresistance (Cao et al., 2022). Previous research has highlighted the involvement of the SOX family in cancer through ferroptosis. For instance, SOX2 knockdown significantly reduced cysteine and GSH levels, while increasing lipid ROS levels and ferroptosis susceptibility in lung cancer cells (Wang et al., 2021). Up-regulation of SOX15 promotes ROS production and accelerates ferroptosis in prostate cancer by enhancing the transcription of amine oxidase copper-containing 1 (Ding et al., 2022). In this study, SOX4 overexpression led to decreased iron content and MDA level, and increased levels of GPX4, SOD, and GSH levels in NPC cells, thereby reducing ferroptosis. We observed that luteolin inhibited SOX4 expression in a time- and dose-dependent manner. Notably, in colorectal cancer, luteolin has been shown to inhibit CREB1 expression at the transcriptional level in a dose-dependent manner (Liu et al., 2017). Further validation is required to determine whether luteolin suppresses SOX4 expression at the transcriptional level in NSCLC. Moreover, luteolin can influence the expression of downstream factor expression by modulating circRNA or miRNA expression in various cancers (Gao et al., 2019; Moeng et al., 2020; Pan et al., 2022; Wang et al., 2024; Zheng et al., 2023a). Thus, it is plausible that luteolin’s inhibitory effect on SOX4 may involve ceRNA mechanisms.

Predictions from the JASPAR database suggested that SOX4 could bind to the GDF15 promoter, a finding confirmed by double-luciferase and ChIP assay. SOX4 was shown to increase the transcription level of GDF15. GDF15, a ferroptosis-related factor, is notably expressed in colorectal cancer tumor tissues (Shao et al., 2021). Knocking down GDF15 knockdown induced ferroptosis in NPC cells, indicated by reduced GSH levels and elevated ROS levels (Chen et al., 2020). Furthermore, we confirmed that overexpression of GDF15 counteracted the ferroptosis-promoting effect of luteolin by increasing NPC cell viability and reducing ferroptosis. GDF15 is a key target gene of p53 (Bauskin et al., 2010), and luteolin induces apoptosis and autophagy while arresting the cell cycle of colon cancer cells in a p53-dependent manner (Yoo et al., 2022). We speculate that GDF15 might be a potential signaling pathway for luteolin treatment in NPC, a hypothesis that requires further evidence in future studies.

Our study has some limitations. First, we focused on a single mechanism of luteolin, and it remains whether luteolin influences other factors involved in ferroptosis. Second, our research was confined to cell experiments, lacking validation and exploration at the animal level. The selection of cell density and luteolin concentration was limited by experimental funding. Third, we did not detect GDF15 protein expression. Fourth, we did not examine other downstream target genes of SOX4 that might be relevant to NPC. Finally, the effects of luteolin on other cancer cell behaviors through the SOX4/GDF15 axis are not well understood. In future research, we will adjust cell density, luteolin concentration, and treatment duration to determine optimal experimental conditions, validate our mechanism in vivo, and investigate other downstream mechanisms of SOX4. This will enhance our theoretical knowledge of the treatment of NPC.

In conclusion, our study demonstrated that luteolin inhibits SOX4 expression, elevates the ferroptosis level in NPC cells, and exerts anti-cancer effects. The underlying mechanism may involve luteolin decreasing the binding of SOX4 to the GDF15 promoter and reducing the transcription level of GDF15, thereby promoting ferroptosis and exerting its anti-cancer effects.

Conflict of interest

Zhiyi Wu and Qingsong Qu declare that there is no conflict of interest.

REFERENCES
 
2024 The Japanese Society of Toxicology
feedback
Top